View PDF - Australasian Plant Pathology Society

APPS 2009 

Plant Health Management: 

An Integrated Approach 

29 September – 1 October 2009 

Newcastle City Hall 

ISBN 978‐0‐646‐52919‐6 

Contents 

Welcome........................................................................................... 2 

Conference Organising Committee................................................... 2 

Sponsors ........................................................................................... 3 

Exhibitors.......................................................................................... 4 

Conference information ................................................................... 5 

General information ......................................................................... 5 

Social program.................................................................................. 6 

The McAlpine lecture........................................................................ 8 

Keynote biographies......................................................................... 9 

Venue map...................................................................................... 10 

Program .......................................................................................... 12 

Oral abstracts.................................................................................. 19 

Poster abstracts ............................................................................ 123 

List of posters ............................................................................... 124

Welcome 

On behalf of the Local Organising Committee welcome to 

Newcastle and the 17th Australasian Plant Pathology Society 

Conference, an event that marks the 40th (or Ruby) anniversary 

of the Australasian Plant Pathology Society. It provides us with a 

good opportunity to reflect on the achievements of our 

profession over four decades of unprecedented discovery about 

the nature and management of plant disease. It is also a time to 

ponder the directions of our profession amidst the challenges 

posed by emerging and persistent plant diseases, food security, 

climate change, water shortages, rising atmospheric carbon 

dioxide levels, bioterrorism, consumer safety and preferences, 

and the opportunities presented to agriculture and horticulture 

by biofuels, phytomedicines and leisure activities. 

The conference theme ‘Plant Health Management: an 

integrated approach’ addresses these challenges from three 

angles—fundamental discovery, the application of these 

discoveries to practical problems and the adoption of research. 

Local and international keynote speakers have been invited to 

challenge you with their perspectives on the big questions in 

plant pathology. Many of you will have already been challenged 

by, and enjoyed, the supporting program of workshops and field 

trips. 

Newcastle is a bustling, historic, post‐industrial seaside city 

boasting exciting cultural activities, superb beaches, and other 

nearby attractions including the Hunter Valley, Barrington Tops 

National Park and more superb coastal scenery. Please take 

time to enjoy the location, catch up with friends and colleagues, 

meet new ones, and return home invigorated, wiser and happy. 

Conference Organising 

Committee 

• David Guest, Convenor 

• Rosalie Daniel 

• Robert Park 

• Peter Magee 

• Nerida Donovan 

• Len Tesoriero 

• Angus Carnegie 

• Chris Steel 

• Gavin Ash 

Workshop Convenors 

Microbial ecology—concepts and techniques for disease control 

—Kerry Everett 

Tree Pathology Workshop 

—André Drenth and Angus Carnegie 

Magical Mystery Vegetable Tour 

—Len Tesoriero and Nerida Donovan 

Biology and management of organisms associated with bunch 

rot diseases of grapes—Chris Steel 

David Guest 

Conference Convenor, APPS 2009 

Conference Secretariat 

Conference Logistics* 

PO Box 6150 

Kingston ACT 2604 

02 6281 6624 [ph] 

02 6285 1336 [fx] 

0448 576 105 [mobile] 

conference@conlog.com.au 

www.apps2009.org.au 

*acting as agent for APPS 

2 PLANT HEALTH MANAGEMENT: AN INTEGRATED APPROACH | APPS 2009

Sponsors 

The Local Organising Committee gratefully acknowledges the support of our sponsors: 

Conference sponsors 

Grains Research and Development 

Corporation 

HAL 

Gold sponsor 

APPS 

Silver sponsor 

Nufarm Australia and BASF 

Welcome Reception 

Cooperative Research Centre for 

National Plant Biosecurity 

International speaker and 

post‐conference tour sponsor 

Grape and Wine Research and 

Development Corporation 

Keynote speaker 

Forest and Wood Products Australia 

Limited 

Lunch, Day 2 

Agrichem 

Supporters 

Plant Health 

Australia 

Lomb Scientific 

AusVeg 

The Crawford Fund 

Mars 

The University of 

Sydney 

APPS 2009 | PLANT HEALTH MANAGEMENT: AN INTEGRATED APPROACH 3

Exhibitors 

APPS 

Nufarm 

The Australasian Plant Pathology Society is dedicated to the 

advancement and dissemination of knowledge of plant pathology and its 

practice in Australasia. Australasia is interpreted in the broadest sense to 

include not only Australia, New Zealand and Papua New Guinea, but also 

the Indian, Pacific and Asian regions. Although the Society’s activities are 

mainly focused on the Australasian region, many of the activities of our 

members are of international importance and significance. 

The Society was founded in 1969. Our members represent a broad range 

of scientific interests, including research scientists, teachers, students, 

extension professionals, administrators, industry and pest management 

personnel. 

FOR MORE INFORMATION: 

Dr Peter Williamson 

Business Manager 

APPS Inc 

Telephone (07) 4632 0467 

Facsimile (07) 46378326 

www.appsnet.org 

Nufarm Australia Limited and the link with BASF Australia Limited. 

Nufarm has become a successful crop protection company based in 

Australia but now with global activities that place it at number eight in 

the global ranking of agrochemical companies. The Nufarm head office is 

based at Laverton North in Victoria. 

In 2004 Nufarm entered into an agreement with BASF Australia Limited 

for Nufarm to market and develop BASF products within Australia. BASF 

has an excellent record for developing new horticultural products , 

especially the discovery of new fungicides. 

For further information on the Nufarm/BASF range of products contact: 

doug.wilson@au.nufarm.com 


Doug Wilson 

R&D Projects Co‐ordinator 

Nufarm Australia Limited 

Telephone (03) 9282 1427 

Facsimile (03) 9282 1022 

Mobile 0427 806 386 

e‐mail: doug.wilson@au.nufarm.com 

Leica Microsystems 

Leica Microsystems is a leading global designer and producer of 

innovative high‐tech precision optics systems for the analysis of 

microstructures. 

It comprises 11 manufacturing facilities in eight countries, sales and 

service companies in 20 countries and an international network of 

dealers; the company is also represented in over 100 countries and the 

international headquarters are based in Wetzlar, Germany. 

Leica Microsystems is one of the market leaders in each of the fields of 

microscopy, confocal laser scanning microscopy, microscope software, 

specimen preparation and medical equipment. The company 

manufactures a broad range of products for numerous applications 

requiring microscopic imaging, measurement and analysis. It also offers 

system solutions in the areas of life science, including biotechnology and 

medicine, as well as the science of raw materials and industrial quality 

assurance. 

Specific to this conference, we will be displaying automated compound 

and stereoscopic microscopes highlighting our imaging systems using 

Montage, multifocus 3D imaging and Web Module allowing viewing and 

analysis of images from a remote station via internet. 


1800 625 286 [ph] 

www.leica‐microsystems.com 

Leica Microsystems Pty Ltd 

Unit 3, 112‐118 Talavera Road 

NORTH RYDE NSW 2113 


Conference information 

Registration desk 

The registration desk is located in the Concert Hall Foyer of City 

Hall. Please direct any questions you may have regarding 

registration, attendance, accommodation or social functions to 

the staff at this desk. The registration desk will be open during 

the following hours: 

Monday 28 September 1730–1900 (Newcastle Art Gallery) 

Tuesday 29 September 0800–1900 

Wednesday 30 September 0800–1730 

Thursday 1 October 0800–1730 

The registration desk can be contacted during these hours on 

0448 576 105. 

Name badges 

Your name badge is your entry to all sessions, exhibition, lunches 

and morning and afternoon teas. Please wear it at all times. 

Catering 

Morning and afternoon teas and lunches will be held in the 

Banquet Room, which is located on the ground floor of City Hall. 

Lunches will be served as an informal stand‐up buffet. We have 

arranged for special meals to be prepared for those delegates 

who have pre‐registered their special requirements. These meals 

will be available from the designated buffet stations during meal 

breaks. Please see a member of the banquet staff for assistance. 

Program changes 

The conference organisers cannot be held responsible for any 

program changes due to external or unforeseen circumstances. 

Please check the program board located outside the Concert Hall 

for any changes to sessions. 

Speakers preparation area 

A speaker preparation area is located in the Concert Hall Foyer 

of City Hall and will be open during the following hours: 

Monday 28 September 1730–1900 (Newcastle Art Gallery) 

Tuesday 29 September 0800–1900 

Wednesday 30 September 0800–1730 

Thursday 1 October 0800–1600 

All speakers must take their presentation to the speaker 

preparation area a minimum of four hours prior to their 

presentation, or the day before if presenting at a morning 

session. Speakers are also requested to assemble in their session 

room 15 minutes before the commencement of the session, to 

meet with their session chair and to familiarise themselves with 

the room and the audiovisual equipment. 

Noticeboard 

A noticeboard will be maintained adjacent to the registration 

desk showing program changes, messages and other 

information. Please check the board regularly for updates. 

Mobile phones 

As a courtesy to speakers and other delegates, please ensure 

that all mobile phones are switched off during sessions. 

Participant list 

The participant list has been included in the conference satchel. 

Those delegates who have indicated on their registration form 

that they do not wish to have their name and organisation 

appear on the participant list have not been included. 

General information 

Useful telephone numbers 

TAXIS 

Newcastle Taxis 13 33 00 

HOTELS 

Crowne Plaza Newcastle 4907 5065 

Travelodge Newcastle 4926 3777 

Ibis Newcastle 4925 2266 

PUBLIC TRANSPORT 

Buses 13 15 00 

www.newcastlebuses.info/timetables.htm 

AIRLINES 

Qantas 13 13 13 

Virgin Blue 13 67 89 

Jetstar 13 15 38 

Brindabella Airlines 1300 66 88 24 

Eating out in Newcastle 

Newcastle has a great food scene, with eateries to suit all 

budgets. There are four main dining precincts to explore in the 

inner city: 

• Darby Street in Cooks Hill (5–10 min walk from City Hall). A 

diverse, friendly, relaxed bohemian precinct. Darby Street 

has a vibrant cafe culture, and a good selection of 

restaurants, pubs and take away outlets. 

• Honeysuckle and the Harbour waterfront (5–10 min walk 

from City Hall). Down at the waterfront you will find cafes, 

bars and restaurants, with wonderful views across the 

wharves. The foreshore promenade offers a great way to 

walk off dessert! 

• Beaumont Street in Hamilton (10 min drive from City Hall). 

There is a strong Mediterranean focus along Beaumont 

Street, with many sidewalk cafes and a thriving pub‐scene. 

• The Junction (25 min walk / 5 min drive from City Hall). An 

upmarket shopping precinct with a smattering of first‐class 

restaurants and cafes to relax in. 

Dining options closest to City Hall are: 

• Civic Precinct, which has a few coffee shops and sandwich 

bars 

• Honeysuckle and Derby Street, which both have a great 

selection of sit‐down cafes, bars and restaurants. 

For further information on places to eat in Newcastle please visit 

www.eatlocal.com.au/. 


Things to do in Newcastle 

CAROLE FRAZERS WALKS AND TALKS 

Discover what makes Newcastle unique and discover 

Newcastle’s best hidden treasures with Carole Frazer’s Walks 

and Talks. You may be surprised that Newcastle has many 

fascinating walks in and around Newcastle city. Included are the 

spectacular Bogey Hole, Leadlight Tower and historic houses, Art 

Gallery and cultural buildings. All walks include commentary on 

many city topics and especially of local Newcastle history. There 

are a number of different types of walks you can do catering for 

a diverse range of areas and interesting locations. Prices start at 

$10 per person for a 1 hour tour. For more information, log onto 

www.walks‐talks.com.au or phone Carole on 02 4952 1537 

BLACKBUTT RESERVE 

Blackbutt Reserve provides nature trails, wildlife exhibits, 

children’s playgrounds and recreational facilities. It is the perfect 

place for a relaxing family picnic or to explore the wonders of 

nature. Wildlife Exhibits open 9.00 am to 5.00 pm every day of 

the year. Picnic and recreation facilities open from 7.00 am to 

5.00 pm and entry is free. For more information log onto 

www.ncc.nsw.gov.au/discover_newcastle/blackbutt_reserve 

NEWCASTLES FAMOUS TRAM 

Everything about Newcastle’s Famous Tram is unique. Built from 

scratch in 1994, the tram is a genuine replica of the original 

Newcastle working tram, which was in service in 1923. 

Newcastle’s Famous Tram is a very novel and nostalgic way to 

visit the historical city of Newcastle. The Newcastle tour is a 45 

minute tour of our city, beaches and historical sites. A full 

commentary is provided. This service in the heart of Newcastle 

reveals to its passengers the beauty of the city and beach areas 

as well as an astonishing blend of history and current changes to 

the city lifestyle. Detailed information is provided about many 

historic sites. The tour is great value at $12 an adult and $6 and 

operates weekday tours from Newcastle’s Railway Station and 

the Crown Plaza in Wharf Road. The Tram operates at 11.00 am 

and 1.00 pm, with a special pick up at the Brewery Wharf Road 

at 12.55 pm, and during school holidays between 10.00 am 

11.00 am 12 noon and 1.00 pm, but please ring to confirm 

operating times. No service on weekends or public holidays. For 

more information log onto www.famous‐tram.com.au 

DARBY ST PRECINCT 

Conveniently situated and only 5 minutes from Newcastle 

Harbour and Foreshore, Darby St Precinct offers a diverse, 

friendly, and relaxed cosmopolitan destination. Consisting of 

over 20 cafes, outdoor dining and cosy retreats, including some 

award winning restaurants that boast the fine cuisine with 

friendly prices. Shoppers look out for unique fashion boutiques, 

art and gift galleries. You also have photography studios, homewares, 

everyday living, music and professional services. For more 

information log onto www.darbystreet.com.au 

Social program 

Welcome Reception 

Monday 28 September 2009 

5.30 pm – 7.00 pm 

Venue: Level 1, Newcastle Region Art Gallery, 1 Laman Street, 

Newcastle (opposite City Hall) 

Dress: Conference attire/neat casual 

Marking the opening of the conference, drinks and canapés will 

be served in the Newcastle Region Art Gallery. The welcome 

reception will give you the opportunity to register early and 

catch up with friends. 

Poster, Wine and Cheese Night 

Tuesday 29 September 2009 

6.00 pm – 7.00 pm 

Venue: Banquet Room and Concert Hall, Newcastle City Hall 

Dress: Conference attire/neat casual 

Cost: Included in full conference registration. $25 for extra 

attendees or other registration categories. If you wish to attend, 

please check with the registration desk staff if there are still 

tickets avaible. 

Conference Dinner 

Wednesday 30 September 2009 

7.00 pm (for 7.30 pm start) until late 

Venue: Auditorium 1, Newcastle Panthers Club, corner King and 

Union Streets, Newcastle (5 minutes walk from City Hall) 

Theme: Ruby—celebrating the 40th Anniversary of the APPS 

Dress: Smart casual (wear something ruby) 

Cost: Included in full conference registration. $110 for extra 

attendees or other registration categories. If you have not 

indicated on your registration form that you would like to 

attend, please see the registration desk staff to find our if there 

are still places or tickets available for purchase. 

It is not every day we turn 40. Come and help us celebrate our 

Ruby Anniversary at the Newcastle Panthers Club. You are 

assured of a night of great food, great wines, fun dancing and 

excellent company. Let’s paint Newcastle Ruby. 

Beach Party 

Thursday 1 October 2009 

6.30 pm – 10.30 pm 

Venue: Newcastle Surf Life Saving Club 

Dress: Casual 

Cost: The cost of the Beach Party is not included in registration 

fees. Cost to all delegates and guests is $55.. If you would like to 

attend, please check with the registration desk staff if there are 

still tickets avaible for purchase. 

Coach transfer: Departs from the front of City Hall, King Street at 

5.30 pm sharp and will return at 10.30 pm. Please be waiting at 

the front of City Hall at least 5 minutes before the scheduled 

departure time. 



The McAlpine lecture 

The invitation to present the McAlpine lecture to the biennial 

conference of the Australasian Plant Pathology Society is 

extended to an eminent scientist in recognition of their 

significant contribution to Australasian plant pathology. The 

lecture is named after Daniel McAlpine, considered to be the 

father of plant pathology in the Australasian region. His most 

notable contributions were to study wheat rust following the 

1889 epidemic, to classify and describe Australian smuts, and to 

recognise Ophiobolus graminis (now Gaeumannomyces 

graminis) as the cause of wheat take‐all. He also collaborated 

with Farrer on resistance to rust in wheat (John Randles 1994, 

Stanislaus Fish 1976). Daniel McAlpine also contributed 

extensively to vegetable pathology. It is therefore fitting that a 

plant pathologist with extensive experience and passion such as 

Phil Keane be asked to deliver the McAlpine lecture in 2009. 

1976 Dr Lilian Fraser, Department of Agriculture, NSW 

Disease of citrus trees in Australia—the first hundred years 

1978 Dr David Griffin, Australian National University, ACT 

Looking ahead 

1980 Mr John Walker, Department of Agriculture, NSW 

Taxonomy, specimens and plant disease 

1982 Professor Richard Matthews, The University of Auckland, NZ 

Relationships between plant pathology and molecular biology 

1984 Professor Bob McIntosh, University of Sydney, NSW, and 

Dr Colin Wellings, Department of Agriculture, NSW 

Wheat rust resistance: the continuing challenge 

1986 Dr Allen Kerr, Waite Agricultural Research Institute, SA 

Agrobacterium: pathogen, genetic engineer and biological 

control agent 

1989 Dr Albert Rovira, CSIRO Division of Soils, SA 

Ecology, epidemiology and control of take‐all, rhizotomies bare 

patch and cereal cyst nematode in wheat 

1991 Mr John Walker, Department of Agriculture, NSW 

Plants, diseases and pathologists in Australasia—a personal 

view 

1993 Dr John Randles (University of Adelaide, SA 

Plant viruses, viroids and virologists of Australasia 

1995 Dr Ron Close, Lincoln University, NZ 

The ever changing challenges of plant pathology 

1997 Professor John Irwin, CRC Tropical Plant Pathology, Qld 

Biology and management of Phytophthora spp. attacking field 

crops in Australia 

1999 Dr Dorothy Shaw, Department of Primary Industries, Qld 

Bees and fungi with special reference to certain plant pathogens 

2001 Dr Alan Dube, South Australian Research and Development 

Institute, SA 

Long‐term careers in plant pathology 

2003 Dr Mike Wingfield, University of Pretoria, South Africa 

Increasing threat of disease to exotic plantation forests in the 

southern hemisphere 

2007 Dr Graham Stirling, Biological Crop Protection, Qld 

The impact of farming systems on soil biology and soil‐borne 

diseases: examples from the Australian sugar and vegetable 

industries, the case for better integration of sugarcane and 

vegetable production and implications for future research 

2009 Assoc Prof Phil Keane, La Trobe University, Vic 

Lessons from the tropics—the unfolding mystery of vascularstreak 

dieback of cocoa, the importance of genetic diversity, 

horizontal resistance, and the plight of farmers 

McAlpine lecturer 2009: Philip Keane 

Philip grew up in the wheat/sheep belt 

of rural South Australia and gained his 

Bachelor of Agricultural Science (Hons) 

at the Waite Agricultural Research 

Institute, University of Adelaide in 

1968. 

He was awarded a PhD at the 

University of Papua New Guinea in 

1972 for his studies of vascular‐streak 

dieback, a serious epidemic disease of 

cocoa. He described and named the 

pathogen, Oncobasidium theobromae, 

and remains the world authority on what is a particularly 

unusual vascular wilt disease. Not only was the pathogen a new 

species, but also a new genus within the Basidiomycetes. 

Philip taught at UPNG before taking up a lectureship at La Trobe 

University in 1975. His time at La Trobe has been supplemented 

with sabbatical periods in the USA and Central America, as well 

as extensive project‐related travel through PNG and Indonesia. 

Since returning to Australia in 1975 Philip maintained his interest 

in diseases of cocoa in South East Asia and Papua New Guinea, 

and in agricultural development and education in tropical 

countries. His approach is focussed on the farmer—from 

listening to farmers, evaluating their ideas, then translating his 

research to be used by the farmers. Philip also initiated research 

into fungal diseases of crop plants and eucalypts, and co‐edited 

the standard monograph on Eucalypt Pathogens and Diseases. 

He is involved in research on a range of big questions in plant 

pathology, including the nature of resistance to crop diseases, 

especially cereal rusts, plant disease epidemiology, the diversity 

of macrofungi and broad questions in plant ecology. 

Philip is an enthusiastic undergraduate teacher and has trained 

many local and international PhD students, many of whom will 

be attending this conference. He has made a special and unique 

contribution to plant pathology in Australia and neighbouring 

countries, and it is a great honour that he has accepted our 

invitation to present the McAlpine Lecture. 

2005 Dr Gretna Weste, University of Melbourne, Vic 

A long and varied fungal foray 


Keynote biographies 

Barbara Christ 

Professor Barbara Christ, the current President of the American 

Phytopathological Society, is Senior Associate Dean in the College of 

Agricultural Sciences and Professor of Plant Pathology at 

Pennsylvania State University in the United States. Her research is 

focused on potato breeding and disease management, including 

basic research into understanding the inheritance of disease 

resistance as well as extension. Her research includes developing 

and releasing new varieties adapted for Pennsylvania growing 

conditions, developing disease‐resistant potato germplasm. 

examining the genetic variability and biology of potato pathogen 

populations, developing methods to detect and forecast potato 

diseases, developing integrated pest management strategies for 

potatoes in Pennsylvania, and evaluating new fungicides for efficacy 

against potato diseases. 

André Drenth 

Dr André Drenth is a Principal Plant Pathologist from the University 

of Queensland, and founder and Leader of the Tree Pathology 

Centre which is a joint initiative between the University of 

Queensland and Queensland Primary Industries and Fisheries. André 

studied Plant Breeding and Pathology at Wageningen University and 

Cornell University, USA. André was Research Program Leader in the 

CRC for Tropical Plant Protection dealing with a large number of 

Tropical diseases. His ability to deliver practical outcomes from basic 

research in plant pathology is well recognised internationally. André 

has been involved in research on plant pathogens for nearly 20 years 

and has published widely on a range of plant diseases with a special 

focus on Phytophthora. 

Adrienne Hardham 

Professor Adrienne Hardham works in the Research School of 

Biology at the Australian National University. The main focus of her 

research is on cellular and molecular mechanisms responsible for 

the infection of plants by Phytophthora and rust fungi and the 

plant’s defence response to pathogen invasion. 

Greg Johnson 

Dr Greg Johnson is President of the Australasian Plant Pathology 

Society (APPS) 2007–2009 and Secretary General of the International 

Society for Plant Pathology (ISPP) 2006–2013. Greg has had over 20 

years’ experience in development assistance in tropical horticulture 

and postharvest R&D collaboration with developing countries in Asia 

and the Pacific, and over 30 years’ experience in plant pathology 

practice, diagnostic advice and publishing on tropical and temperate 

plants and crops. His especial interest is postharvest diseases of 

mangoes. Greg currently operates a Canberra‐based consultancy, 

Horticulture 4 Development, that builds upon Greg’s background in 

managing a portfolio of projects and activities in postharvest 

technology, horticulture and crop protection with the Australian 

Centre for International Agricultural Research (ACIAR) in Asia and 

the Pacific. His recent activities have included an overview of the 

vegetable sector in tropical Asia and reviewing issues and priorities 

for postharvest disease management in mangoes. 

Eun Woo Park 

Professor Eun Woo Park is Dean of the College of Agriculture and 

Life Sciences in Seoul National University, Korea. Major research 

areas are epidemiology of airborne diseases with special emphasis 

on modeling and forecasting disease development, and applications 

of various information technologies to implement disease 

management strategies. 

Dov Prusky 

Professor Dov Prusky is Deputy Director Research and Development 

with the Agricultural Research Organization, Israel. He is also active 

in research in the Department of Postharvest Science of Fresh 

Produce of the ARO Technology and Storage of Agricultural Products 

Institute. Dov is currently Chair of the ISPP Postharvest Diseases 

Subject Matter committee. Dov’s research Interests include: 

• understanding the basic processes underlying the interactions 

between fruits and pathogenic fungi 

• studying biochemical and molecular mechanisms that are 

controlled by fungal virulence and fruit resistance factors 

• using transformation‐mediated gene disruption to create 

strains of pathogenic fungi that are specifically mutated in their 

ability to make cell‐wall degrading enzymes and other 

pathogenicity factors. These mutants are tested for their ability 

to cause disease and to elicit defense responses 

• studying the biochemical basis for modulation of pathogenicity 

factor affecting the transcription expression of nitrogen 

metabolism, ammonia secretion and the effect on the 

modulation of local pH 

• reduction of postharvest losses in deciduous and subtropical 

fruits. 

Robert Seem 

Robert C Seem has spent his 34‐year career as professor of plant 

pathology at Cornell University’s Agricultural Experiment Station in 

Geneva, New York. He specialises in the epidemiology of fruit and 

vegetable diseases. Robert also served in the station administration 

for 14 years. During this time he was instrumental in the 

development of the Cornell Agriculture and Food Technology Park 

Corporation, where he continues to serve a president of the board. 

Mike Wingfield 

Professor Michael Wingfield was born in South Africa. He graduated 

with BSc Hons (Natal) and MSc (Stellenbosch) degrees then 

completed his PhD in Plant Pathology (University of Minnesota), 

specialising in forest pathology and forest entomology. He returned 

to South Africa to establish the Tree Protection Co‐operative 

Programme (TPCP) at the University of the Free State, and in 1998 

established the Forestry and Agricultural Biotechnology Institute 

(FABI) at the University of Pretoria. FABI is now the Centre of 

Excellence in Tree Health Biotechnology. He is also an alumnus of 

the Harvard Business School Advanced Management Programme. 

Celeste Linde 

Celeste Linde investigates the population genetics of, for example, 

cereal pathogens, the influence of wild or weedy hosts on pathogen 

populations and their evolution of virulence. Her main focus has 

been with Rhynchosporium secalis, causing barley scald. 


Venue map 

Level 1 

Level 2 


Level 3 


Program 

Monday 28 September 

1400– 

1700 

1730– 

1800 

Registration open 

WELCOME RECEPTION 

Ground Floor Foyer, Newcastle Region Art Gallery 

Newcastle Region Art Gallery 

Tuesday 29 September 

0800– 

1900 


Concert Hall Foyer 

0800 ARRIVAL TEA AND COFFEE Concert Hall Foyer 

0830 Conference opening Concert Hall 

Prof David Guest, University of Sydney 

0845 Presidential address—‘Shield the young harvest from devouring blight’—Charles Darwin, Joseph Banks, Concert Hall 

Thomas Knight and wheat rust: discovery, adventure, and ‘getting the message out’ 

Dr Greg Johnson, Horticulture 4 Development, ACT 

0930 Keynote address—The relevance of plant pathology in food production Concert Hall 

Dr André Drenth, Tree Pathology Centre, The University of Queensland and Primary Industries and Fisheries 

1030 MORNING TEA Banquet Room 

Session 1A 

Disease management 

Room: Concert Hall 

Chair: Andrew Miles 

1100 An integrated approach to 

husk spot management in 

macadamia 

Dr Olufemi Akinsanmi, The 

University of Queensland and 

Primary Industries and 

Fisheries, Qld 

1120 Application methods of 

phosphonate to control 

Phytophthora pod rot and 

stem canker on cocoa 

Dr Peter McMahon, La Trobe 

University, Vic 

1140 Botrytis bunch rot control 

strategies in cool climate 

viticultural regions of Australia 

and New Zealand 

Dr Jacqueline Edwards, 

Department of Primary 

Industries, Vic 

Session 1B 

Disease surveys 

Room: Cummings Room 

Chair: Eileen Scott 

Why Australia needs a 

coordinated national 

diagnostic system 

Ms Jane Moran, Department 

of Primary Industries, Vic 

Development of a soil DNA 

extraction and quantitative 

PCR method for detecting two 

Cylindrocarpon species in soil 

Ms Chantal Probst, Lincoln 

University, NZ 

Bananas in Carnarvon—good 

news for growers in survey for 

quarantine plant pests and 

pathogens 

Dr Sarah Collins, Department 

of Agriculture and Food WA 

Session 1C 

Soilborne diseases 

Room: Hunter Room 

Chair: Nerida Donovan 

Can investment in building up 

soil organic carbon lead to 

disease suppression in 

vegetable crops? 

Dr Ian Porter, Department of 

Primary Industries, Vic 

Evaluation of soil health 

indicators in the vegetable 

industry of temperate 

Australia 

Ms Robyn Brett, Department 

of Primary Industries, Vic 

Rhizoctonia AG2.1 and AG3 in 

soil—competition or 

synergism? 

Dr Tonya Wiechel, 



Session 1D 

Virology 

Room: Newcastle Room 

Chair: John Randles 

Towards universal detection of 

Luteoviridae 

Miss Anastasija Chomic, 

Lincoln University, NZ 

Massive parallel sequencing of 

small RNAs to identify plant 

viruses and virus‐induced small 

RNAs 

Dr Robin MacDiarmid, The 

New Zealand Institute for Plant 

and Food Research Ltd, NZ 

Chickpea chlorotic stunt virus, 

an important virus of coolseason 

food legumes in Asia 

and North Africa and 

potentially in Australia 

Dr Safaa Kumari, International 

Center for Agricultural 

Research in the Dry Areas, 

Syria 

1200 LUNCH Banquet Room 

Editor’s meeting (1200–1400) 

Waratah Room 

Student mentor lunch (1200–1320) 

Mulumbinba Room 

1320 Keynote address—Emerging frontiers in forest pathology Concert Hall 

Prof Mike Wingfield, Forestry and Agricultural Biotechnology Institute, University of Pretoria, South Africa 


Session 2A 

Forest pathology/native 


Chair: Angus Carnegie 

1410 Variability in pathogenicity of 

Quambalaria pitereka on 

spotted gums 

Mr Geoffrey Pegg, The 

University of Queensland/ 

Primary Industries and 

Fisheries, Qld 

1430 Movement of pathogens 

between horticultural crops 

and endemic trees in the 

Kimberleys 

Ms Monique Sakalidis, 

Murdoch University, WA 

1450 Pathogenicity of Phytophthora 

multivora to Eucalyptus 

gomphocephala and 

E. marginata 

Dr Treena Burgess, Murdoch 

University, WA 

1510 Microscopy of progressive 

decay of fungi isolated from 

Meranti tree canker 

Dr Erwin Erwin, University of 

Mulawarman, Indonesia 

Session 2B 

Soilborne disease 


Chair: Peter McGee 

Optimising conditions to 

investigate gene expression in 

pathogenic Streptomyces using 

RT‐qPCR 

Dr Tonya Wiechel, 



Fusarium oxysporum and 

Pythium associated with 

vascular wilt and root rots of 

greenhouse cucumbers 

Mr Len Tesoriero, NSW 


Industries 

Fusarium oxysporum f. sp. 

fragariae: a main component 

of strawberry crown and root 

rots in Western Australia 

Dr Hossein Golzar, 

Department of Agriculture and 

Food WA 

Evaluation of resistant 

rootstocks for control of 

Fusarium wilt of watermelon in 

Nghe An Province, Vietnam. 

Prof Lester Burgess, The 

University of Sydney, NSW 

Session 2C 

Epidemiology 


Chair: Chris Steel 

Bunch rot diseases and their 

management 

Prof Turner Sutton, NC State 

University, USA 

Inoculum and climatic factors 

driving epidemics of Botrytis 

cinerea in New Zealand and 

Australian vineyards 

Dr Rob Beresford, The New 

Zealand Institute for Plant and 

Food Research Limited, NZ 

Infection of apples by 

Colletotrichum acutatum in 

New Zealand is limited by 

temperature 

Dr Kerry Everett, The New 



Epidemiology of walnut blight, 

caused by Xanthomonas 

arboricola pv. juglandis, in 

Tasmania, Australia 

Dr Katherine Evans, University 

of Tasmania 

Session 2D 



Chair: Robert Magarey 

Sugarcane smut—disease 

development and mechanism 

of resistance 

Dr Shamsul Bhuiyan, BSES 

Limited, Qld 

Dissemination of biological 

and chemical fungicides by 

bees onto Rubus and Ribes 

flowers 

Dr Monika Walter, The New 



Current studies on divergence 

and management of pepper 

yellow leaf curl disease 

Indonesia 

Dr Sri Hidayat, Bogor 

Agricultural University, 

Indonesia 

Fungicide resistance in cucurbit 

powdery mildew 

Dr Chrys Akem, Primary 

Industries and Fisheries, Qld 

1530 AFTERNOON TEA Banquet Room 

1600 Keynote address—Population genetic analyses of plant pathogens: new challenges and opportunities Concert Hall 

Dr Celeste Linde, Research School of Biology, College of Medicine, Biology and Environment, Australian National University 

Session 3A 

Population genetics 


Chair: Andre Drenth 

1640 Genetic diversity of Botryosphaeria parva 

(Neofusicoccum parvum) in New Zealand 

vineyards 

Mr Jeyaseelan Baskarathevan, Lincoln 


1700 Anthracnose disease of chili pepper— 

genetic diversity, pathogenicity and 

breeding for resistance 

A/Prof Paul Taylor, The University of 

Melbourne, Vic 

1720 The diversity of Colletotrichum infecting 

lychee in Australia 

Ms Jay Anderson, Primary Industries and 

Fisheries, Qld and University of 

Queensland 

1740 Variation in Phytophthora palmivora on 

cocoa in Papua New Guinea 

Ms Josephine Saul Maora, PNG Cocoa 

Coconut Institute 

Session 3B 

Modelling and crop loss assessment 


Chair: Ian Porter 

Spore traps for early warning of smut 

infestations in Australian sugarcane crops 

Dr Rob Magarey, BSES Limited, Qld 

Software‐assisted gap estimation (SAGE) 

for measuring grapevine leaf canopy 

density 

Mr Gareth Hill, The New Zealand Institute 

for Plant and Food Research Limited, NZ 

Evaluation of the efficacy of Brassica spot 

TM 

models for control of white blister in 

Chinese cabbage 

Mr Desmond Auer, Department of 


Evaluating an infection model of prune 

rust to improve the management of 

disease for almond and prune growers 

Mr Peter Magarey, South Australian 

Research and Development Institute 

Session 3C 



Chair: Shane Hetherington 

Management of white blister on vegetable 

brassicas with irrigation and varieties 

Dr Elizabeth Minchinton, Department of 


Alternative screening methods for 

sugarcane smut using natural infection 

and tissue staining 

Dr Shamsul Bhuiyan, BSES Limited, Qld 

Interruption of cool chain and strawberry 

fruit rot by leak‐causing fungi Rhizopus 

species 

Dr Monika Walter, The New Zealand 

Institute for Plant and Food Research 

Limited, NZ 

Enhancing Papua New Guinea smallholder 

cocoa production through greater 

adoption of integrated pest and disease 

management 

Mr Yak Namaliu, PNG Cocoa Coconut 

Institute 

1800 DRINKS AND POSTERS Banquet Room and Concert Hall 

1830– 

2030 

Council of Society meeting 

Waratah Room 


Wednesday 30 September 

0800– 

1730 




0830 Keynote address—Molecular cytology of Phytophthora‐plant interactions Concert Hall 

Prof Adrienne Hardham, Plant Cell Biology Group, Research School of Biology, The Australian National University 

Session 4A 

Plant pathogen interactions 


Chair: David Guest 

0910 Gene expression changes 

during host‐pathogen 

interaction between 

Arabidopsis thaliana and 

Plasmodiophora brassicae 

Mrs Arati Agarwal, 



0930 Hairpin RNA derived from viral 

NIa gene confers immunity to 

wheat streak mosaic virus 

infection in transgenic wheat 

plants 

Mr Muhammad Fahim, CSIRO 

Plant Industry, and Australian 

National University, ACT 

0950 Characterising inositol 

signalling pathways in 

Phytophthora spp. for future 

development of selective 

antibiotics 

Mr Dean Phillips, Deakin 

University, Vic 

1010 Systemic acquired resistance— 

a new addition to the IPM 

clubroot toolbox? 

Dr Caroline Donald, 



Session 4B 



Chair: Sandra Savocchia 

Prevalence and pathogenicity 

of Botryosphaeria lutea 

isolated from grapevine 

nursery materials in New 

Zealand 

Ms Regina Billones, Lincoln 


Infection and disease 

progression of Neofusicoccum 

luteum in grapevine plants 

Mr Nicholas Amponsah, 

Lincoln University, NZ 

Carbohydrate stress increases 

susceptibility of grapevines to 

Cylindrocarpon black foot 

disease 

Miss Dalin Dore, Lincoln 


Botryosphaeria spp. associated 

with bunch rot of grapevines in 

south‐eastern Australia 

Ms Nicola Wunderlich, Charles 

Sturt University, NSW 

Session 4C 

Epidemiology 


Chair: Greg Johnson 

Honey bees— do they aid the 

dispersal of Alternaria radicina 

in carrot seed crops? 

Mr Rajan Trivedi, Lincoln 


Translating research into the 

field: meta‐analysis of field pea 

blackspot severity and yield 

loss to extend model 

application for disease 

management in Western 

Australia 

Dr Moin Salam, Department of 

Agriculture and Food WA 

Development of a model to 

predict spread of exotic wind 

and rain borne fungal pests 

Dr Moin Salam, Department of 

Agriculture and Food WA 

Psyllid transmission of 

Huanglongbing from naturally 

infected Shogun mandarin to 

orange jasmine 

Dr Rantana Sdoodee, Prince of 

Songkla University, Thailand 

Session 4D 

Prokaryotic pathogens 


Chair: Lucy Tran‐Nguyen 

Transmission of 'Candidatus 

Phytoplasma australiense' to 

Cordyline and Coprosma 

Dr Ross Beever, Landcare 

Research, NZ 

Australian grapevine yellows 

phytoplasma found in 

symptomless shoot tips after a 

heat wave in South Australia 

Mr Peter Magarey, South 

Australian Research and 

Development Institute, SA 

Association of Phytoplasmas 

with papaya crown yellows 

(PCY) disease—a new disease 

of papaya in Northern 

Mindanao, Philippines 

Ms Regina Billones, Del Monte 

Phils Inc, Philippines 

Phytoplasma diseases in citrus 

orchards of Pakistan 

Dr Shazia Mannan, COMSATS 

Institute of Information 

Technology, Pakistan 


1100 Keynote address—Mechanisms modulating fungal attack in postharvest pathogen interactions and Concert Hall 

their modulation for improved disease control 

Prof Dov Prusky, Department of Postharvest Science of Fresh Produce, Agricultural Research Organization, Israel 

Session 5A 

Plant pathogen interactions 


Chair: Rosalie Daniel 

1140 ABA‐dependant signalling of PR genes and 

potential involvement in the defence of 

lentil to Ascochyta lentis 

Dr Rebecca Ford, The University of 

Melbourne, Vic 

1200 Fundamental components of resistance to 

Phytophthora cinnamomi: using model 

system approaches 

Prof David Cahill, Deakin University, Vic 

1220 Genes involved in hypersensitive cell death 

responses during Fusarium crown rot 

infection in wheat 

Dr Jill Petrisko, University of Southern 

Queensland, Qld 

Session 5B 



Chair: Aaron Maxwell 

Fishing For Phytophthora across Western 

Australia’s water bodies 

Dr Daniel Hüberli, Murdoch University, 

WA 

Incidence of fungi isolated from grape 

trunks in New Zealand vineyards 

Mr Dion Mundy, The New Zealand 


Limited, NZ 

Isolation and characterisation of strains of 

Pseudomonas syringae from waterways of 

the Central North Island of New Zealand 

Dr Joel Vanneste, The New Zealand 


Limited, NZ 

Session 5C 

Chemical control 


Chair: Len Tesoriero 

Evaluation of fungicides to manage 

brassica stem canker 

Ms Lynette Deland, South Australian 

Research and Development Institute, SA 

Evaluation of spray programs for powdery 

mildew management in greenhouse 

cucumbers 

Dr Kaye Ferguson, South Australian 


The incidence of copper resistant bacteria 

in Australian pome and stone fruit 

orchards 

Dr Chin Gouk, Department of Primary 



1240 AGRICHEM LUNCH Banquet Room 

1340 Poster session Banquet Room and Concert Hall 


1500 McAlpine lecture—Lessons from the tropics—the unfolding mystery of vascular‐streak dieback Concert Hall 

of cocoa, the importance of genetic diversity, horizontal resistance, and the plight of farmers 

Assoc Prof Phil Keane, Department of Botany, La Trobe University, Vic 

1600 AGM Concert Hall 

1730 Close of day 

1900 CONFERENCE DINNER Newcastle Panthers Club 


Thursday 1 October 

0700 Regional Councillor’s meeting Waratah Room 

0700 CHAIRMAN’S BREAKFAST Mulumbinba Room 

0800– 

1730 




0830 Keynote address—Translating research into the field: how it started, how it is practised and Concert Hall 

how we carry out grape powdery mildew research 

Dr Bob Seem, Cornell University, USA 

0910 GRDC book launch: Mr James Clarke, Grains Research and Development Corporation Concert Hall 

Session 6A 

Cereal pathology 1 


Chair: Mark Sutherland 

0925 Stem rust race Ug99: international 

perspectives and implications for Australia 

Dr Colin Wellings, The University of 

Sydney, NSW 

0945 Mitigating crop losses due to stripe rust in 

Australia: integrating pathogen 

population dynamics with research and 

extension programs 

Dr Colin Wellings, The University of 

Sydney, NSW 

1005 Impact of sowing date on crown rot losses 

Dr Steven Simpfendorfer, Department of 

Primary Industries, NSW 

1025 Symptom development and pathogen 

spread in wheat genotypes with varying 

levels of crown rot resistance 

Dr Cassandra Malligan, Queensland 

Primary Industries and Fisheries 

Session 6B 

Quarantine and exotic pathogens 


Chair: Suzy Perry 

Development of an eradication strategy 

For exotic grapevine pathogens 

Dr Mark Sosnowski, South Australian 


Green grassy shoot disease of sugarcane, 

a major disease in Nghe An Province, 

Vietnam 

Dr Rob Magarey, BSES Limited, Qld 

Molecular detection of Mycosphaerella 

fijiensis in the leaf trash of ‘Cavendish’ 

banana 

Dr Seona Casonato, The New Zealand 


Limited, NZ 

Optimising responses to incursions of 

exotic plant pathogens 

Dr Mike Hodda, CSIRO Entomology, ACT 

Session 6C 

Alternatives to chemical control 


Chair: Carolyn Blomley 

The influence of soil biotic factors on the 

ecology of Trichoderma biological control 

agents 

Prof Alison Stewart, Lincoln University, NZ 

Understanding Trichoderma bioinoculants 

in the root system of Pinus 

radiata 

Mr Pierre Hohmann, Lincoln University, 

NZ 

A bioassay to screen Trichoderma isolates 

for their ability to promote root growth in 

willow 

Mr Mark Braithwaite, Lincoln University, 

NZ 

Biofumigation for reducing Cylindrocarpon 

spp. in New Zealand vineyard and nursery 

soil 

Ms Carolyn Bleach, Lincoln University, NZ 


Session 7A 

Cereal pathology 2 


Chair: Colin Wellings 

1100 Crown rot of winter cereals: integrating 

molecuar studies and germplasm 

improvement 

Prof Mark Sutherland, University of 

Southern Queensland, Qld 

1120 Infection of wheat tissues by Fusarium 

pseudograminearum 

Mr Noel Knight, University of Southern 

Queensland, Qld 

1140 Monitoring sensitivity to Strobilurin 

fungicides in Blumeria graminis on wheat 

and barley in Canterbury, New Zealand 

Dr Suvi Viljanen‐Rollinson, The New 

Zealand Institute for Plant and Food 

Research Limited, NZ 

1200 Cross inoculation of crown rot and 

Fusarium head blight isolates of wheat 

Mr Philip Davies, University of Sydney, 

NSW 

Session 7B 

Quarantine and exotic pathogens 


Chair: Nerida Donovan 

Twenty years of quarantine plant disease 

surveillance on the island of New Guinea: 

key discoveries for Australia and PNG 

Mr Richard Davis, Australian Quarantine 

and Inspection Service, Qld 

The importance of reporting suspect exotic 

or emergency plant pests to your State 

Department of Primary Industry 

Dr Sophie Peterson, Plant Health 

Australia, ACT 

The use of sentinel plantings in forest 

biosecurity; results from mixed eucalypt 

species trails in South‐East Asia and 

Australia 

Dr Treena Burgess, Murdoch University, 

WA 

Methyl bromide alternatives for 

quarantine and pre‐shipment and other 

purposes—future perspectives 

Ms Janice Oliver, Office of the Chief Plant 

Protection Officer, ACT 

Session 7C 

Alternatives to chemical control 


Chair: Alison Stewart 

Fruit extracts of Azadirachta indica 

induces systemic acquired resistance in 

tomato against Pseudomonas syringae pv 

tomato 

Dr Prabir Paul, Amity University, India 

Fungal foliar endophytes induce systemic 

protection in cacao seedlings against 

Phytophthora palmivora 

Ms Carolyn Blomley, The University of 

Sydney, NSW 

Effectiveness of the rust Puccinia 

myrsiphylli in reducing populations of the 

invasive plant bridal creeper in Australia 

Dr Louise Morin, CSIRO Entomology, ACT 

Evaluation of essential oils and other plant 

extracts for control of soilborne pathogens 

of vegetable crops 

Ms Cassie Scoble, Department of Primary 

Industries and La Trobe University, Vic 

1230 LUNCH Banquet Room 


1330 Keynote address—Use of grid weather forecast data to predict rice blast development in Korea Concert Hall 

Prof Eun Woo Park, College of Agriculture and Life Sciences, Seoul National University, Korea 

1410 Investigating the impact of climate change on plant diseases 

Dr Jo Luck, Department of Primary Industries, Vic 

1430 Impact of climate change in relation to blackleg on oilseed rape and blackspot on field pea in Western Australia 

Dr Moin Salam, Department of Agriculture and Food, WA 

1450 Approaches to training in plant pathology capacity building projects in developing countries 

Prof LW Burgess, University of Sydney, NSW 

1510 Increasing global regulations on fumigants stimulates new era for plant protection and biosecurity 

Dr Ian Porter, Department of Primary Industries, Vic 


1600 Keynote address—A world of possibilities Concert Hall 

Dr Barbara Christ, The Pennsylvania State University, USA 

1630 Incoming presidential address 

Dr Caroline Mohammed, School of Agricultural Science, University of Tasmania 

1645 Awards 

1700 Close of day 

1730 Bus leaves Civic Centre for Beach Party 

1800 BEACH PARTY Newcastle Surf Life Saving Club 


Oral abstracts 


President’s address 

‘Shield the young harvest from devouring blight’—Charles Darwin, Joseph Banks, 

Thomas Knight and wheat rust: discovery, adventure, and ‘getting the message out’ 

G.I. Johnson{ XE "Johnson, G.I." } 

Horticulture 4 Development, PO Box 412, Jamison ACT 2614 Australia Email: greg.johnson@velocitynet.com.au 

1969: The year of the first moon landing (20 July 1969), the 

Woodstock Festival in upstate New York (15–18 August 1969), 

and (coinciding the last day of Woodstock) the beginning of the 

Australasian Plant Pathology Society (first AGM at 41st ANZAAS 

Meeting, Adelaide (18 August 1969) (Purss 1994)). All had a 

lengthy gestation and challenges along the way. All have 

changed the world! 

In the 17th President’s Address to the Australasian Plant 

Pathology Society, David Guest (2001), noted: ‘I became a plant 

pathologist because the mechanisms organisms use to 

communicate fascinate me’. Well, I became a plant pathologist 

because I am gardener at heart. But I have learned along the 

way that communication is a critical issue—not only the 

communication amongst and between microorganisms and 

plants, but also that between plant pathologists, farmers, 

politicians and communities. And, communication that is timely, 

inspiring and, (preferably) accurate, often yields the most 

favourable outcomes. 

In this paper, I will explore some of the early communication 

relating to plant disease, particularly wheat rusts. I refer to 

Erasmus and Charles Darwin, Joseph Banks, Thomas Knight, and 

some pioneering Australian researchers, and the roles of 

conferences, publications and newspapers, to highlight how 

‘getting our message out’ was as important in the 19th and early 

20th centuries as it is now. And, finally, I will consider how a 

scientific society in the 21st century still has relevance and the 

potential to change the world. 


The relevance of plant pathology in food production 

André Drenth{ XE "Drenth, A." } 

Tree Pathology Centre, The University of Queensland and Primary Industries and Fisheries, Indooroopilly, Queensland 4068 Australia 

DrenthA@dpi.qld.gov.au 

Plants are our only true primary producers of food, fibre and fuel 

through the process of photosynthesis. The objective of plant 

science in general is to understand the principles and processes 

involved in plant growth and reproduction and the objective of 

crop science concerns the productivity of our crops. 

Keynote address 

Over a period of 35 years from 1960 to 1995 the world food 

production doubled while the world population more than 

doubled from 2.5 billion to 5.6 billion. The present world 

population is 6.7 billion and expected to grow to 9 billion by 

2050. Agricultural production needs to increase 2.3% a year just 

to meet global food demand. At present we increase it by 1.5% a 

year. Thus the challenge for Agriculture is to double the global 

food production over the next three decades. In addition to 

meeting the challenge for food production Agriculture is also 

expected to provide renewable fuel. It should be clear that 

society needs Agriculture now more than ever before. 

The objective of the discipline of plant pathology is to reduce the 

impact of diseases on the production of plants for food, fibre 

and fuel. Plant pathology is an important biological science and 

arose out of need during times of famine, poor food security and 

large scale crop losses. Despite clearly defined objectives and a 

proud history of achievements many plant pathologists would 

agree with the statement ‘Plant pathology in relation to its 

importance to humanity continues to be a grossly underfunded 

discipline’ (Strange and Scott, 2005, Annual Review of 

Phytopathology). In order to ascertain the significance of our 

relatively small discipline we must recognise and document past 

contributions, identify and understand future challenges, and be 

actively working on tomorrow’s problems. The aim of my 

presentation is to address the following three questions: 

• What have been the contributions and impacts of plant 

science and more specifically plant pathology on food 

production? 

• What are the key challenges with regards to plant 

production which will enable Agriculture to feed a growing 

world population in the future? 

• What role can our discipline of plant pathology play in 

feeding the world? 


Session 1A—Disease management 

An integrated approach to husk spot management in macadamia 

O.A. Akinsanmi{ XE "Akinsanmi, O.A." } and A. Drenth 

Tree Pathology Centre, The University of Queensland and Primary Industries and Fisheries, Queensland, 80 Meiers Road Indooroopilly, 

4068 Qld, Australia 

INTRODUCTION 

Husk spot, caused by Pseudocercospora macadamiae is a major 

fungal disease of macadamia in Australia (3). Husk spot occurs 

only in eastern Australia, costing over $10 million in lost 

productivity if the disease is not adequately controlled. 

P. macadamiae infects macadamia husks on which it continually 

produces inoculum (4), the infection causes premature 

abscission of diseased fruit, thus, resulting in extensive yield 

losses and reduced kernel quality. Application of fungicide is 

currently the only effective method for controlling husk spot (1). 

However, several factors including the upsurge in organic 

farming, the need for sustainable management practices, and 

possible development of fungicide resistant fungal strains and 

lack of quantitative information on levels of disease resistance in 

varieties require development of integrated management 

strategies for controlling husk spot. Systematic studies were 

performed to improve husk spot control through the provision of 

alternative fungicide, biological control options, effective 

cultural practices and diagnostic characters for disease resistant 

cultivars. 

MATERIALS AND METHODS 

In order to evaluate the efficacy of different fungicides and 

biocontrol options against husk spot, both laboratory and field 

trials were established. Macadamia trees treated with different 

fungicide products at three field sites in south east Queensland 

and northern New South Wales were evaluated for husk spot 

incidence and severity, from onset of visual symptoms to kernel 

maturity (2). The area under disease progress curves of the 

treatments were compared against each other and with the 

untreated control using analysis of variance. The activities of five 

Trichoderma species against P. macadamiae were assessed 

either singly or in combination with each other and bacteria 

(Bacillus subtilis and Pseudomonas fluorescence) in laboratory 

experiments. Five characters of macadamia varieties with 

varying incidence of husk spot were evaluated as possible 

diagnostic characters for husk spot resistant varieties and 

discriminant analysis was performed using the identified 

diagnostic characters to partition 12 macadamia varieties to 

husk spot resistance. 

stomata per unit area and number of lesion per fruit classified 

macadamia varieties into various resistance groups. 

Nut harvested 

100% 

80% 

60% 

40% 

20% 

0% 

Poor Moderate Good Very good 

None Once Twice 

Number of spray applications 

Figure 1. Proportion of quality of total macadamia kernel produced from 

trees that received varying number of spray applications. 

ACKNOWLEDGEMENTS 

We acknowledge the University of Queensland, Primary 

Industries and Fisheries Queensland, Australian Macadamia 

Society Ltd., Horticulture Australia Ltd. and Nufarm Australia Pty 

Ltd for the funding for this project. 

REFERENCES 

1. Akinsanmi, O.A., Miles, A.K., and Drenth, A. 2007. Timing of 

fungicide application for control of husk spot caused by 

Pseudocercospora macadamiae in macadamia. Plant Dis. 91:1675– 

1681. 

2. Akinsanmi, O.A., Miles, A.K., and Drenth, A. 2008. Alternative 

fungicides for controlling husk spot caused by Pseudocercospora 

macadamiae in macadamia. Australas. Plant Pathol. 37:141–147. 

3. Beilharz, V., Mayers, P.E., and Pascoe, I.G. 2003. Pseudocercospora 

macadamiae sp. nov., the cause of husk spot of macadamia. 

Australas. Plant Pathol. 32 (2):279–282. 

4. Miles, A.K., Akinsanmi, O.A., Sutherland, P.W., Aitken, E.A.B., and 

Drenth, A. 2009. Infection, colonisation and sporulation by 

Pseudocercospora macadamiae on macadamia fruit. Australas. 

Plant Pathol. 38 (1):36–43. 

RESULTS AND DISCUSSION 

Results of field trials showed that pyraclostrobin conferred 

significantly (P < 0.05) better protection than trifloxystrobin and 

also had somewhat similar efficacy as a tank‐mixture of 

carbendazim and copper against husk spot incidence and 

severity. The use of pyraclostrobin in rotation with tank mixture 

of carbendazim and copper would play a key role in the 

management of fungicide resistance in the industry. The 

reduction of copper usage would also provide additional benefits 

to the macadamia industry. Frequency or number of fungicide 

spray applications influenced total kernel quality (Fig. 1). In vitro 

volatile inhibition trials showed that growth rate of 

P. macadamiae was inhibited by 8% in mixed cultures of T. viride 

and T. harzianum, and by 5% in the mixed culture of T. koningii 

and T. harzianum but no mycoparasitism was observed in the 

hyphal interaction experiments. Our results showed that 

significant differences exist in the reaction of macadamia 

varieties to husk spot. The discriminant analysis on the disease 

incidence and severity, prevalence of stick‐tights, number of 


Application methods of phosphonate to control Phytophthora pod rot and stem 

canker on cocoa 

A. Purwantara, A. Wahab, Y. Imron, V.K.M. Dewi, P.J. McMahon{ XE "McMahon, P.J." }, S. Lambert, P.J. Keane, D.I. Guest 

Presenting author: Department of Botany, La Trobe University, Bundoora, Victoria 3086 Email: peter.mcmahon@latrobe.edu.au 

INTRODUCTION 

Stem canker and Phytophthora pod rot (PPR) or black pod 

caused by Phytophthora palmivora are among the most serious 

diseases of cocoa in Sulawesi, Indonesia, causing high yield 

losses for farmers. Potassium phosphonate (phosphite) has 

previously been demonstrated to effectively control canker and 

PPR in Papua New Guinea (1). To test the effectiveness of 

phosphonate in Sulawesi against Phytophthora diseases and to 

compare methods of application of the chemical, two 

experimental trials were conducted on cocoa farms in Sulawesi, 

Indonesia. 


METHODS 

1 The effect of trunk‐injected phosphonate on stem canker and 

PPR in Ladongi, Southeast Sulawesi. Fifty 10 year‐old hybrid 

cocoa trees were injected annually with 16 g a.i. phosphonate 

(Agrifos 600; Agrichem), fifty with water and fifty left untreated. 

For 4.5 years following the initial injection, trees were scored 

each month for canker severity and monitored for PPR and CPB 

incidence (% ripe pods affected). Treatments were compared by 

one‐way ANOVA followed by either the Bonferroni or the 

Games‐Howell post‐hoc tests. 

2 The effect of phosphonate on stem canker applied by three 

differing methods. In a blocked trial with four replicates, 2‐yearold 

grafted cocoa trees naturally infected with Phytophthora 

stem canker were treated with phosphonate either by trunk 

injection, bark painting (combined with Pentrabark; Agrichem), 

or implants?, or left untreated and were then scored monthly (as 

in Experiment 1) for five months for canker lesion size. 


1 Trunk injection. Phosphonate injection cured stem canker 

within four months of the initial injection (Fig. 1). Over a 2.5 year 

period, phosphonate significantly decreased cumulative PPR 

incidence (Table 1), while PPR incidence did not differ between 

the untreated and water‐injected trees indicating that the 

injection procedure itself did not influence these results. In both 

the control and phosphonate‐treated trees, cycles of PPR 

infection occurred in the wet season with PPR incidence 

fluctuating from less than 30% to greater than 75% (data not 

shown). These might have been due to variations in rainfall, the 

regular removal of infected pods in the experiment or natural 

cycles of sporulation and infection. CPB incidence did not differ 

significantly between treatments (data not shown). 

Figure 1. Mean canker scores for phosphonate‐injected trees (solid line 

and squares) and water‐injected (broken line, open diamond symbols) 

assessed from 2002 to 2006. Only trees that initially had canker 

infections are included. Trees were injected in June 2002, December 

2002 and then every year until the end of 2006. 

Table 1. Mean cumulative incidences of PPR in ripe pods from April 2004 

to December 2006. 

Treatment Mean PPR (%) 

Untreated 

43.4 ± 1.9 a 

Water‐injected 

40.2 ± 2.1 a 

Phosphonate‐injected 

26.3 ± 1.8 b 

Mean incidences were calculated from the total number of ripe pods and 

infested/infected pods harvested from each tree in the 2.5 years. Each treatment 

had 50 trees (replicates). Means (± SE) within columns followed by the same letter 

are not significantly different (P


Botrytis bunch rot control strategies in cool climate viticultural regions of Australia 

and New Zealand 

J. Edwards{ XE "Edwards, J." } 1 , D. Riches 1 , K.J. Evans 2 , R.M. Beresford 3 , G.N. Hill 3 , P.N. Wood 4 and D.C. Mundy 5 

1 Department of Primary Industries, 621 Burwood Highway, Knoxfield, Victoria 3180. 

2 Tasmanian Institute of Agricultural Research, University of Tasmania, New Town Research Laboratories, 13 St Johns Avenue, New Town, 

Tasmania 7008. 

3 Plant and Food Research, Mt Albert Research Centre, Private Bag 92‐169 Auckland, NZ 

4 Plant and Food Research, Hawke’s Bay Research Centre, Private Bag 1401, Havelock North, Hastings 4157, NZ 

5 Plant and Food Research, Marlborough Wine Research Centre, P.O. Box 845, Blenheim 7240, NZ 

INTRODUCTION 

Botrytis bunch rot can cause major losses in wine grapes, while 

negligible damage may occur in some seasons, even in the 

absence of control measures. We evaluated the effectiveness of 

different disease control strategies in five cool climate viticulture 

regions in the context of determining disease risk during the 

season (1) and economic outcomes for the grower. 


Standard measures of yield, weather, canopy density, bunch 

exposure, latent Botrytis cinerea incidence at pre‐bunch closure 

(PBC), and botrytis development post‐veraison were recorded at 

23 sites in Southern Tasmania, Southern Victoria and New 

Zealand between 2006–08 (Table 1). Untreated plots and 

combinations of treatments including fungicide timing, canopy 

modification (leaf plucking and shoot thinning), and inoculum 

reduction by removing bunch trash, were used to generate a 

wide range of harvest botrytis severities. 

RESULTS 

The efficacy of early season (5%, 80% cap‐fall), mid season (peasize, 

PBC), late season (veraison, pre‐harvest) fungicide 

applications and combination treatments varied considerably 

across the different trial sites and seasons. Only 8 out of 23 trials 

exceeded 3% botrytis severity at harvest (a level at which many 

wineries impose price penalties) on unsprayed vines. Fungicide 

applications reduced disease below the 3% threshold in only four 

of them (Table 1). Leaf plucking was as effective as the fungicide 

treatments in six New Zealand and one Victorian trial, but not in 

two other trials. Leaf removal combined with fungicide 

applications was the most effective treatment, reducing botrytis 

severity to below the 3% threshold even in trials where severity 

was >8% in the untreated plots. The experimental inoculum 

reduction treatment (bunch trash removal) did not reduce 

botrytis severity in these trials. 

Tactical decisions about the need for individual fungicide sprays 

or canopy management actions depend on the season, canopy 

density and bunch exposure, and underlying risk for the region. 

The data collected in these trials is being used to develop a 

botrytis risk model (1) to assist growers in making decisions for 

botrytis management in future. 

Table 1. Treatment effects on botrytis severity at harvest for trials 

conducted 2006–08 in Australia and New Zealand. 

Year 

Mean botrytis severity at harvest (%) 

Location and 

Leaf 

Variety 1 Control Spray program 2 pluck 

Spray 

+leaf pluck 

06–07 NZ (A) ‐ SB 25.3 7.7 (mid) ‐ ‐ 

“ NZ (HB) ‐ SB 4.5 2.1 2.6 0.3 

“ NZ (HB) ‐ CH 9.6 5.9 ns 2.2 1.7 

“ NZ (M) ‐ SB1 0.2 0.1 ns(early) ‐ ‐ 

NZ (M) ‐ SB2 0.6 ‐ ‐ ‐ 

“ Tas ‐ SB 2.5 0.9 (mid) ‐ ‐ 

“ Tas ‐ R 0.6 0.8 ns ‐ ‐ 

“ Vic ‐ CH1 0.0 0.0 ns ‐ ‐ 

“ Vic ‐ SB 0.1 0.0 ns ‐ ‐ 

“ Vic ‐ CH2 0.0 0.0 ns ‐ ‐ 

07–08 NZ (A) ‐ SB 1.6 0.1 (early) 0.7 0.3 

“ NZ (HB) ‐ SB 8.4 3.5 3.4 0.4 

“ NZ (HB) ‐ CH 9.5 1.9 1.9 0.3 

“ NZ (M) ‐ SB1 2.1 1.5 (mid/early) 1.1 0.2 

NZ (M) ‐ SB2 0.8 ‐ ‐ ‐ 

“ NZ (M) ‐ SB3 5.3 0.6 ‐ ‐ 

“ Tas ‐ SB 2.7 1.6 ns (mid) 2.2 1.9 

“ Tas ‐ R1 6.2 2.6 (mid) ‐ ‐ 

“ Tas ‐ R2 1.9 0.8 ns (mid) ‐ ‐ 

“ Tas ‐ CH 3.6 2.8 (late) ‐ ‐ 

“ Vic ‐ CH1 2.0 0.0 2.1 0.0 

“ Vic ‐ SB 2.3 0.1 0.4 0.6 

“ Vic ‐ CH2 0.8 0.0 0.6 0.0 

DISCUSSION 

Assuming that 3% botrytis severity is a threshold level at which 

growers may suffer a price penalty on their crop, many of our 

trial sites did not reach the 3% severity threshold even when left 

untreated. Botrytis severity at harvest is strongly correlated with 

the length of the ripening period (1) and Auckland and Hawke’s 

Bay were most prone to serious botrytis epidemics, followed by 

Marlborough and Southern Tasmania, with Victoria the lowest 

risk. These results highlight the need for benefit‐cost analyses, as 

the full cost of a spray program (fuel, pesticide, labour, water, 

etc) may not always be recouped, particularly in drier viticultural 

regions like Victoria. 

Leaf plucking was as effective as a complete fungicide program 

at sites with dense canopies. The combined effects of leaf 

removal and fungicide application gave the lowest levels of 

botrytis, but risk of sunburn and effects on fruit quality are also 

important when considering leaf plucking for botrytis control. 

1 

M=Marlborough, HB=Hawke’s Bay, A=Auckland, SB=Sauvignon Blanc, R=Riesling, 

CH=Chardonnay 

2 Full fungicide program or the most effective fungicide timing (shown in brackets). 

ns—fungicide treatments not significantly different to untreated at P ≤ 0.05 


GWRDC, New Zealand Winegrowers and our respective agencies 

for funding this research. 

REFERENCES 

1. Beresford and Hill (2008) Predicting in‐season risk of botrytis bunch 

rot in Australian and New Zealand vineyards. ‘Breaking the mould: 

a pest and disease update’, Australian Society of Viticulture and 

Oenology Seminar Proceedings, Mildura 24 July 2008. 


Development of a soil DNA extraction and quantitative PCR method for detecting two 

Cylindrocarpon species in soil 

INTRODUCTION 

C.M. Probst{ XE "Probst, C.M." }, M.V. Jaspers, E.E. Jones and H.J. Ridgway 

Faculty of Agriculture and Life Sciences, Lincoln University, PO Box 84, Lincoln 8150, New Zealand 

Cylindrocarpon black foot disease has been identified worldwide 

as a common cause of vine death in nurseries and in young 

vineyards (1), especially in sites converted from orchards or 

replanted from grapes. This indicates that the existing soil 

conditions may have contributed to the disease, although very 

little information is available regarding the survival of the 

pathogens in soil. In New Zealand, the three Cylindrocarpon 

species equally responsible for black foot disease on grapevines 

are C. destructans, C. macrodidymum and C. liriodendri (1). 

Recently, quantitative PCR (qPCR) has begun to supersede soil 

dilution plating as a method for precise determination of soil 

inoculum levels (2). In this research program, qPCR was 

optimised to test large soil samples for presence of two 

Cylindrocarpon species. 


Fungal isolates. The Lincoln University Culture Collection 

provided isolates of the three Cylindrocarpon species, which had 

been obtained from symptomatic New Zealand grapevines. 

Single spore colonies of 10 randomly selected isolates per 

species were grown on potato dextrose agar (PDA) at 20°C in the 

dark. 

RESULTS 

The primer pairs were specific for each of the two species and no 

cross reactivity was observed. They produced a 300 bp and 197 

bp product for C. macrodidymum and C. liriodendri, respectively. 

They were also suitable for a range of genetically diverse 

isolates. Each of the primers was able to detect as little as 30 pg 

DNA in a standard PCR and 3 pg DNA in a nested PCR. The qPCR 

could detect pure DNA at the same level as the nested PCR. For 

spore suspensions, the qPCR was able to detect as little as 100 

spores in soil. The time course experiment showed that for each 

species, less than half of the nuclei remained 1 week after 

infesting the soil with conidia. However, at this time, the DNA 

could still be visualised on agarose gels of the qPCR products 

(Fig 1). After 2, 3 and 6 weeks, the DNA could not be detected. 

M ng Weeks 

30 3 0.3 0.03 0.003 0 0 1 2 

Session 1B—Disease surveys 

Soil Infestation. A mixed conidium suspension (10 6 conidia /mL) 

was obtained for each species using three isolates. They were 

used to infest 5 L pots of soil, three replicates per species, with a 

final concentration of 10 5 conidia per gram of soil. Controls were 

treated with a similar quantity of water. The 5 L pots were sunk 

into, and level with, the ground in the Lincoln University 

Vineyard. Two 15 g soil samples were taken from each pot for 

DNA extraction at 0, 1, 2, 3 and 6 weeks after set up. All three 

species were inoculated into each pot to ensure detection 

specificity 

DNA extraction. For pure culture extraction, a small plug of 

mycelium was transferred from a 5 d old PDA culture to potato 

dextrose broth (PDB) and incubated for 7 d at room 

temperature, in 12 h light/ dark. The mycelium was harvested 

and stored at ‐80°C until DNA extraction using a PureGene DNA 

extraction kit (Qiagen). Spectrophotometry was used to quantify 

the genomic DNA. DNA was also extracted from 10 6 conidia of 

each isolate in a similar way. 

For DNA extraction from soil samples, 10 g of soil was placed in a 

250 mL bottle with 45 mL water containing 0.01% agar. The 

bottles were shaken for 10 min and left to stand for 10 min. The 

supernatant was put into two 15 mL tubes, and centrifuged at 

4000 x g for 15 min. The pellets were combined and centrifuged 

again, with the final pellet being used for DNA extraction using a 

PowerSoil kit (MO BIO Laboratories Inc.). Genomic DNA quality 

was assessed by visualisation on a 1% agarose gel. 

PCR amplification. Species specific primers for the β− tubulin 

region of C. macrodidymum and C. liriodendri, donated by Dr 

Lizel Mostert (University of Stellenbosch, South Africa), were 

used in qPCR with SYBR green chemistry and a Rox internal 

standard on an ABI Prism 7700 sequence detector. After the 

qPCR, the products were separated by electrophoresis on a 1.5% 

agarose gel and visualised under UV light. 

Figure 1. 1.5% agarose gel of products amplified during qPCR with the 

primers specific for C. liriodendri. 

DISCUSSION 

The results show that the species specific primers used in a qPCR 

system could detect as little as 3 pg of pure DNA, which is 

equivalent to 30 Cylindrocarpon macroconidia. When spores 

were recovered from soil a sensitivity of 100 spores was 

achieved. Following soil inoculation, DNA of fewer than 50% of 

the conidium nuclei in the soil was detected after 1 week. 

Additional unpublished data has indicated that in the soil 

environment, the 4‐celled conidia were often converted to 2 

chlamydospores (uninucleate). It is possible that the >50% 

decrease observed is a reflection of that conversion, rather than 

the death of conidia. Research is continuing to investigate the 

population dynamics of these Cylindrocarpon species in soil. 

Future research will include the development of C. destructans 

specific primers. 


We gratefully acknowledge Lizel Mostert for providing the 

primers sequences and Winegrowers New Zealand and TECNZ 

for funding this project. 

REFERENCES 

1. Halleen, F., Fourie, P.H. and Crous P.W. (2006). A review of black 

foot disease of grapevine. Phytopathologia Mediterranea 45: S55‐ 

S67. 

2. Kernaghan, G., Reeleder, R.D. and Hoke, S.M.T. (2007). 

Quantification of Cylindrocarpon destructans f. sp. Panacis in soils 

by real‐time PCR. Plant Pathology 56: 508–516. 



Why Australia needs a coordinated national diagnostic system 

J.R. Moran{ XE "Moran, J.R." } 1 , J.H. Cunningtonv, F.J. Macbeth 2 , C.C. Murdoch 1 , A.M. Kelly 3 , D. Hailstones 4 , S.A. Peterson 5 , B. Hall 6 , S. 

Perry 7 , M. Williams 8 

1 Department of Primary Industries, Victoria, Private Bag 15, Ferntree Gully DC, 3156, VIC 

2 Office of the Chief Plant Protection Officer, Department of Agriculture, Fisheries and Forestry, GPO Box 858, Canberra, 2601, ACT 

3 NSW Department of Primary Industries, PMB 8 Camden, 2570, NSW 

4 CRC Diagnostics Research Program, PMG 8, Camden, 2570, NSW 

5 Plant Health Australia, 5/4 Phipps Close, Deakin, 2600, ACT 

6 South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001, SA 

7 Department of Employment, Economic Development and Innovation, GPO Box 46, Brisbane, 4001, Qld 

8 Department of Primary Industries and Water, 13 St John’s Ave, New Town, 7008, Tasmania 

INTRODUCTION 

The accurate and rapid diagnosis of plant pests and diseases 

underpins all management activities aimed at preventing the 

establishment of exotic pests and is a critical component of 

surveillance activities. 

Plant pest diagnostic services also provide the foundation of 

endemic pest management through the timely identification of 

plant pests, if left uncontrolled, can disrupt agricultural plant 

production and restrict market access for agricultural produce. 

Rapid identification also supports quarantine processes, such as 

maintaining pest free areas that allow access to domestic and 

international markets. 

Diagnostic services are delivered by a range of agencies across a 

dispersed geography and climate range. The majority of 

diagnostic services are provided by state agencies with some 

being delivered by the Australian Government, commercial 

diagnostic laboratories, CSIRO, and the Universities (1). Services 

are provided on an ad‐hoc, commercial and nationally 

coordinated basis as required. Diagnostic operations are often 

performed in conjunction with collaborative research activities. 

The development of a national diagnostic system for plant pests 

and diseases has been the subject of discussion for over 10 

years. A number of reviews have been conducted of the national 

capability (1, 2) and issues of standards and accreditation have 

been addressed by the Subcommittee on Plant Health Diagnostic 

Standards (SPHDS) (3). More recently SPHDS has been given the 

responsibility to develop a National Diagnostic Strategy for plant 

health. This strategy will complement the National Plant Health 

Strategy that will be released this year. 

This paper reports on the activities of four diagnostic 

laboratories, their findings and implications for national 

biosecurity. 

METHODS AND RESULTS 

Data was collected from state government diagnostic 

laboratories in Tasmania, South Australia, Victoria and NSW. 

Data was also provided by the Office of the Chief Plant 

Protection Officer (OCCPO). 

Between January 2006 and May 2009, 45 new pest or diseases 

have been brought to the attention of the OCPPO and have 

warranted action by the Consultative Committee on Exotic Plant 

Pests. Of these 16 were fungi, 13 were invertebrates, 11 were 

virus or phytoplasmas and 5 were bacteria. 

interest is that 43% of these investigations arose from ad hoc 

samples submitted to the laboratory from industry. Most of 

these were ornamentals. The diagnostic investigations revealed 

15 new hosts of pathogens already present in Australia, three 

new pathogen records for Victoria, seven new pathogen records 

for Australia and one new undescribed species. 

Data from the other states proved difficult to obtain and to 

analyse. Diagnostic activity was not centrally coordinated and 

details were not easily accessed due to a lack of readily 

searchable databases. South Australian laboratories conducted 

in excess of 90 investigations into suspect emergency plant pest, 

NSW 88, Queensland 63 and Tasmania 20. 

The numbers of investigations conducted by DPI Vic have 

increased from 16 in 2006 to 64 in 2008. Similarly in NSW 

numbers increased from 19 in 2006 to 25 in the first five months 

of 2009. This is in part due to a better understanding by the 

diagnostic laboratory of reporting obligations under the 

Emergency Plant Pest Response Deed (4). 

DISCUSSION 

The data presented here demonstrates the increasing level of 

activity and importance of diagnostic activity nationally. It also 

highlights the benefits of a central coordination of diagnostic 

services within an agency. Those agencies without a centrally 

coordinated diagnostic service find it difficult to ascertain the 

level of diagnostic activity that underpins their states 

biosecurity. This shortcoming will be overcome as Australia 

works towards developing a National Diagnostic System. 


To all the diagnosticians in Australia who have contributed to the 

data presented here. 

REFERENCES 

1. Moran JR and Muirhead IF, 2002, Assessment of the current status 

of the human resources involved in diagnostics for plant insect and 

diseases pests. A report prepared for Plant Health Australia. 

2. Anon, 2003, Developing a world class plant pathology diagnostic 

network. Plant Health Australia Workshop Proceedings 

3. Williams, MA, Hall, BH, Plazinski, J, Gray, P, Moran, JR, Stevens, P, 

Perry, S. (2009) Subcommittee on Plant Health Diagnostic 

Standards. APPS 2009. 

4. Peterson, SA, Macbeth, FJ, 2009, The importance of reporting 

suspect exotic emergency plant pests to your state department of 

primary industry, APPS 2009. 

In the same time the Victorian DPI diagnostic laboratory 

conducted investigations into 133 suspect emergency plant 

pests. Some of these investigations arose from detections 

interstate and consequent national surveillance activities. Of 


Bananas in Carnarvon—good news for growers in survey for quarantine plant pests 

and pathogens 

S.J. Collins{ XE "Collins, S.J." } A , A.E. Mackie A , J.H. Botha A , V.A.Vanstone A , J.M. Nobbs B and V.M. Lanoiselet A 

A 

Department of Agriculture and Food Western Australia, South Perth, 6151, Western Australia 

B 

SARDI Plant and Soil Health, GPO Box 397, Adelaide, 5001, South Australia 

INTRODUCTION 

The banana industry in Carnarvon, Western Australia, is unique 

among other Australian banana growing areas. While bananas are 

typically grown in tropical to sub‐tropical regions where rainfall is 

abundant, Carnarvon has an arid‐desert climate and growers depend 

on year round irrigation. Under these unique conditions, plant pests 

and pathogens common to other Australian banana growing areas 

may not be successful. However, pathogens and pests more suited 

to local conditions could potentially thrive. A survey to identify 

potential quarantine risks and exotic viruses, bacteria, fungi, insects 

and nematodes was initiated by HortGuard® and the Carnarvon 

Banana Producers Committee. 

METHODS 

From the approx. 55 banana growing properties in the Carnarvon 

area, 15 were selected for assessment based on a range in 

production and management practices, yields and years in 

production. Survey activities comprised three main areas, each with 

specific sampling methods. 

Nematodes. From each property, soil and roots were collected from 

ten trees using methods adapted from Pattison et al. (1). Sample 

trees were chosen randomly within older blocks where nematode 

numbers were likely to be higher. Roots were examined for 

symptoms. Nematodes were extracted from roots and soil in a mist 

chamber over 5 days, then quantified and identified. 

Virus, bacteria and fungi. A minimum of 100 plants per property 

were inspected. Leaves, pseudostems, suckers and bunches were 

visually assessed for symptoms of disease, mechanical and 

physiological damage. Symptoms were described in terms of type, 

quantity and severity. The most severely infected leaves were 

incubated in moist trays under natural light for 2–7 days. For 

identification, fruiting bodies on leaves were examined 

microscopically, on half strength Potato Dextrose Agar and on Water 

Agar. As no symptoms were observed for viruses, further testing was 

not conducted. 

Invertebrates. At each property 2–4 blocks of different aged plants 

were assessed using sweep netting and direct observation. Sweep 

net samples were collected from approx. 200 sweeps of the main 

canopy and from 100x10 minute sweeps near the plantation floor. 

Direct observation (10x hand lens) focused on invertebrates found 

on leaves, fruit, flowers and the plantation floor. 


Nematodes. No nematodes of quarantine significance were 

identified. Root Knot Nematode (RKN, Meloidogyne sp.) and Spiral 

Nematode (Helicotylenchus multicinctus) were identified from both 

the roots and soil (Table 1). Spiral Nematode and RKN were present 

in all samples. Root Lesion Nematode (Pratylenchus sp.) was 

identified from the roots, but not the soil in only one sample (2.7/g 

dry root). Root symptoms of both RKN and Spiral Nematode were 

observed. Typical symptoms of Burrowing Nematode (Radopholus 

similis) were absent, and this species was not identified from any 

sample. 

These nematode levels would not be regarded as a production 

constraint in tropical areas. In Carnarvon, where plants did not have 

well developed root systems, it is possible that Spiral and Root Knot 

Nematodes may have a greater impact (T. Pattison, pers. comm., 

2009). In tropical areas, Spiral Nematode is of secondary importance 

to Burrowing Nematode. However, in areas where temperature and 

rainfall conditions are limiting, R. similis is rare, and H. multicinctus is 

the major nematode problem which can cause severe damage and 

decline in bananas. 

Table 1. Spiral and Root Knot Nematode (RKN) densities extracted from 

roots and soil. 

Nematodes/g dry root Nematodes/200g dry soil 

Property Spiral RKN Spiral RKN 

1 473.0 25.9 533.1 58.2 

2 0 56.6 8.5 357.6 

3 162.2 67.4 183.7 164.4 

4 142.9 32.0 1418.9 54.2 

5 638.9 9.7 892.4 29.6 

6 530.4 83.1 236.5 19.4 

7 254.8 22.8 245.6 18.9 

8 149.5 39.0 571.6 89.1 

9 458.1 21.7 577.2 25.5 

10 344.5 22.1 1141.9 26.8 

11 38.4 279.9 59.4 80.2 

12 675.5 1.3 640.6 7.7 

13 415.0 188.3 404.7 11.4 

14 433.8 3.8 450.1 8.4 

15 12.5 200.9 0 167.3 

Virus, bacteria and fungi. No diseases of quarantine significance 

were identified. From the 20 samples collected, secondary fungal 

pathogens were identified from 14, including Alternaria sp., 

Stemphyllium sp., Penicillium sp. and Aspergillus sp. Colletotrichum 

sp. was identified from leaf spots on one sample. Pleospora 

herbarum was identified from one sample of a leaf spot with dark 

margin and bleached centre. P. herbarum is a cosmopolitan fungus 

that is occasionally a weak parasite known to cause leaf spots. 

Invertebrates. No pests of quarantine significance were identified. 

Pest levels were low over the entire area. Seventy per cent of the 

surveyed properties use biocontrol agents, which may account for 

the low pest numbers. Large numbers of spiders, which are 

beneficial in reducing pest invertebrates, were found on all 

properties. These included typical wheel‐web spiders (Araneidae) 

such as Eriophora spp. as well as Sparassidae, Lycosidae and 

Salticidae. 

CONCLUSION 

No exotic pests or diseases were identified. Only low levels of fungal 

pathogens and invertebrate pests were detected. The unique 

environmental conditions of Carnarvon, as well as its isolation from 

other banana growing areas, may contribute to this finding. 

Although Burrowing Nematode (R. similis) was not detected, Spiral 

and Root Knot Nematodes may pose a potential production 

constraint to bananas in this area. 


Thanks to the Carnarvon Banana HortGuard ® Committee and the 

APC Carnarvon Banana Producers Committee for supporting and 

funding this work. D. Parr and S. Lawson assisted with sample 

collection. H. Hunter, X. Zhang, L. De Brincat, C. Wang, M. You and N. 

Eyres processed, and identified samples in the laboratory. 

REFERENCES 

1. Pattison T, Stanton J, Treverrow N, Lindsay S, Campagnolo D (2000) 

Managing Banana Nematodes. 2nd ed. Qld Horticulture Institute, 

DPIQ. 



Session 1C—Soilborne diseases 

Can investment in building up soil organic carbon lead to disease suppression in 

vegetable crops? 

INTRODUCTION 

I. Porter{ XE "Porter, I." } A , R. Brett A , S. Mattner A , C. Hall A , R. Gounder A , N. O’Halloran B , P. Fisher B and J. Edwards A 

A Biosciences Research Division, Knoxfield Centre, Private Bag 15, Ferntree Gully Delivery Centre, 3156 

B Future Farming Systems Division, Tatura Centre, 3616, DPI Victoria 

Over the past few years, there has been increasing recognition 

of soil as an important non‐renewable asset that needs to be 

managed well and looked after. Practices to improve soil health 

are increasingly being recommended such as building up soil 

organic carbon by the addition of green manures, animal 

manures, organic mulches, composts, etc. 

Soilborne diseases have traditionally been controlled with the 

use of chemicals such as fumigants and fungicides. These options 

are being withdrawn worldwide for human health and 

environmental reasons. Alternative methods of control such as 

the use of biofumigant crops and strategic nutrient application 

are now being used more widely by industries. However, what is 

the penalty cost of using these methods when conditions are 

unfavourable for disease? Can improvements in soil health such 

as building up organic carbon be used to create disease 

suppressive conditions on vegetable farms? 


Trials were set up to examine the impact of disease 

management practices and soil organic amendments on crop 

productivity and profitability at two vegetable farms in southern 

Victoria. 

At site 1, with a history of clubroot of brassica (Plasmodiophora 

brassicae), chemical fumigation, biofumigation, fungicides, 

nitrate and slow release ammonium fertilisers and organic soil 

conditioners (chicken manures, silage and composted green 

waste) were applied to broccoli grown during winter when 

conditions were unfavourable for disease. 

Long‐term trials were also established at both sites to compare 

the effect of organic amendments with the standard practice of 

metham fumigation on crop yield, profitability and soil health 

characteristics. Treatments wer applied in autumn and spring of 

2008. Crop rotations included lettuce, broccoli, endive, leeks and 

celery. 

Overhead irrigation, base fertiliser, insecticide and herbicides 

were applied as required, according to local grower practice. 

Trial designs were randomised complete blocks with treatments 

replicated 4 times. Yield data were analysed using ANOVA. 

Effects on soil biological, chemical and physical characteristics 

were measured but data analysis is still under way. 


Tailored site‐specific nutrient applications were able to provide 

equivalent yields (Figure 1) and profit as soil fumigation, with 

potentially better benefits to the environment. The 

biofumigants, Voom and Fumifert, and composted organic mulch 

gave yields equivalent to standard grower practice. Fluazinam, a 

pesticide registered for clubroot control, resulted in lower yields 

than standard grower practice due to its tendency to cause a 

delay in crop maturity. 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

Fluaz.+GBA+CaNO3 

3rd harvest 

2nd harvest 

1st harvest 

Rustica fertilzer 

Perlka 

Fluazinam 

Broccoli Yields (kg/plot) Lamattina, 2008 

GBA 

Green Org. Compost 

Grower practice 

Voom 

Fumifert 

Alzon 

Metham 800 L/ha 

Metham 425 L/ha 

GBA+CaNO3 

Figure 1. Short term study: Marketable yield of broccoli (3 harvests) 

grown with different soil treatments in winter 2008 at Boneo, Victoria, 

LSD = 1.24. 

Broccoli yield (kg) 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

Standard grower - low 

Metham - low 

Average Total Broccoli Yield 

Standard grower - high 

Composted mulch - low 

Metham - high 

Silage - low 

Composted mulch - high 

Treatment 

Chicken Manure - low 

Chicken Manure - high 

Silage - high 

Yield cut 4 

Yield cut 3 

Yield cut 2 

Yield cut 1 

Figure 2. Long term study: Marketable yield of broccoli grown with 

different organic amendments during winter 2008. 

Organic amendments, although producing moderate yields 

(Figure 1), reduced grower profit in the short term study, but 

increased yields and maintained profit in the long term study 

(Figure 2). The trials also confirmed better water and nutrient 

use efficiency and biological indicators are showing an increase 

in biological activity which leads to better soil resilience and 

possible disease suppression. Current and future trials have been 

set up to evaluate the long term effect of repeated treatments, 

particularly with respect to disease suppression. A cost/benefit 

model is also being developed to help growers determine the 

benefits of soil health for different crop production systems. 


Horticulture Australia Ltd, DPI Victoria and the Vegetable 

Industry funded this research. 


Evaluation of soil health indicators in the vegetable industry of temperate Australia 

INTRODUCTION 

R.W. Brett{ XE "Brett, R.W." }, R.K. Gounder, S.W. Mattner, C.R. Hall and and I.J. Porter 

Biosciences Research Division, DPI Victoria, Private Bag 15, Ferntree Gully Delivery Centre, 3156, Vic 

Soil health benchmarking trials commenced in the temperate 

vegetable industry in 2007 as part of a national program to 

better understand soil health and its impact on vegetable 

production efficiency and soilborne diseases. 

The aim of the benchmarking trials was to identify soil biological, 

physical and chemical tests that could be used to detect changes 

in soil caused by various farm management practices. Ultimately, 

the study aims to use these indicators to identify good soil 

health strategies that suppress soilborne pathogens. 


In 2007, 14 commercial production sites and three nonproduction 

(“control”) sites were selected at two vegetable 

farms on sandy soil at Cranbourne, Victoria. 

Olsen P (mg/kg) 

300 

250 

200 

150 

100 

50 

0 

optimal P 

TS3 

PS5 

TSNC 

PS4 

PS3B 

PS2 

PS3A 

PS1 

TS2 

TS1 

TS43b 

TS43a 

TS33a 

TS43d 

TS33b 

TS43c 

TS4 


Sites that were at different stages of production (table 1) were 

compared with each other and with non‐production sites. A 

suite of biological, chemical and physical tests were evaluated 

for their robustness as indicators of soil health under a range of 

farm practices (1). 

Table 1. Site selection for benchmarking studies 

Site name 

TS1 

TS2 

TS4 

PS1, PS3A 

PS2, PS3B 

PS4 

TS33a, TS43a,c 

TS33b, TS43b,d 

PS5, TS3, TSNC 

Crop stage at sampling 

6 week spinach 

Fallow 

Celery tansplant 

Leeks residue incorporated 

Leeks mature 

Kohl rabi residue incorporated 

Fumigated, lettuce transplant 

Lettuce transplant 

Non‐production 


Biological tests. Populations of free‐living nematodes were 

quantified as an indicator of a site’s previous history and 

potential resilience following disturbance. Populations and 

community structure of free‐living nematodes were affected by 

soil disturbances such as tillage, fumigation, or residue 

incorporation, but tended to recover over time. These data 

indicate that although tillage, fumigation and crop residue 

management can stimulate flushes of bacterial colonisation, 

populations of microbial organisms may stabilise during crop 

growth. This was more evident for crops of longer (leeks) rather 

than shorter (lettuce) duration. These observations are 

important when considering the resilience of soils and long term 

sustainability of vegetable production. 

Chemical tests. Available phosphorus was always higher in 

production compared with non‐production sites, irrespective of 

cropping history (Figure 1). Combined with wide‐ranging levels 

of potassium and sulphur measured in many cropped sites, these 

results suggest inappropriate fertiliser application may be 

common in vegetable production. The impact of this on control 

of soilborne diseases could be important and will be considered 

in future studies. 

Figure 1. Phosphorus levels were higher than required for vegetable 

production at cropped sites compared with non‐production sites, 

irrespective of cropping history. 

CONCLUSION 

On the sandy Cranbourne soils, nematode communities 

responded rapidly to changing soil conditions caused by farm 

practices and are a good indicator of past soil management, and 

potentially a good indicator of soil resilience and soil health. 

Some chemical measures such as available phosphorus, 

potassium and sulphur were useful in identifying poor fertiliser 

management and therefore poor soil health practices. 

Additional chemical and biological measures such as nitrogen, 

carbon and soil‐borne disease thresholds are being evaluated in 

current field trials to identify indicators that show how altered 

farm management can improve suppression of soilborne 

diseases. 

The indicators of soil health that prove to be robust predictors of 

the relationship between on‐farm practices, crop yield and soil 

health will be further developed so that growers can improve 

nutrient, water and disease management on farm. The 

information will become part of a national database which will 

enable growers to better manage farm inputs and improve the 

sustainability and soil health of the vegetable industry in 

temperate Australia. 


This work was funded by Horticulture Australia Ltd, the Victorian 

Vegetable Industry and the Victorian DPI. We thank the 

vegetable farmers who provided land and resources to conduct 

these trials. 

REFERENCES 

1. Porter, I., Brett, R., and Mattner, S. (2007) Management of soil 

health for sustainable vegetable production. Horticulture Australia 

Ltd VG06090 Final report. 



INTRODUCTION 

Rhizoctonia AG2.1 and AG3 in soil—competition or synergism? 

T.J. Wiechel{ XE "Wiechel, T.J." } and N.S. Crump 

Biosciences Research Division, DPI Victoria, Knoxfield Centre, Private Bag 15, Ferntree Gully Delivery Centre 3156 

Rhizoctonia solani causes stem and stolon canker, which delay 

and reduce emergence, as well as black scurf on tubers. AG2.1 

and AG3 are the most dominant anastomosis groups isolated 

from potato plants (1). The interactions between AG2.1 and 3 

have not been fully examined. Strains within the one species 

that co‐occur in a habitat (soil) and may have similar resource 

requirements may be expected to compete with each other. 

Competition between fungi has been categorised as either 1) 

colonisation of unoccupied habitat or 2) colonisation of habitat 

that is already occupied (2). This study used radish as a model 

system to investigate whether AG2.1 and AG3 compete with 

each other in soil, or act synergistically to produce disease. 


Soil inoculation. An isolate of AG2.1 and AG3 (both originally 

from potato) were inoculated into soil in combination at various 

rates: 1—1 plate fungal mycelium, 0.5—half plate fungal 

mycelium, 0.25 quarter plate fungal mycelium per 8 kg soil 

(Table 1). Nine radish seeds were planted per pot with 5 

replicate pots, and grown at 17°C in a growth room (cool) or 

27°C in the glasshouse (warm). Emergence and pruning of the 

radish seedlings was assessed weekly for 5 weeks. Plants were 

harvested and assessed for yield, after 4 weeks (warm 

conditions), or 8 weeks (cool conditions). 

There was a good negative relationship between AG2.1 soil 

inoculum treatments and radish emergence (R 2 ‐0.9). 

Emergence at 7 days 

10 

9 

8 

7 

6 

5 

4 

3 

2 

1 

0 

lsd 0.5217 p

INTRODUCTION 

Towards universal detection of Luteoviridae 

A. Chomic{ XE "Chomic, A." } A , M. Pearson B and K. Armstrong A 

A 

Bio‐Protection Research Centre, Lincoln University, PO Box 84, Lincoln 7647, New Zealand 

B School of Biological Sciences, University of Auckland, PB 92019, Auckland, New Zealand 

Luteoviridae is a plant virus family of 26 species which causes 

yield losses in cereals, potatoes and other economically 

important crops worldwide. Accurate detection and fast 

identification are important components of controlling the 

spread of luteoviruses and reducing yield losses. 

3. C1F1/C2R3 detected ScYLV species. 

None of the primer combinations detected PEMV‐1 or CtRLV. 

Session 1D—Virology 

PCR based detection is often the method of choice for 

Luteoviridae as it is more sensitive than serological methods [1] 

which frequently fail to detect infection due to the low 

concentration of luteoviruses in plants. Since the currently 

available luteovirus primers are mostly species specific and work 

under different PCR conditions, universal primers are desirable. 

Following PCR amplification sequencing may be required to 

confirm virus identity, often resulting in several days delay. A 

possible alternative is the use of melt curve analysis (MCA) 

which requires less time than sequencing and can be preformed 

in most real‐time PCR equipment. MCA is already used for 

identification of some animal and plant viruses. 

We tested 7 primers designed to target the most conserved 

regions of the Luteoviridae genomes and which possess high 

homology to over 75% of Luteoviridae species. We also tested 

the suitability of MCA in identification of Luteoviridae species. 


Virus isolates. Thirty luteovirus isolates representing 15 species 

were obtained from New Zealand and overseas (either as 

infected freeze dried plant material or as cDNA). These included 

all 5 species from the Luteovirus genus, 8 of the 9 species from 

the Polerovirus genus (except CYDV‐RPS), PEMV‐1 (the only 

species from the Enamovirus genus) and CtRLV which is not 

assigned to a genus. 

PCR. Reactions were performed using three combinations of 

primers (7 primers in total): 

1. C1F1/C1F2/C1R1/C1R2 (129bp and 148bp amplicons) 

2. C2F1/C2F2/C2R3 (68bp amplicon) 

3. C1R1/C2R3 (75bp amplicon) 

All primers have a low level of degeneracy and amplify a 

fragment from the coat protein gene. Amplification products 

were sequenced to confirm their identity. 

Figure 1. Amplification of Luteoviridae with primers C2F1, C2F2 and 

C2R3. Lanes: 1 – BWYV, 2 – BMYV, 3 – BClV, 4 – BLRV, 5 – PLRV, 6 – TuYV, 

7 – CABYV, 8 – CYDV‐RPV, 9 – SbDV, 10 – Negative (water), M – 1kB 

Ladder (NEB).’ 

The primers are homologous to 6 other Luteoviridae species 

(SPLSV, BYDV‐SGV, BYDV‐GPV, BYDV‐RMV, GRAV and TVDV) but 

amplification of those species is yet to be tested. 

Melt curve analysis showed that at least 5 Luteoviridae species 

can potentially be distinguished by different melt temperatures; 

but exact temperatures are yet to be determined. 

ACKNOWLEDGMENTS 

We acknowledge Dave Saul and Karin Farreyrol (Univ. Auckland) 

for the original primer design. We thank J.Fletcher, C.Delmiglio, 

O.LeMaire, M.Stevens, B.Wintermantel, S.Saumtally, T.van 

Antwerpen and S.Fuentes for kindly supplying virus isolates and 

MAF Bio‐Security New Zealand, in particular J.Tang, for technical 

assistance. This work was supported by MAF Biosecurity New 

Zealand and Better Border Biosecurity. 

REFERENCES 

1. D’Arcy, C.J., L.L. Domier, and L. Torrance, Detection and Diagnosis 

of Luteoviruses, in The Luteoviridae, H.G. Smith, and Barker, H., 

Editor. 1999, CABI Publishing. 

Melt Curve Analysis. Real‐time PCR was performed using the 

same three primer combinations as above, SYBR GreenER I 

fluorescent dye and an ABI PRISM ® 7000 real‐time cycler. The 

melting of amplification products was performed at a rate of 

0.2ºC/min. 


Between them the three combinations of primers detected all 13 

of the the Luteovirus and Polerovirus species tested: 

1. C2F1/C2F2/C2R3 primers detected nine species (Fig.1). 

2. C1F1/C1F2/C1R1/C1R2 primers detected BYDV‐PAV, BYDV‐ 

MAV and BYDV‐PAS. 



Massive parallel sequencing of small RNAs to identify plant viruses and virus‐induced 

small RNAs 

R.M. MacDiarmid{ XE "MacDiarmid, R.M." } A , D. Cohen A , A.G. Blouin A and L.J. Collins B 

A 

The New Zealand Institute for Plant and Food Research Ltd, 120 Mount Albert Road, Auckland, New Zealand 

B 

Allan Wilson Centre for Molecular Ecology and Evolution and Institute of Molecular BioSciences, Massey University, Palmerston North, 

Massey University, Palmerston North, New Zealand 

INTRODUCTION 

Small RNAs are short (20–25 nt) RNAs that can guide the 

degradation of target mRNA or alternatively inhibit their 

translation. The net result of either process is the lack of 

functionality of the target RNA. In plants, small RNAs are 

generated from two distinct sources: the plant genome or 

infecting viruses 1 . The intrinsic small RNAs encoded by a plant 

are mainly composed of microRNAs that are processed from 

longer RNA transcripts and target other plant‐encoded mRNAs. 

Small interfering (si) RNAs are derived from an infecting virus 

and target that same virus RNA for degradation, thus forming 

the basis of a highly malleable, sequence‐specific defence 

mechanism. 

Recent advances in sequencing technologies now permit the 

economic identification of millions of RNA sequences from a 

single sample of plant tissue. Knowledge of the siRNA sequences 

in a plant infected with an unknown virus provides a potential 

tool for identification of the virus from which the sequences are 

derived. This process is aimed at use at the border by Biosecurity 

New Zealand. 

Figure 1. Venn diagram illustrating the pools of small RNA sequences 

derived from uninfected and infected tissue. 


Plant and virus samples. Nicotiana occidentialis plants grown at 

20°C with 10 hours low light per day were either mockinoculated 

or inoculated from leaf samples infected with one of 

four known viruses or from six plants infected with unknown 

viruses. Small RNAs were isolated and sequenced using the 

Genome Analyser (Illumina®) at the Allan Wilson Centre 

Genome Sequencing Service. 

Bioinformatic programs. Data were matched to known targets 

using ELAND (Illumina®), or formed into contiguous sequences 

using Velvet 2 or Edena 3 before matching to virus sequences in 

publicly available sequence databases using Basic Local 

Alignment Search Tool (BLAST) 4 . 


We have sequenced small RNAs from both uninfected and virus 

infected samples, resulting in over 22 million sequences 

(~500,000 unique sequences). The unique sequences present in 

uninfected tissue were subtracted in silico from the infected 

sequence pool to identify the small RNAs specific to uninfected 

tissue and those common to both uninfected and virus‐infected 

tissues (Figure 1). The remaining sequences that were present 

only in the virus‐infected tissue were then used either to match 

to a known infecting virus (Figure 2) or to develop a method to 

identify unknown virus infectious agents also present in the 

tissue. To increase search specificity, contiguous sequences were 

generated before BLAST analyses. 

Subtraction in silico of the infecting virus siRNAs from the 

sequences found only in virus‐infected plants left a large pool of 

small RNAs (~240,000 unique sequences) that were 

(presumably) not of viral origin. The identity of these novel 

plant‐derived small RNA sequences present in response to virus 

infection is being investigated and will be discussed. 

Figure 2. Alignment of small interfering RNAs to the genome of a 

potexvirus. The potexvirus genome (five arrows representing open 

reading frames) is aligned with the ~4,000 unique, cognate siRNA 

sequences (dashes). 


This research is funded by the New Zealand Foundation for 

Research, Science and Technology (C06X0710). 

REFERENCES 

1. Mlotshwa S, Pruss GJ, Vance V. (2008) Small RNAs in viral infection 

and host defense. Trends Plant Sci. 13(7): 375–82. 

2. Zerbino DR, Birney E. (2008) Velvet: algorithms for de novo short 

read assembly using de Bruijn graphs. Genome Res. 18(5):821–9. 

3. Hernandez D, Francois P, Farinelli L, Osteras M, Schrenzel J. (2008) 

De novo bacterial genome sequencing: millions of very short reads 

assembled on a desktop computer. Genome Res. 18:802–809. 

4. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W. & 

Lipman DJ. (1997) Gapped BLAST and PSI‐BLAST: a new generation 

of protein database search programs. Nucleic Acids Res. 25:3389– 

3402. 


Chickpea chlorotic stunt virus, an important virus of cool‐season food legumes in Asia 

and North Africa and potentially in Australia 

Safaa G. Kumari{ XE "Kumari, S.G." } A , Nouran Attar A , H. Josef Vetten B and Joop van Leur c 

A International Center for Agricultural Research in the Dry Areas (ICARDA), P.O. Box 5466, Aleppo, Syria 

B Julius Kuehn Institute, Federal Research Centre for Cultivated Plants (JKI), Messeweg 11/12, 38104 Braunschweig, Germany 

C New South Wales Department of Primary Industries, Tamworth Agricultural Institute, 4 Marsden Park Road, Calala NSW 2340, Australia 

INTRODUCTION 

Chickpea chlorotic stunt virus (CpCSV), a proposed new member 

of the genus Polerovirus (family Luteoviridae) was first described 

in Ethiopia in 2006 (1) and has since been reported from Eritrea 

(4), Syria (3), Egypt, Morocco and Sudan (2). It naturally infects 

many legume crops (e.g., chickpea, lentil, field pea, faba bean) as 

well as some leguminous weeds and four wild non‐legume plant 

species (1, 2, 3, 4). Typical symptoms of CpCSV‐infected plants 

are leaf rolling, yellowing and stunting (Figure 1‐A). CpCSV is a 

phloem‐limited virus that is present in very low concentrations 

and transmitted only by aphids (Aphis craccivora Koch.) in a 

persistent manner (1, 3). 

This study reports the use of a few monoclonal antibodies to 

CpCSV (1, 2) for detecting different CpCSV isolates from 8 

countries in Asia and North Africa. 


Sample collections, diagnostic techniques and reagents used—A 

total of 3265 food legume samples showing yellowing/stunting 

symptoms were collected from 8 countries (Azerbaijan, China, 

Eritrea, Ethiopia, Lebanon, Syria, Tunisia and Yemen) and tested 

for the presence of CpCSV using the following three mixtures of 

CpCSV monoclonal antibodies (MAbs) in tissue‐blot 

immunoassay (TBIA): M‐I = 1‐1G5 + 1‐3H4 + 1‐4B12; M‐II = 5‐2B8 

+ 5‐3D5; and M‐III= 5‐5B8 (1, 2). In addition, over 500 TBIA blots 

from chickpea, faba bean and field peas collected in northern 

NSW, Australia, for different types of symptoms were processed 

with the CpCSV MAbs. 


Figure 1‐B shows how CpCSV is detected in infected plants by 

using TBIA. 

A 

B 

Figure 1. (A) Symptoms produced 

on a chickpea plant infected with 

chickpea chlorotic stunt virus 

(CpCSV); (B) TBIA detection of 

CpCSV in a stem blot from an 

infected chickpea plant (top) as 

compared to that from a noninfected 

plant (bottom). 

Table 1 summarises the reactions of the MAbs with the samples 

from 8 countries in Asia and North Africa. Results obtained 

placed the tested samples in four groups: group A comprised 

1218 samples (from Azerbaijan, Lebanon, Syria, Tunisia and 

Yemen) reacting with MAbs M‐II and M‐III; group B contained 

254 samples (from Azerbaijan, China, Eritrea, Ethiopia and 

Tunisia) reacting only with MAb M‐I; group C included 77 

samples (from Azerbaijan and Ethiopia) reacting with MAbs M‐I 

and M‐II; and group D consisted of 38 samples (from Ethiopia 

and Tunisia) reacting only with MAb M‐II. The presence of CpCSV 

was confirmed in a representative number of samples from each 

group and country by RT‐PCR using specific primer sets. This is 

the first record of CpCSV in Azerbaijan, China, Lebanon, Tunisia 

and Yemen. 

Testing of the Australian samples gave CpCSV‐positive reactions 

for several chickpea, faba bean and field pea samples, which 

tested negative to antisera specific for other luteoviruses. These 

findings require reconfirmation, but are an indication that CpCSV 

(or a closely related non‐described virus) may be present in 

Australia. Sequence analysis of RT‐PCR amplicons is in progress 

and will shed more light on the relatedness among the 

aforementioned groups and to the two major CpCSV strains 

proposed by Abraham et al. (2). 

Table 1. TBIA reactions of different luteovirus isolates with three groups 

of monoclonal antibodies raised against CpCSV 

No. of 

samples 

No. of TBIApositive 

TBIA reaction with 

different CpCSV MAbs* 

Country/Crop tested samples M‐I M‐II M‐III 

Eritrea 

Chickpea 211 32 + ‐ ‐ 

Tunisia 

Chickpea 711 6 + ‐ ‐ 

8 ‐ + ‐ 

335 ‐ + + 

Faba bean 127 8 ‐ + + 

Azerbaijan 

Chickpea 320 11 ‐ + + 

2 + + ‐ 

153 + ‐ ‐ 

Lentil 86 1 + ‐ ‐ 

Ethiopia 

Chickpea 129 70 + + ‐ 

29 ‐ + ‐ 

1 + ‐ ‐ 

Lentil 9 

5 + + ‐ 

1 ‐ + ‐ 

Faba bean 190 4 + ‐ ‐ 

Fenugreek 80 55 + ‐ ‐ 

China 

Faba bean 15 2 + ‐ ‐ 

Syria 

Chickpea 579 460 ‐ + + 

Faba bean 362 279 ‐ + + 

Lentil 78 46 ‐ + + 

Pea 21 12 ‐ + + 

Yemen 

Pea 35 19 ‐ + + 

Lebanon 

Chickpea 32 3 ‐ + + 

Faba bean 232 43 ‐ + + 

Pea 35 1 ‐ + + 

Lentil 13 1 ‐ + + 

* M‐I= 1‐1G5+1‐3H4+1‐4B12; M‐II= 5‐2B8+5‐3D5; M‐III= 5‐5B8 (1, 2) 

REFERENCES 

1. Abraham AD, Menzel W, Lesemann DE, Varrelmann M, Vetten HJ 

(2006) Chickpea chlorotic stunt virus: A new polerovirus infecting 

cool‐season food legumes in Ethiopia. Phytopathology 96, 437– 

446. 

2. Abraham, AD, Menzel W, Varrelmann M, Vetten HJ (2009) 

Molecular, serological and biological variation among chickpea 

chlorotic stunt virus isolates from five countries of North Africa and 

West Asia. Archives of Virology 154 (Published online, April 5, 2009) 

3. Asaad NY, Kumari SG, Kassem AH, Shalaby A, Al‐Chaabi S, Malhotra 

RS (2009) Detection and characterization of chickpea chlorotic 

stunt virus in Syria. Journal of Phytopathology 157 (Published 

online, April 15, 2009). 

4. Kumari SG, Makkouk KM, Loh M, Negassi K, Tsegay S, Kidane R, 

Kibret A, Tesfatsion Y (2008) Viral diseases affecting chickpea crop 

in Eritrea. Phytopathologia Mediterranea 47, 42–49. 




INTRODUCTION 

Emerging frontiers in forest pathology 

Michael J. Wingfield{ XE "Wingfield, M.J." } 

Forestry and Agricultural Biotechnology Institute, University of Pretoria, Pretoria 0002, South Africa 

If one uses the first text book on the topic as starting point, the 

study of tree diseases is a little more than 100 years old. Thus, 

Robert Hartig’s fundamental text published in 1874 and 

translated into English in 1894 as “Textbook of the diseases of 

trees” provided the first firm foundation for forest pathology. It 

is interesting, that it was not long after the publication of 

Hartig’s forest pathology text book that chestnut blight caused 

by Cryphonectria parasitica was first found outside its native 

range in the United States in 1904. At the time, this might have 

been considered co‐incidental, but it was clearly linked to 

growing trade, particularly between northern hemisphere 

countries and particularly including wood and wood products. 

Thus, outbreaks of devastating diseases such as white pine 

blister rust, Dutch elm disease and others caused by non‐native 

pathogens first emerged more or less during the same period of 

time. 

The study of tree diseases and the field of forest pathology have 

grown firmly during the course of the last Century. The causal 

agents of diseases of unknown aetiology have been discovered, 

new diseases have been recorded and the biology of the biology 

of many important tree pathogens has been elucidated. A suite 

of outstanding text books have been produced both for the 

teaching environment as well as for diagnosticians. Furthermore, 

we have celebrated the careers of many outstanding forest 

pathologists, working in many different parts of the world and 

contributing substantially to our understanding of tree 

pathogens and the diseases that they cause. 

While forest pathology has become a well‐established field of 

study and outstanding forest pathologists practice in many 

countries, there are causes for concern. In this regard, new and 

in some cases very serious tree diseases continue to appear 

regularly, both in natural forests and in plantation environments. 

This implies that in many situations, we are failing to manage the 

global threats to forests and forestry due to diseases. Ironically, 

there are also indications, at least in some countries that 

positions for forest pathologists and educators in this field are 

decreasing, rather than increasing in number. 

NEW TREE PATOHGEN TRENDS 

The threats relating to new diseases emerging from the 

accidental movement of pathogens from one area to another is 

well‐recognised. This is also a category of disease that continues 

to increase, despite global efforts to manage the movement of 

plants and plant products. A worrying trend that appears to be 

increasing is the adaptation of pathogens to new hosts. 

Apparent host and vector shifts, at levels previously unexpected 

are occurring for host specific pathogens. Novel pathogens are 

also emerging through hybridisation. The processes leading to 

host/vector shifts and hybridisation leading to the evolution of 

so‐called “new pathogens” are pathogens” are poorly 

understood and they deserve increased attention. 

FOREST PATHOLOGY OPPORTUNITIES 

New tree diseases and new categories of tree disease are 

emerging and this is a trend that is likely to continue to grow. 

This will also bring new and exciting challenges for forest 

pathologists. New tools and technologies continue to become 

available for research and these will clearly also enhance the 

depth and breadth of tree pathology investigations. 

Identification of tree pathogens and disease diagnosis is a field 

that has changed markedly during the course of the last two 

decades. The emergence of DNA‐based tools for these purposes 

is now commonly used and this will be increasingly true in the 

future. Many tree pathogens that have been treated as single 

species are now known to represent suites of cryptic taxa and 

this is already having a substantial impact on for example 

quarantine regulations. DNA based techniques have likewise 

made it possible to recongnise hybrids between species and they 

have shifted our understanding of pathogen population biology 

to new and exciting levels. Furthermore, diagnostics have 

become much more rapid and also more accurate. These are all 

areas that will grow substantially in the foreseeable future. 

For many years, quarantine efforts to restrict the movement of 

pathogens, was based on lists of names of undesirable 

organisms. It is now widely recognised that such lists have many 

flaws, many that have also emerged from the more 

sophisticated taxonomy and population biology tools now 

available. The focus has clearly shifted to understanding 

pathways that allow pathogens to move globally. Many 

opportunities remain to be explored in this domain and exciting 

new strategies are likely to emerge in the future 

In order to understand the importance and impact of climate 

change on tree health, there will clearly need to be a greater 

focus on team research. The importance of integrating the 

efforts of scientists from different disciplines has long been 

recognised. Yet there are disappointingly few examples of tree 

health research conducted by formally constituted and 

supported multidisciplinary teams. 

CONCLUSION 

Forest pathology is more important today than it has ever been 

in the past. The threat of tree diseases in their many different 

manifestations has increased steadily ever since they were first 

formally recognised. This trend is likely to continue to grow. The 

challenge for forest pathologists will be to fight for a fair share of 

biological science budgets for tree health research. This funding 

can then be expended to capture the many new and exciting 

opportunities and technologies that can contribute substantially 

to improving the current and future health of the world’s 

forests. 

Climate change is one of the most important issues facing the 

world and it will clearly also impact on tree health. Very little 

focused research has been conducted on the likely impact of 

climate change on tree diseases. This is a complex area of study 

but it is also one that will require the attention of forest 

pathologists globally. 


INTRODUCTION 

Variability in pathogenicity of Quambalaria pitereka on spotted gums 

G.S. Pegg{ XE "Pegg, G.S." } A , A.J. Carnegie B , M.J. Wingfield C , A. Drenth A 

A 

Tree Pathology Centre, The University of Queensland/Primary Industries and Fisheries, Queensland, Australia, 4068 

B 

Forest Resources Research, NSW Department of Primary Industries, New South Wales, Australia, 2119 

C 

Forestry and Agricultural Biotechnology Institute, University of Pretoria, South Africa, 0002 

Quambalaria shoot blight (QSB) is a serious disease affecting the 

expanding eucalypt plantation estate in subtropical and tropical 

eastern Australia (1,2). Quambalaria pitereka has been isolated 

from foliage, stems and woody tissue of species in the genera 

Corymbia, Blakella and Angophora in Australia (1,2,3). 

Quambalaria pitereka affects the new flush of Corymbia foliage 

causing spotting, necrosis and distortion of expanding leaves and 

green stems. 

The aim of this investigation was to identify if variation in 

pathogenicity levels existed between isolates of Q. pitereka 

collected from a range of species and regions in NSW and 

Queensland. 


Isolates of Q. pitereka were collected from spotted gum 

plantations and Corymbia species trials in north Queensland 

(NQ), south east Queensland (SEQ) and northern New South 

Wales (NSW). Isolates used were: Q107 from C. torelliana (NQ), 

Q147 from C. citriodora (NQ), Q151, Q152 from C. variegata 

(SEQ) and Q191, Q200 from C. variegata (NSW). 

Spotted gum seedlings (1/2 sibling Woondum provenance) and 

cuttings were grown in steam sterilised soil mix and fertilised 

with slow release Osmocote ® (Native Trees) as required and 

irrigated twice a day for 10 minutes each using overhead 

sprinklers. Glasshouse temperatures were maintained at 25– 

28°C during the day and 20–22°C overnight. Seedlings were 

grown for three months prior to inoculation with Q. pitereka. 

QSB Score (x/100) 

35 

30 

25 

20 

15 

10 

5 

0 

Q107 Q147 Q151 Q152 Q191 Q200 

Quambalaria pitereka isolate 

Figure 1. Comparison of pathogenicity of a range of isolates of 

Q. pitereka on spotted gum, Woondum provenance. 

DISCUSSION 

Variability in pathogenicity between isolates of Q. pitereka has 

not previously been studied. This preliminary study using isolates 

from a range of regions identifies only a small degree of 

variability. More extensive studies are needed to investigate the 

significance of pathogen virulence on disease development, 

especially in relation to selecting for disease resistance. Further 

studies are required to investigate Q. pitereka population 

genetics and potential variability in isolate virulence. 


We thank Queensland Primary Industries Innovation and 

Biosecurity Program Investment, Forest Plantations Queensland, 

Integrated Tree Cropping, Forest Enterprises Australia and 

Forests NSW for providing the necessary funding for this 

research. 

Session 2A—Forest pathology/native 

Isolates of Q. pitereka were obtained from single lesions and 

grown on Potato Dextrose Agar (PDA) for 2 to 3 weeks in the 

dark at 25°C. A spore suspension (1x10 6 spores/ml) was obtained 

by washing plates with sterile distilled water (SDW) to which two 

drops of Tween 20 had been added prior to inoculation. 

Seedlings were inoculated using a fine mist spray (2.9 kPa 

pressure) generated by a compressor driven spray gun (Iwata 

Studio series 1/6 hp; Gravity spray gun RG3, Portland, USA), to 

the upper and lower leaf surfaces of the seedlings until runoff 

was achieved. All seedling trees were covered with plastic bags 

immediately after inoculation to maintain high humidity levels 

and to increase the period of leaf wetness. Bags were removed 

after 48 hours and plants watered using overhead irrigation 

systems twice a day for a period of 10 minutes. Sub‐samples of 

the spore suspension applied to the trees were placed onto PDA 

and incubated at 25°C for 48 hours to ensure that the spores 

were viable. 

REFERENCES 

1. Carnegie AJ, 2007a. Forest health condition in New South Wales, 

Australia, 1996–2005. I. Fungi recorded from eucalypt plantations 

during forest health surveys. Australasian Plant Pathology 36, 213– 

24. 

2. Pegg GS, O’Dwyer C, Carnegie AJ, Wingfield MJ, Drenth A 2008. 

Quambalaria species associated with plantation and native 

eucalypts in Australia. Plant Pathology 57, 702–14. 

3. Simpson JA, 2000. Quambalaria, a new genus of eucalypt 

pathogens. Australasian Mycologist 19, 57–62. 

Each treatment was replicated six times with a single inoculation 

per tree and assessed for disease incidence and severity 14 days 

later. A QSB score was then calculated to compare levels of 

pathogenicity between isolates. A comparison between isolates 

was done using ANOVA (StatView®). 

RESULTS 

Significant variability in pathogenicity was observed between 

isolates. Isolate Q152 was significantly more virulent than all 

other isolates. 



Movement of pathogens between horticultural crops and endemic trees in the 

Kimberleys 

INTRODUCTION 

T.I. Burgess A , J.D. Ray B , M.L. Sakalidis{ XE "Sakalidis, M.L." } A , V. Lanoiselet C , G.E.StJ. Hardy A 

A 

School of Biological Sciences and Biotechnology, Murdoch University, Murdoch, 6150, Australia 

B 

Australian Quarantine and Inspection Service, NAQS/OSP, Marrara NT, 0812 

C Department of Agriculture and Food , Baron‐Hay Court , South Perth, 6151, WA 

Recently a survey of endophytes associated with boabs 

(Adansonia gregorrii) and associated tree species in the 

Kimberleys, Western Australia has resulted in the description of 

seven new species in the Botryosphaeriaceae (Pavlic et al. 2008). 

Additionally several common species of Lasiodiplodia, 

(L. theobromae, L. pseudoptheobromae and L. parva) were also 

isolated as endophytes of endemic tree species. 

Concurrently, surveys in the Ord River Irrigation Area (ORIA) 

have revealed Mangiferum indica trees showing symptoms of 

dieback and cankers. In this project we isolated, identified and 

determined the pathogenicity of fungi associated with these 

cankers. 


Isolation and identification. Fungi were isolated from cankers 

using standard techniques. Due to the similarity in morphological 

features among the Botryosphaeriaceae, molecular 

identification was conducted by extracting DNA, amplifying and 

sequencing the ITS and EF1‐α gene regions (Burgess et al. 2005) 

and conducting phylogenetic analysis to identify cryptic species. 

Pathogenicity trails. Trials were conducted using unripe but 

mature Kensington pride mangoes The mangoes were washed in 

water then submerged in 1.5% NaOH (Bleach) solution for 2 

minutes to disinfest. Mangoes were then allowed to air dry and 

were stored overnight at temp 28–33°C. Mangoes were 

inoculated with 11 fungal isolates (9 replicates per isolate), by 

wounding with the tip of a sterile pipette and immediately 

placing a colonised agar plug mycelia side down over the wound. 

After 6 days the lesions were measured. 


Seven species from the Botryosphaeriaceae were isolated from 

mangoes in the ORIA. Three of these species, L. theobromae, 

N. ribis and N. dimidiatum are known pathogens of mangoes 

causing either cankers or post‐harvest disease. Four species, 

P. adansoniae, N. novaehollandia, L. pseudotheobromae and 

L. parva have not been reported previously from mangoes, but 

are commonly found as tree endophytes in the surrounding 

region. 

Table 1. Species of Botrysphaeriaceae isolated as endophytes of endemic 

trees in the Kimberleys and causing disease in mangoes in Kununurra 

Species Mangoes Trees 

Pseudofusicoccum adansoniae # 

Pseudofusicoccum kimberleyense # 

Pseudofusicoccum ardesiacum # 

Lasiodiplodia theobromae 

Lasiodiplodia pseudotheobromae 

Lasiodiplodia parva 

Lasiodiplodia margaritacea # 

Lasiodiplodia crassispora 

Dothiorella longicollis # 

Fusicoccum ramosum # 

Neoscytalidium novaehollandia # 

Neoscytalidium dimidiatum 

Neofusicoccum ribis 

# denotes species newly described by Pavlic et al. 2008 

Common endophytes and latent pathogens of mangoes, 

Neofusicoccum mangiferae, N. parvum and Botryosphaeria 

dothidea, were not isolated in the ORIA. In addition N. ribis was 

isolated very rarely. The most commonly isolated pathogens 

were L. theobromae, P. adansoniae and the two Neoscytalidium 

spp. interestingly these fungi are also common in the 

surrounding endemic vegetation. It appears that many of the 

pathogens of mangoes in the ORIA have moved onto the trees 

from the surrounding environment rather than arriving with 

nursery stock. The differences in the species found in the ORIA 

compared with other mango growing regions could be due to 

the geographic isolation of the region. 

REFERENCES 

1. Burgess TI, Barber PA, Hardy GESJ, 2005. Botryosphaeria spp. 

associated with eucalypts in Western Australia including 

description of Fusicoccum macroclavatum sp. nov. Australasian 

Plant Pathology. 34: 557–567. 

2. Pavlic D, Barber PA, Hardy GESJ, Slippers B, Wingfield MJ, Burgess 

TI, 2008. Seven new species of the Botryosphaeriaceae discovered 

on baobabs and other native trees in Western Australia. Mycologia. 

100: 851–866. 

All tested species were pathogenic to mangoes, with 

Lasiodiplodia theobromae causing the largest lesion followed by 

the Neoscytalidium spp. P. adansoniae caused the smallest 

lesions. 


Pathogenicity of Phytophthora multivora to Eucalyptus gomphocephala and 

E. marginata 

P.M. Scott 1 , P. Barber 1 , T. Jung 1 , B.L. Shearer 1,2 , G.E. Hardy, T.I. Burgess{ XE "Burgess, T.I." } 1 

1 Centre of Phytophthora Science and Management, School of Biological Sciences and Biotechnology, Murdoch University, Australia 

2 Science Division, Department of Environment and Conservation, Australia 

INTRODUCTION 

Since the early 1990s there has been a significant decline of 

E. gomphocephala, and more recently E. marginata, in the tuart 

forest in tuart woodland in Yalgorup National Park SW Western 

Australia, although no satisfactory aetiology has been 

established to explain the decline. Characteristics of the canopy 

dieback and decline distribution are reminiscent of other forest 

declines known to involve Phytophthora soil pathogens and 

indicate that a Phytophthora species may be involved in the 

decline. In 2007 isolates of Phytophthora multivora, recently 

described by (1), were recovered from rhizosphere soil of 

declining or dead trees of Eucalyptus gomphocephala and 

E. marginata. For E. gomphocephala and E. marginata, the 

pathogenicity of P. multivora was tested: ex situ on seedlings 

using a soil infestation method; and in situ on stems using an 

under bark infestation method. 


Ex situ soil inoculation trial: The roots of E. gomphocephala 

seedlings, grown in neutral coarse river sand, were infested with 

a vegetable juice—vermiculite medium colonised with five 

isolates of P. multivora isolated across the Yalgorup decline and 

two isolates of P. cinnamomi; while the roots of E. marginata 

seedlings were infested with one isolate of P. multivora as 

described (2). After one year the roots of infested seedlings were 

scanned and the lengths of roots of different diameters were 

calculated using the WINRHIZO Pro V 2007d software (Reagent 

Instruments, Québec, Canada). Isolates were recovered from the 

roots of all infested seedlings. 

In situ under bark inoculation trial: The stems of less than 1.5 m 

tall E. gomphocephala saplings, naturally growing on site in 

Yalgorup National Park, were under bark inoculated with five 

isolates of P. multivora; while saplings of E. marginata were 

inoculated with one isolate of P. multivora as described (3).After 

nine weeks saplings were harvested and lesion lengths 

calculated. 

RESULTS 

Ex situ soil inoculation trial: Preliminary results from the ex situ 

soil infestation trial indicate that E. gomphocephala seedlings 

treated with P. multivora isolate Pm1 and Pm2 and P. cinnamomi 

isolates Pc1 and Pc2, had significantly less roots between 0–2 

mm in diameter compared to the control (Figure 1). Eucalyptus 

gomphocephala seedlings infested with P. multivora isolates 

Pm3, Pm4 and Pm5 did not have significantly less roots 

compared to the control across any size class. Eucalyptus 

marginata seedlings infested with P. multivora isolate Pm1, did 

not have significantly less roots compared to the control across 

any size class. 

In situ under bark inoculation trial: Saplings of E. gomphocephala 

and E. marginata inoculated with all P. multivora isolates had 

significantly longer lesions compared to the control. When 

harvested the average lesion length on P. multivora inoculated 

E. gomphocephala and E. marginata seedlings was 13.6 mm and 

90.5 mm respectively. 

Root length (cm) 

20000 

16000 

12000 

8000 

4000 

0 

Con Pm1 Pm2 Pm3 Pm4 Pm5 Pc1 Pc2 

Isolates 

Figure 1. Length of live roots (mean ± SE) of E. gomphocephala seedlings 

for roots 0–2 mm in diameters Con, control; Pm 1–5, P. multivora 

isolates 1–5; Pc 1–2 P. cinnamomi isolates. 

DISCUSSION 

The significant reduction in root diameter in E. gomphocephala 

seedlings after infestation with isolates Pm1 and Pm1 indicates 

that P. multivora is a pathogen of E. gomphocephala under 

glasshouse conditions and may be a significant soil pathogen to 

E. gomphocephala in the field. The variation in pathogenicity of 

P. multivora isolates used in the soil infestation trial suggests 

that there is variation in the pathogenicity of P. multivora 

isolates within the field. 

The significant lesion lengths measured in E. gomphocephala and 

E. marginata sapling inoculated with P. multivora isolates 

confirms that P. multivora is a pathogen to both host species 

under conditions where P. multivora can colonise the vascular 

tissue in the field. The lesion lengths indicate that P. multivora 

can be especially E. marginata saplings. 

The variation in pathogenicity observed between isolates and 

species in both soil infestation and under bark inoculation trials 

suggests that P. multivora can be significantly aggressive to both 

E. gomphocephala and E. marginata; although further research 

is needed to understand the population dynamics of the 

pathogen and its impact within the tuart decline in Yalgorup 

National Park. 

REFERENCES 

1. Scott PM, Burgess TI, Barber PA, Shearer BL, Stukely MJC, Hardy 

GESJ, Jung T (2009) Phytophthora multivora sp. nov., a new species 

recovered from declining Eucalyptus, Banksia, Agonis and other 

plant species in Western Australia. Persoonia. 

2. Jung T, Blaschke H, Neumann P (1996) Isolation, identification and 

Pathogenicity of Phytophthora species from declining oak stands. 

European Journal of Forest Pathology 26, 253–272. 

3. Shearer BL, Michaelsen BJ, Somerford PJ (1988) Effects of isolate 

and time of inoculation invasion of secondary phloem of Eucalyptus 

spp. and Banksia grandis by Phytophthora spp. Plant Disease 72, 

121–126. 




INTRODUCTION 

Microscopy of progressive decay of fungi isolated from meranti tree canker 

E. Erwin{ XE "Erwin, E." } A , Won‐Joung Hwang B , Shuhei Takemoto C and Yuji Imamura D 

A Forestry Faculty, University of Mulawarman, Jln. Ki Hajar Dewantara No.1, Samarinda 75123, Indonesia 

B Institute of Wood Technology, Akita Prefectural University, 11‐1 Kaieizaka, Noshiro, Akita 016‐0876, Japan 

C Plant Pathology Research Team, National Institute of Fruit Tree Science, Tsukuba, Ibaraki 305‐8605, Japan 

D Research Institute for Sustainable Humanosphere (RISH), Kyoto University, Uji, Kyoto 611–0011, Japan 

White rot basidiomycetes are especially important in the forest 

ecosystem because they are the only fungi capable of degrading 

all cell wall components (cellulose, lignin, hemicelluloses) of 

wood. Micromorphological aspects of two main types of white 

rot, selective delignification and simultaneous rot, have been 

distinguished [1]. Light red meranti (Shorea smithiana) and 

yellow meranti (Shorea gibossa) trees which growing in one area 

of natural dipterocaprs in Kalimantan, Indonesia inhabited by 

white‐rot fungi, Schizophyllum commune [2] and Phlebia 

brevispora [3], respectively. It is of interest that S. commune and 

P. brevispora in the decayed wood of standing S. smithiana and 

S. gibbosa and have been causing simultaneous decay. 

This study was performed to confirm their progressive decay 

patterns in artificial laboratory conditions (in vitro). 


Fungal strain and decay test procedure. The decay fungi isolated 

from decayed wood of S. smithiana and S. gibbosa cankerous 

trees, were genetically identified by their ITS sequence as 

Schizophyllum commune [2] and Phlebia brevispora [3], 

respectively. Twelve sound wood‐blocks (20 x 20 mm in crosssection 

x 10 mm in length) obtained from the uninfected 

portions of the stem disks were inoculated with the identified 

fungi, and incubated in accordance with the JIS K 1571 soil‐block 

test procedure [4]. 

Microscopic observations. Various stages of the decay wood 

were examined using light and scanning electron microcopy. Six 

exposure times were analyzed: 2, 4, 6, 8, 10 and 12 weeks. 

RESULTS 

After 12 weeks of exposure in the laboratory decay test, wood 

blocks of S. smithiana that had been inoculated with S. commune 

fungus sustained an average weight loss of 1.82%, whereas P. 

breviospora decayed S. gibbosa wood more aggressively than S. 

commune (Table 1). 

Table 1. Weight loss in S. smithiana and S. gibbosa wood infected with S. 

commune and P. brevispora, respectively. 

Weight loss percentage 

Incubation period 

(Mean±SE) 

(weeks) S. smithiana S. gibbosa 

2 0.42 ± 0.32 0.91 ± 0.10 

4 0.50 ± 0.44 2.24 ± 0.60 

6 0.54 ± 0.50 5.02 ± 1.03 

8 0.60 ± 0.62 8.23 ± 1.22 

10 0.80 ± 0.40 11.80 ± 5.15 

12 1.82 ± 0.40 12.34 ± 2.76 

Figure 1. Decay wood caused by fungus for 12 weeks incubation. (A) 

Hyphal branches of S. commune fungus passed through pits in vessels of 

S. smithiana (arrows). Bar 5 μm; (B) Erosion channels in parenchyma 

cells adjacent to infected vessels of S. gibbosa (arrow). Bar 10 μm. 

DISCUSSION 

Slight erosion of wood cell walls in S. smithiana over 12 weeks’ 

incubation was classified as the early stage of simultaneous 

decay, and showed a similar pattern to that observed in 

naturally decayed wood samples. 

P. brevispora reduced S. gibbosa wood weight by 0.91–12.34% 

and produced progressive simultaneous decay over 2–12 weeks’ 

incubation in vitro. The first 6 weeks of incubation was classified 

as the early stages decay, in which pit erosion and slight erosion 

of cell walls facilitated hyphal between cells. Numerous and 

conspicuous holes as well as erosion troughs in cell walls, which 

were found at the end of 8 weeks’ incubation, showed that an 

intermediate stage of decay had occurred. Furthermore, 

complete degradation of wood cell components, termed the 

advanced stage of decay, was found in some areas of wood 

blocks after 12 week’s incubation. 

REFERENCES 

A 

1. Blanchette RA (1984) Screening wood decayed by white‐rot fungi 

for preferential lignin degradation. Appl Environ Microbiol 48:647– 

653 

2. Erwin, Takemoto S, Hwang WJ, Takeuchi M, Itoh T, Imamura Y 

(2008) Anatomical characterization of decayed wood in standing 

light red meranti and identification of the fungi isolated from the 

decayed area. Journal of Wood Science 5:233–241 

3. Erwin, Hwang WJ, Takemoto S and Imamura, Y (2007) 

Micromorphological changes of wood and decay fungi in yellow 

meranti (Shorea gibossa) stem canker. 57th Annual Meeting of the 

Japan Wood Research Society. Hiroshima, August 8–10. 

4. JIS K 1571 (2004) Test methods for determining the effectiveness of 

wood preservatives and their performance requirements. Japanese 

Industrial Standard (JIS), Japanese Standards Association, Tokyo. 

B 


Optimising conditions to investigate gene expression in pathogenic Streptomyces 

using RT‐qPCR 

INTRODUCTION 

T.J. Wiechel{ XE "Wiechel, T.J." }, R.C. Ates and N.S. Crump 

Biosciences Research Division, DPI Victoria, Knoxfield Centre, Private Bag 15, Ferntree Gully Delivery Centre 3156 

Pathogenic Streptomyces species cause common scab of potato. 

The pathogen produces a phytotoxin, thaxtomin A, that induces 

a host response that creates the corky symptoms of common 

scab that can be superficial, raised, netted or deep pitted. QPCR 

is being increasingly used as a method for mRNA quantification 

but only a relatively few studies have reported the use of RTqPCR 

for plant pathogens. This study aimed at optimising total 

RNA isolation from pathogenic Streptomyces spp. and using RTqPCR 

conditions to quantify thaxtomin A transcripts. 

Ct value 

Session 2B—Soilborne disease 


Pathogenic Streptomyces strain. Streptomyces scabies strain S29 

was grown on yeast malt extract agar (YME) at 27°C. After one 

week S29 was inoculated into 3 types of growth media (yeast 

malt extract broth YME, thaxtomin defined medium broth TDM, 

oatmeal broth OM) both with and without cellobiose (1). The 

inoculated media were incubated at 27°C on a rotating shaker 

for one week then filtered through cheese cloth to separate the 

Streptomyces cultures from the media. The cultures were used 

fresh or stored at ‐20°C until ready to extract RNA. 

RNA extraction. RNAqueous 4 PCR (Ambion) for isolation of 

DNA‐free RNA was used to extract total RNA from the 

Streptomyces cultures according to the manufacturers 

instructions. 

cDNA synthesis and quantification. Total RNA was treated with 

DNaseI and ABI High capacity cDNA reverse transcription kit was 

used to transcribe RNA into cDNA according to the 

manufacturers instructions. The resulting cDNA was quantified 

using Nanodrop ND‐1000 Spectrophotometer. 

cDNA dilutions and qPCR. The cDNA was diluted to the following 

concentrations 500, 250, 125 and 62.5 ng/5 µL and replicated 3 

times. QPCR was performed in 0.2 mL tubes in a Rotor Gene 

3000 machine (Corbett Research). Each 25 µL reaction consisted 

of 50 ng template cDNA, 1x SYBR qPCR Super Mix (Invitrogen) 

0.1 µM of primers TxTATq1 and TxTATq2 (2). The thermal cycle 

protocol was 50°C for 2 min, 95°C for 2 min and 45 cycles of 95°C 

for 15 sec and 60°C for 60 sec and Melt cycle of 60–95°C in 1°C 

intervals. Negative controls without cDNA template were run 

with every assay to rule out contaminations. 

RESULTS 

The RNA isolation method RNAqueous 4 PCR provided a high 

quantity of high integrity RNA. The RNA was transcribed into 

cDNA using the ABI High capacity cDNA reverse transcription kit 

and gave good quality cDNA. The transcript levels of thaxtomin A 

were quantified using SYBR qPCR with primers specific to 

thaxtomin A. A standard curve was constructed from the means 

of the serially diluted cDNA replicates (Figure 1). The small 

standard errors with these replicates demonstrated that the 

assay is reproducible and highly robust. The transcript levels of 

thaxtomin A were greater in media amended with cellobiose 

than without, with oatmeal broth having the highest transcript 

levels as expressed by Ct value (Figure 2). 

Concentration ng/ 5 µL 

Figure 2. Standard curve obtained from serially diluted cDNA. Ct values 

are the means of 3 replicates. Error bars represent standard error of the 

means. 

Fluorescence 

OM+ 

YME- 

TDM+ 

OM- 

+ve 

YME+ 

TDM- 

Figure 3. Amplification curves for amended media. OM oatmeal, OM+ 

oatmeal with cellobiose, TDM thaxtomin defined medium, TDM+ 

thaxtomin defined medium with cellobiose, YME yeast malt extract, 

YME+ yeast malt extract with cellobiose. 

DISCUSSION 

This proof of concept study optimised the RNA extraction 

method from pathogenic Streptomyces and RT‐ qPCR conditions 

to quantify thaxtomin A transcripts. The levels of thaxtomin A 

varied depending on the growth media used, with oatmeal plus 

cellobiose giving the highest quantity. The next stage of this 

research will be to use these optimum conditions to study gene 

expression of pathogenic Streptomyces spp. 


This project was facilitated by HAL in partnership with the 

processing potato industry, funded by the processing potato levy 

and voluntary contributions from industry partners. The 

Australian Government provided matched funding for HAL’s R&D 

activities. DPI Victoria contributed funding to this project. 

REFERENCES 

1. Johnson EG, Joshi MV, Gibson DM, Loria R (2007) Cellooligosaccharides 

released from host plants induce pathogencity in 

scab‐causing Streptomyces species. Physiological and Molecular 

Plant Pathology 71:18–25. 

2. Crump NS (2005) Prediction and molecular detection of soilborne 

pathogens of potato. Final Report HAL PT01019. 

-ve 



Fusarium oxysporum and Pythium species associated with vascular wilt and root rots 

of greenhouse cucumbers 

INTRODUCTION 

L.A. Tesoriero{ XE "Tesoriero, L.A." } A , L.M. Forsyth A and L.W. Burgess B 

A NSW Department of Primary Industries, EMAI, PMB 8, Camden, 2570, NSW 

B The University of Sydney, 2006, NSW 

Fusarium wilt of cucumber caused by F. oxysporum f.sp. 

cucumerinum (F.o.cuc) and root rots caused by Pythium species 

have a worldwide distribution. F. oxysporum f. sp. radiciscucumerinum 

(F.o.r‐cuc) has more recently been described in 

Europe and North America causing stem and root rots of 

greenhouse cucumbers (1, 2). F.o.r‐cuc was shown to be 

genetically distinct from F.o.cuc (3). 


Pythium isolates were assigned to nine taxonomic groups. Seven 

conformed to named species: P. aphanidermatum (Edson) 

Fitzpatrick, P. coloratum Vaartaja, P. irregulare Buisman, P. 

mamillatum Meurs, P. oligandrum Drechsler, P. spinosum 

Sawada, and P. ultimum Trow var. ultimum Trow. The remaining 

two taxa were placed in Pythium ‘Group T’ and the Pythium 

species ‘HS Group’ (4). 

Pythium species are commonly associated with roots from a 

wide botanical host range (4). Member species and isolates can 

be aggressive pathogens, weakly pathogenic, secondary 

invaders, saprophytes or hyperparasites. 

Except for the one previous study of Fusarium wilt in Australian 

greenhouse cucumbers (5), the causes and severity of wilt, stem 

and root rots are unknown. 

Preliminary surveys of greenhouse cucumbers in crops grown in 

the peri‐urban districts of Sydney revealed severe vascular wilt, 

stem and root rots associated with heavy crop losses. The 

purpose of this study was to identify potential agents 

responsible for these diseases and to determine their 

significance across major Australian production areas. 


Greenhouse cucumber crops were surveyed across major 

Australian production areas in NSW, Qld., S.A. and W.A. between 

2001 and 2006. Cucumber plants were assessed in‐situ for 

stunting, wilting, discolouration of hypocotyl tissue, and pinkorange 

sporulation on stem lesions. Samples of diseased plants 

that were not permanently wilted were collected, transported to 

a laboratory and processed within 24 hours where possible. 

Growers freighted further samples directly to the laboratory. 

Sub‐samples of symptomatic roots and stems were washed 

clean of soil or media, surface‐sterilised in a hypochlorite 

solution and rinsed in sterile‐distilled water. 

Pythium species were isolated from roots and crown tissue that 

had been plated to potato carrot agar amended with 5 ppm 

pimaricin and 10 ppm rifampicin. Fusarium species were 

similarly isolated from roots and stem vascular tissue plated to 

¼‐strength potato dextrose agar amended with 100 ppm 

novobiocin. Plates were incubated at 25°C and examined for the 

presence of typical features of these genera under a compound 

light microscope. Pythium species were sub‐cultured and 

identified (4). Fusarium isolates were single‐spored and 

identified (6). 

Representative isolates of Pythium taxa were further 

characterised by sequence analysis of ITS rDNA regions and 

compared with published sequences (7). 

Fusarium isolates were compared with F.o.cuc and F.o.r‐cuc 

reference isolates from overseas by determining their vegetative 

compatibility groupings (VCGs), repPCR profiles and sequences 

of their β−tubulin, calmodulin and α−elongation factor genes. 

One unique VCG of F. oxysporum dominated in all production 

areas. It also had a unique repPCR profile while gene sequences 

aligned closely with F.o.cuc. A number of other isolates each had 

unique VCGs while they shared similar repPCR profiles. A subset 

of this group clustered with gene sequences of F.o.r‐cuc. Further 

VCG studies will be required for F.o.cuc isolates since the 

publication of four new groups from China (8). 

This study confirmed that F.o.cuc is the major subspecies of 

Fusarium oxysporum associated with greenhouse cucumber 

vascular wilt disease in Australia. Isolates consistent with F.o.rcuc 

were also identified as a minor population. Pathogenicity 

and host range studies completed the characterisation of 

representative Fusarium and Pythium isolates. Results of these 

studies will be reported elsewhere. 


NSW DPI, the Australian Government and HAL Ltd funded this 

study. L. Gunn, S. Azzopardi, F. Lidbetter, C. Howard and S. 

Peterson assisted with molecular studies. Thanks also to B. 

Summerell and E. Liew for guidance and use of the laboratory at 

the RBG, Sydney. 

REFERENCES 

1. Vakalounakis, D.J. 1996. Root and stem rot of cucumber caused by 

Fusarium oxysporum f. sp. Nov., Plant Disease 80:313–316. 

2. Punja, Z.K. and Parker, P. 2000. Development of Fusarium root and 

stem rot, a new disease on greenhouse cucumber in British 

Columbia, caused by Fusarium oxysporum f.sp. radiciscucumerinum, 

Canadian Journal of Plant Pathology 22:349–363. 

3. Vakalounakis, D.J. and Fragkiadakis, G.A. 1999. Genetic diversity of 

Fusarium oxysporum isolates from cucumber: differentiation by 

pathogenicity, vegetative compatibility, and RAPD fingerprinting, 

Phytopathology 89:161–168. 

4. Plaats‐Niterink, A.J. van der. 1981. Monograph of the genus 

Pythium. Studies in Mycology 21, 242pp. 

5. Wicks, T.J., Volle, D. and Baker, B.T. 1978. The effect of soil 

fumigation and fowl manure on populations of Fusarium 

oxysporum f.sp. cucumerinum in glasshouse soil and on the 

incidence of cucumber wilt. Agricultural Record 5:5pp. 

6. Burgess L.W., Summerell B.A., Bullock S, Gott K.P. and Backhouse D 

1994. Laboratory Manual for Fusarium Research (3rd Edition) The 

University of Sydney, 133pp. 

7. Lévesque, C.A. and De Cock, A. 2004. Molecular phylogeny and 

taxonomy of the genus Pythium. Mycological Research 108:1363– 

1383. 

8. Vakalounakis, D.J, Wang, Z., Fragkiadakis, G.A., Skaracis, G. and Li, 

D‐B. 2004. Characterisation of Fusarium oxysporum isolates 

obtained from cucumber in China by pathogenicity, VCG and RAPD. 

Plant Disease 88:645–649. 


Fusarium oxysporum f. sp. fragariae: a main component of strawberry crown and root 

rots in Western Australia 

INTRODUCTION 

H. Golzar{ XE "Golzar, H." } and D. Phillips 

Department of Agriculture and Food Western Australia, 3 Baron‐Hay Court South Perth WA 6151 

Root and crown rots are important diseases of strawberry crops 

worldwide. The fungi Phytophthora spp., Verticillium spp., 

Fusarium spp., Gnomonia fragariae and Colletotrichum spp. have 

been reported as causal agents of strawberry crown and root 

rot, and they caused considerable yield reduction. In many cases 

the causes of root rot are referred to several pathogens of which 

Pythium spp., Rhizoctonia spp., Cylindrocarpon spp., Phoma spp., 

Coniothyrium spp. and Fusarium spp. have been the most 

common in the root rot complex (1, 3). Fusarium oxysporum f. 

sp. fragariae has been reported in Queensland, Western 

Australia and Japan as an important pathogen of strawberry (2, 

3, 4). 


Field survey. During the surveys conducted a high incidence of 

strawberry death was observed in coastal districts up to 50 km 

north of Perth areas in 2005 and 2006. A total of 50 partially 

diseased and asymptomatic plants were randomly collected 

from ten major strawberry fields. Roots were carefully washed 

under running tap water and the crown of each plant was 

dissected lengthwise. Vascular discolouration of the crown and 

root was evident on some of the samples collected. 

Isolation method. Crowns and roots of diseased and 

asymptomatic plants were surface‐sterilised by immersion in a 

1.25% aqueous solution of sodium hypochlorite for 1 min, rinsed 

in sterile water and dried in a laminar flow cabinet. Out of 50 

samples 500 root and crown specimens with equal numbers of 

10 pieces per sample were selected randomly. Specimens were 

separately placed on potato dextrose agar (PDA), water agar and 

selective media (P10VPH and P10VP) and then incubated at 22 ± 

3°C. Emerged fungal colonies were sub‐cultured on carnation 

leaf agar, PDA and V‐8 juice agar and incubated at 25°C with a 

12 h dark and light cycle. Growth rate, colony morphology and 

morphological characteristics of the isolated fungi were 

determined. 

Pathogenicity test. The pathogenicity of 10 Fusarium isolates 

was tested on Fragaria × ananassa cv. Camarosa, Lycopersicon 

lycopersicum cv. Petula and Cucumis sativus (Lebanese 

cucumber) in a glasshouse experiment. Strawberry runners and 

4‐week‐old seedlings of tomato and cucumber were inoculated 

by dipping the roots in a spore suspension (10 5 spores/mL) 

before planting. Controls were dipped in tap water. 


During the surveys, a high incidence of decline and death of 

strawberries was observed. Mortality of Camarosa and Gaviota 

varieties of strawberry (Fragaria × ananassa) was between 0 and 

60% in some strawberry fields. 

recovery of the fungi (Table1) was indicated that Fusarium spp. 

(74%) was predominant while Phytophthora spp. (21%), Pythium 

spp. (23.5%), Phoma spp. (3%), Rhizoctonia spp. (9%), 

Colletotrichum spp. (1.5%) and Macrophomina spp. (16%) were 

minor components of root and crown rots of strawberries. In 

most cases combination of fungi were recovered from both root 

and crown strawberry samples tested. A culture of F. oxysporum 

f. sp. fragariae has been deposited in the culture collection of 

Department of Agriculture and Food Western Australia as WAC 

12708. 

Table 1. Average percentage of fungi associated with root and crown 

rots of Camarosa cultivar in 2005 and 2006 

2005 and 2006 

Total recovery % 

Recovered Fungi Diseased Healthy* 

Fusarium oxysporum f. sp. fragariae 74.0 10.0 

Phytophthora spp. 21.0 1.5 

Pythium spp. 23.5 9.0 

Phoma spp. 3.3 0.0 

Rhizoctonia spp. 9.3 2.0 

Colletotrichum spp. 1.5 0.0 

Macrophomina spp. 16.0 1.0 

Others 9.0 1.0 

* Asymptomatic plant 

Strawberry root and crown rots seem to be caused by diverse 

fungi. Determining the specific fungus or fungi causing crown 

and root rots is complicated, because the fungi isolated from 

diseased tissue may only be capable of causing disease under 

specific conditions or only in specific associations with other 

organisms. 

ACKNOWLEDGEMENT 

The authors would like to thank the Western Australia 

strawberry industry for financial support. 

REFERENCES 

1 D’Ercole N, Nipoti P, Manzali D (1989) Research on the root rot 

complex of strawberry plants. Acta Horticulturae 265, 497–506. 

2 Golzar, H, Phillips, D. and Mack S. 2007. Occurrence of strawberry 

root and crown rot in Western Australia. Australasian Plant 

Disease Notes. 2, P. 145–147 

3 Maas JL (1998) ‘Compendium of strawberry diseases.’ 2nd edn. 

(APS Press: St Paul, MN) 

4 Winks BL, Williams YN (1965) A wilt of strawberry caused by a new 

form of Fusarium oxysporum. Queensland Journal of Agricultural 

and Animal Sciences 22, 475–479. 


Of the 500 root and crown specimens, Fusarium spp. was 

consistently isolated from diseased plants. Fusarium isolates 

used were pathogenic on the strawberry runners but nonpathogenic 

on the tomato and cucumber plants tested. On the 

basis of morphological characteristics and pathogenicity tests, F. 

oxysporum f. sp. fragariae was identified as a main component 

of root and crown rots of strawberries. Average percentage 



Evaluation of resistant rootstocks for control of Fusarium wilt of watermelon in Nghe 

An Province, Vietnam 

V.T. Dau A , N.V. Dang B , D.H. Nguyen A , L.T. Pham A , T.T.M. Le A , H.T. Phan C , L.W. Burgess{ XE "Burgess. L.W." } D 

A Nghe An Plant Protection Sub‐Department, 19 Tran Phu St., Vinh, Nghe An, Vietnam 

B 

Syngenta, 16 3A St., Bien Hoa 2 Industrial Area, Dong Nai, Vietnam 

C National Institute of Medicinal Materials, 3B Quang Trung St, Hanoi, Vietnam 

D Faculty of Agriculture, Food and Natural Resources, The University of Sydney, Sydney, 2006, New South Wales, Australia 

INTRODUCTION 

Fusarium wilt of watermelon, caused by Fusarium oxysporum 

f.sp. niveum, has caused serious losses in watermelon crops in 

Nghia Dan District, Nghe An Province, Vietnam over the past two 

years, and is threatening the viability of the industry (1). We 

demonstrated that the local watermelon cultivar could be 

grafted successfully onto a resistant rootstock in 2008. In this 

paper we report on the evaluation of a range of potential 

resistant rootstocks in relation to graft compatibility and 

watermelon production and quality, and the assessment of three 

rootstock‐scion combinations under commercial conditions. 

MATERIALS, METHODS AND RESULTS 

We evaluated the local cultivar Bau trang (Lagenaria sinceraria) 

together with five hybrid cucurbits for use as resistant 

rootstocks. The hybrids, provided by Syngenta, Thailand, were 

Kazako, Carnivar and Bulrojangsaeng (S. sinceraria), and 

Emphasis and Argentaria (pumpkin). The simple grafting 

technique as refined by Syngenta, is efficient and can be taught 

quickly to farmers. The three basic tools used by our cooperating 

farmers are a razor blade, and home‐made scalpel and stylet 

(Figure 1). 

Figure 2. Successful graft of watermelon on resistant rootstock (A) and 

graft junction on mature plant (B). 

The Bulrojangsaeng hybrid was the best rootstock on all criteria 

but the farmers consider it too expensive. Consequently the Bau 

trang cultivar was used as a resistant rootstock in an initial 0.1ha 

field trial in soil with a history of severe watermelon wilt, in 

spring 2009. Two watermelon cultivars from Syngenta, Thuy Loi 

and Phu Dong, were used as scions. The grafted plants were not 

affected by Fusarium wilt and produced marketable fruit. 

Staff from Nghe An Plant Protection Sub‐Department and 

Syngenta held farmer field schools on Fusarium wilt and the 

grafting technique in March, 2009. A cooperating farmer planted 

an eight‐hectare summer crop of grafted seedlings in late April, 

2009. He used the Bau trang rootstock and two watermelon 

cultivars in his trial, Hac My Nhan and Dat Viet (Nong Viet 

Company), selections based on cost of seed. The results of this 

planting will be reported. 

Figure 1. Basic tools used for grafting watermelon onto Fusarium wilt 

resistant rootstock. Home made scalpel (top), stylet (middle) and razor 

blade (bottom) 

The grafting process involves excising the stem of the rootstock 

seedling immediately above the cotyledons, at the first true leaf 

stage. A narrow cone shaped slot is then made in the stem with 

the stylet. The upper part of the stem of a watermelon seedling 

(0.8 to 1.0cm long), at the cotyledon stage, is then removed with 

a razor blade, making an oblique transfer cut. The scion is then 

inserted in the slot in the rootstock stem. The grafting process 

takes about 10 to 15 seconds. The success rate is approximately 

80% or greater depending on experience. A successful graft is 

shown in Figure 2. 

DISCUSSION 

The use of watermelon grafted onto resistant rootstocks has 

been shown to be a successful approach for the prevention of 

Fusarium wilt in soils with high inoculum levels. The cost of seed 

in relation to yield, fruit quality and market acceptance in Hanoi 

will determine the preferred combinations of scions and 

rootstocks. The widespread use of tomatoes grafted onto 

resistant rootstocks for control of bacterial wilt in Vietnam (2) 

indicates the potential for using resistant rootstocks to prevent 

losses from a range of diseases caused by soil‐borne pathogens. 


Financial support from the Australian Centre for International 

Agricultural Research (ACIAR CP/2002/115) is gratefully 

acknowledged. 

REFERENCES 

1. Dau VT, Burgess LW, Pham LT, Phan HT, Nguyen HD, Le TV, Nguyen 

DH (2009) First report of Fusarium wilt in watermelon in Vietnam. 

Australasian Plant Disease Notes 4, 1–3. 


INTRODUCTION 

Bunch rot diseases and their management 

T.B. Sutton{ XE "Sutton, T.B." }, J. Miranda Longland, K. Whitten Buxton, O. Anas 

Department of Plant Pathology, NC State University, Raleigh, NC 27695 USA 

Bunch rot diseases are of concern in all regions of the world 

where grapes are grown but nowhere are they more 

problematic than in moist and temperate growing regions. 

Among the most important bunch rot diseases in the 

southeastern United States are black rot, phomopsis, botrytis, 

bitter rot, ripe rot, and sour rot. This paper summarises a series 

of studies designed to gain a better understanding of the biology 

and epidemiology of the pathogens that cause bitter rot 

[Greeneria uvicola (Berk. & Curtis) Punith.] and ripe rot 

[homothallic and heterothallic strains of Colletotrichum 

gloeosporioides (Penz.) Penz. & Sacc. (teleomorph Glomerella 

cingulata (Stonem.) Spauld. & Schrenk) and C. acutatum J.H. 

Simmonds (teleomorph G. acutata Guerber & Correll)] and how 

to manage them. 

BIOLOGY AND EPIDEMIOLOGY OF G. UVICOLA AND 

COLLETOTRICHUM SPP. 

Fruit susceptibility to G. uvicola and Colletotrichum spp. 

through the growing season. From 2003–2007 a series of 

studies were conducted to determine the period during the 

growing season that fruit were susceptible to infection by G. 

uvicola and homothallic isolates of C. gloeosporioides. Fruit of 

Chardonnay, Merlot, and Cabernet Franc were susceptible to 

infection by G. uvicola from bloom until harvest but were most 

susceptible just prior to and during véraison. Although fruit were 

susceptible to C. gloeosporioides from bloom to harvest, the 

period of peak susceptibility was not as obvious. Chardonnay 

was most susceptible at bloom and véraison, Seyval blanc during 

bloom, post‐bloom, and véraison, and Cabernet Franc at postbloom, 

closing, véraison, and preharvest. 

Influence of temperature and leaf wetness on infection of fruit 

by G. uvicola. Detached fruit of V. vinifera (cv Chardonnay, 

Cabernet Franc, and Cabernet Sauvignon) were atomised with a 

conidial suspension of G. uvicola (10 5 spores/ml), placed in moist 

chambers and subjected to 14, 18, 22, 26, and 30°C for 6, 12, 18, 

or 24 h of wetting. Optimum conditions for infection were 6 or 

12 h of wetting and temperatures ranging from 22.4 to 24.6°C 

(mean=23.3°C) (1). 

Colletotrichum species in the diverse geographical regions of 

North Carolina and to examining differences based on host 

genera. The relative proportion of Colletotrichum spp. in a 

vineyard varied with the cultivar/species present and location 

(2). 

MANAGEMENT 

Effect of cane pruning. An experiment was conducted from 

2004–2006 on the cultivars Chardonnay, Merlot, and Cabernet 

Sauvignon in a 12‐year‐old vineyard in the Piedmont of North 

Carolina designed to evaluate the effect of cane pruning vs spur 

pruning on the incidence and severity of bitter rot and ripe rot. 

Cordons 1, 2, and 3‐years‐old were established during the course 

of the experiment and the incidence and severity of bitter rot, 

ripe rot and sour rot was compared to the 12‐year‐old spur 

pruned vines There was a significant reduction in the incidence 

and severity of bitter rot and ripe rot in the first year which 

carried over during the 3 years of the study. Cane pruning did 

not reduce the incidence of sour rot, but did reduce its severity. 

The disease management program for ripe rot and bitter rot in 

the southeastern US. The backbone of the disease management 

program in the southeastern US is cultural practices which are 

designed to reduce the initial inoculum and create an 

environment within the vine canopy less favorable for disease 

development. However, a fungicide program beginning at bloom 

and continuing until harvest is necessary to effectively manage 

summer bunch rot diseases. Captan, applied on a 10–14 day 

interval is the principle fungicide used from closing to harvest. 

REFERENCES 

1. Miranda, J.G. and Sutton, T.B. 2008. Factors affecting the infection 

of fruit of Vitis vinifera by the bitter rot pathogen, Greeneria 

uvicola. Phytopathology 98: 580–584. 

2. Whitten Buxton, K.R. and Sutton, T.B. 2008. Biology and 

epidemiology of Colletotrichum species associated with ripe rot of 

grapes. Phytopathology 98:S170. 

Session 2C—Epidemiology 

Relative susceptibility of cultivars to G. uvicola and 

Colletotrichum spp. Fruit of 38 grape cultivars or selections were 

evaluated for their susceptibility to G. uvicola while 35 cultivars 

or selections were tested for their susceptibility to a homothallic 

isolate of C. gloeosporioides in a laboratory assay 

There was a wide variation in the susceptibility of fruit to G. 

uvicola. Fruit of V. vinifera were more susceptible than the 

French American hybrids. V. aestavalis Cynthiana was the most 

resistant to G. uvicola (1). There was also a wide range in the 

susceptibility of cultivars and selections to C. gloeosporioides; 

however; there was not a clear difference between the relative 

susceptibility of V. vinifera and hybrids to C. gloeosporioides. 

Early harvest Cynthiana, Chardonnay, Merlot, Petit Syrah, and 

Pride were among the most susceptible cultivars to C. 

gloeosporioides. 

Population structure of Colletotrichum spp.associated with ripe 

rot of grapes. This study was conducted from 2004–2007 with 

the objectives of determining the population structure of 



Inoculum and climatic factors driving epidemics of Botrytis cinerea in New Zealand 

and Australian vineyards 

R.M. Beresford{ XE "Beresford, R.M." } A , G.N. Hill A , K.J. Evans B , J. Edwards C , D. Riches C , P.N. Wood D and D.C. Mundy E 

A The New Zealand Institute for Plant & Food Research Limited (Plant & Food Research), Private Bag 92 169, Auckland 1142, New Zealand 

B Tasmanian Institute of Agr. Research, University of Tasmania, New Town Res. Laboratories, 13 St Johns Avenue, New Town, Tasmania 

7008 

C Department of Primary Industries, 621 Burwood Highway, Knoxfield, Victoria 3180 

D Plant & Food Research, Hawke’s Bay Research Centre, Private Bag 1401, Havelock North, Hastings 4157, New Zealand 

E Plant & Food Research, Marlborough Wine Research Centre, P.O. Box 845, Blenheim 7240, New Zealand 

INTRODUCTION 

Botrytis bunch rot (botrytis) reduces grape yield and wine quality 

in seasons when wet weather occurs during grape ripening. 

Grape growers need to be able to predict when there is a high 

risk of botrytis so that fungicide applications, vine canopy 

management and harvesting operations can be more effectively 

planned. This study investigated climatic predictors of harvest 

botrytis severity that were measured in non‐fungicide treated 

plots between key vine growth stages: 1) early season (flowering 

to pre‐bunch closure (PBC)), 2) mid season (PBC to beginning of 

ripening (veraison)), 3) late season (veraison to harvest). 


Weather data came from weather stations within 1–5 km of 

each vineyard trial site (1). Relationships between harvest 

botrytis severity (2) and rainfall, daily mean, minimum and 

maximum temperature and surface wetness duration were 

investigated. Surface wetness duration and temperature during 

wetness were summarised using the “Bacchus” model (3) from 

Hortplus TM (www.hortplus.com). 


There were strong regional associations between harvest 

botrytis severity and some climatic variables during some growth 

stage intervals (Figures 1–3). The figures show the 3% severity 

threshold at which wineries may impose price penalties for 

botrytis‐affected grapes. Amount of rainfall, even late in the 

growing season, was, surprisingly, a poor predictor of harvest 

botrytis severity. Further research is using the relationships 

found in this study, together with fungicide and vine 

management factors, to develop a botrytis risk prediction model. 


This study was funded by New Zealand Winegrowers, the 

Australian Grape and Wine Research and Development 

Corporation, the N.Z. Foundation for Research, Science and 

Technology (C06X0810) and Plant and Food Research. 

REFERENCES 

1. Beresford RM, Hill GN 2008. Predicting in‐season risk of botrytis 

bunch rot in Australian and New Zealand vineyards. In: Breaking 

the mould—a pest and disease update. Proceedings of the ASVO 

seminar, Mildura, Victoria. Australian Society of Viticulture and 

Oenology Inc.: Adelaide, South Australia: 24–28. 

2 Beresford RM, Evans KJ, Wood PN, Mundy DC 2006. Disease 

assessment and epidemic monitoring methodology for bunch rot 

(Botrytis cinerea) in grapevines. New Zealand Plant Protection 59: 

355–360. 

3. Kim KS, Beresford RM, Henshall WR 2007. Prediction of disease risk 

using site‐specific estimates of weather variables. New Zealand 

Plant Protection 60: 128–132. 

Harvest botrytis severity (%) 

20 

15 

10 

5 

Auckland 

Hawke’s Bay 

Marlborough 

Tasmania 

Yarra Valley 

Bacchus index at 

3% severity= 0.57 

y = 38.287x - 19.009 

R 2 = 0.74 

0 

0.3 0.5 0.7 0.9 

Mean Bacchus index, early-season 

Figure 1. “Bacchus” index (surface wetness duration and temperature) 

was the most useful early‐season indicator of harvest botrytis severity. 


20 

15 

10 

5 

y = 7E+07e -0.7139x 

R 2 = 0.81 

Auckland 

Hawke’s Bay 

Marlborough 

Tasmania 

Yarra Valley 

Mean max.temp. at 

3% severity= 23.8 o C 

0 

20 22 24 26 

Mean max. temp., early-season 

Figure 2. Mean daily maximum air temperature in the early part of the 

season was strongly inversely related to harvest botrytis severity. 


20 

15 

10 

5 

Auckland 

Hawke’s Bay 

Marlborough 

Tasmania 

Yarra Valley 

Mean interval at 

3% severity= 40.8 days 

y = 0.005e 0.1567x 

R 2 = 0.87 

0 

0 20 40 60 80 

Mean late-season interval (days) 

Figure 3. A longer ripening period (late‐season interval) was associated 

with greater harvest botrytis severity. This regional trend is often 

reflected in individual vineyards, where a delay in harvest date to 

achieve higher grape sugar content is accompanied by increased risk of 

botrytis. 


Infection of apples by Colletotrichum acutatum in New Zealand is limited by 

temperature 

K.R. Everett{ XE "Everett, K.R." }, O.E. Timudo‐Torrevilla, I.P.S. Pushparajah, R.W.A. Scheper, P.W. Shaw, T.M. Spiers, A. Ah Chee, J.T. 

Taylor, P. Wood, D.R. Wallis, M.A. Manning 

The New Zealand Institute for Plant and Food Research Limited, P.B. 92169, Mt Albert, Auckland, New Zealand 

INTRODUCTION 

Colletotrichum acutatum infects the surface of apples in New 

Zealand to cause small, 1–2 mm diameter dark spots, usually on 

the side of the fruit exposed to the sun, which can enlarge to 

cover the entire fruit surface with one or several orange, 

sporulating lesions. Infection eventually results in fruit drop. 

Symptoms express in summer. Little is known of the 

epidemiology of C. acutatum infecting apples, either in New 

Zealand or elsewhere (1). A study was conducted to investigate 

the epidemiology of this fungus on apples in New Zealand, to 

facilitate the design of strategies to achieve control with no 

residues. 


Laboratory inoculations. ‘Royal Gala’ apples were harvested 

monthly starting immediately after fruit set in November 2005 

until harvest in 2006. At each time, apples were woundinoculated 

with 10 6 spores/ml C. acutatum and placed at 5, 10, 

15, 17.5, 20, 25 or 30°C in humid conditions for 7 days. Lesion 

diameter was then measured. 

Field inoculations. ‘Royal Gala’ apples in two orchards in each of 

three major apple growing regions in New Zealand, viz. Waikato, 

Hawke’s Bay and Nelson, were wound‐inoculated monthly with 

10 6 spores/ml C. acutatum beginning in November 2005 until 

harvest in February 2006. Lesion diameter was then measured. 

Lesion diameter (mm) 

30 

25 

20 

15 

10 

5 

0 

November 

December 

January 

February 

5 10 15 20 25 30 

Temperature o (C) 

Figure 1. Mean lesion diameter (mm) of detached apple fruit inoculated 

at harvest with 10 6 spores/ml Colletotrichum acutatum. A Boltzmann 

plot was fitted. 

RESULTS 

Detached ‘Royal Gala’ apples were susceptible to infection by C. 

acutatum when a temperature of c. 15°C was exceeded, 

regardless of maturity (Fig. 1). A wetness period of 72 hours was 

required for infections without wounding (results not shown). In 

the field ‘Royal Gala’ apples were infected by C. acutatum after a 

temperature of 15.2°C was exceeded (Fig. 2). 

mean number of infected fruit (max. = 5) 

5 

4 

3 

2 

1 

0 

Y = 3.1 + (0.02 - 3.1)/(1+exp ((x-15.2/0.01)) 

R 2 = 73% 

12 13 14 15 16 17 18 19 20 21 

mean daily temperature ( o C) 

Figure 2. The mean number of infected apple fruit out of five inoculated 

with 10 6 spores/ml of Colletotrichum acutatum plotted against the mean 

daily temperature for 72 hours after inoculation. A Boltzmann plot was 

fitted. The x0 value (inflection point) = 15.2°C. 

DISCUSSION 

In New Zealand mean daily temperatures of 15°C are exceeded 

during December, January and February. Effective control 

without residues may be able to be achieved by reducing 

inoculum early in the season before temperatures are above 

mean daily termperatures of c. 15°C, as was achieved for control 

of B. dothidea (2). A biological control agent or a benign 

chemical such as calcium chloride (3) could be used to protect 

the fruit from infection during summer when temperature is not 

limiting infections. 


This work was funded by MAF Sustainable Farming Fund, Pipfruit 

New Zealand, Waikato Fruitgrowers’ Association and Nelson 

Group 8. 

REFERENCES 

1. Peres NA, Timmer LW, Adaskaveg JE, Correll JC (2005) Lifestyles of 

Colletotrichum acutatum. Plant Disease 89, 784–96. 

2. Everett KR, Timudo‐Torrevilla OE, Taylor JT and Yu J (2007) 

Fungicide timing for control of summer rots of apples. New Zealand 

Plant Protection 60, 15–20. 

3. Boyd‐Wilson KSH and Walter M (2007) Effect of nutrients on the 

biocontrol activity of yeasts on apple pathogens. IN: Conference 

Handbook, 16th Biennial Conference of Australasian Plant 

Pathology Society. P. 43. 




Epidemiology of walnut blight, caused by Xanthomonas arboricola pv. juglandis, in 

Tasmania, Australia 

M.D. Lang A , K.J. Evans{ XE "Evans, K.J." } B and S.J. Pethybridge C 

A 

Tasmanian Institute of Agricultural Research (TIAR), University of Tasmania (UTAS), P.O. Box 3523, Burnie, 7320, TAS, Australia 

B 

TIAR, UTAS, 13 St Johns Ave, New Town, 7008, TAS, Australia 

C 

Botanical Resources Australia—Agricultural Services Pty Ltd., 44–46 Industrial Drive, Ulverstone, 7315, TAS, Australia 

INTRODUCTION 

Walnut blight is an important bacterial disease of walnuts worldwide, 

and can cause the premature drop of almost all fruit in 

some Australian orchards (1). In glasshouse trials, only five 

minutes of continuous wetness on the fruit surface is necessary 

for infection by Xanthomonas arboricola pv. juglandis (2), and 

extensive wetness periods may explain polycyclic disease 

epidemics in California (3). Objectives of this study were to 

characterise the temporal progression of disease incidence and 

severity in walnut fruit in Tasmania, Australia, and the 

relationship between disease severity and yield of marketable 

nuts. 

Table 1. Linear models of the temporal progression of walnut blight 

incidence in Vina and Franquette in Tasmania. 

Year Model R 2 A Intercept Slope Day 50% B 

Vina 

2004-05 Monomolecular 0.9677 -0.3203 0.0121 84 

2005-06 Logistic 0.9922 -10.0603 0.1926 52 

2006-07 Monomolecular 0.9886 -0.0655 0.0018 - 

Franquette 

2005-06 Gompertz 0.9926 -3.5383 0.0771 51 

2006-07 Monomolecular 0.9946 -0.1298 0.0042 - 

A Back transformed R 2 ; B Days (predicted) to 50% disease incidence. 


Randomised, complete block trials were conducted on single 

tree plots (n = 6) of Vina and Franquette over three and two 

growing seasons, respectively, in northern Tasmania. On nontreated 

trees, disease incidence and severity was assessed on 

the same 100 fruits from fruit set to harvest, or until a fruit fell. 

Severity was estimated visually as the perc ent area of the fruit 

covered with blight symptoms. Incidence was derived from the 

severity data as the percentage of fruit with symptoms. Daily 

cumulative disease incidence was analyzed as a function of time 

with linear, monomolecular, exponential, logistic and Gompertz 

models. Crop yield in non‐treated plots was defined as the 

percentage of the 100 fruit present at fruit set that produced 

marketable nuts at harvest. 


The time of disease onset was similar for each epidemic whereas 

the rate of disease increase was highest in 2005–06 with nearly 

100% incidence within 80 and 120 days of bud‐burst in Vina and 

Franquette respectively (Fig. 1). Temporal progression of disease 

incidence was described well by the monomolecular model in 

2004–05 and 2006–07, implying monocyclic disease epidemics 

(Table 1). In contrast, the logistic and Gompertz models 

described putative polycyclic disease in Vina and Franquette, 

respectively, in the relatively wet season of 2005–06. Disease 

severity of fruits at half full‐size diameter accounted for 74% of 

the variation in crop yield (Fig. 2). No marketable nuts were 

predicted when the mean blight severity on fruit was 10%. In 

contrast, 87% of fruits were predicted to produce marketable 

nuts when the mean blight severity was 2%. 

Incidence (%) 

Vina 

Franquette 

100 

80 

60 

40 

20 

0 

20 40 60 80 100 120 140 160 20 40 60 80 100 120 140 160 

Days from bud-burst 

2004-05 

2005-06 

2006-07 

Yield (%) 

100 

80 

60 

40 

20 

0 

y = -11.019x + 109.03 

R 2 = 0.74 

0.0 2.0 4.0 6.0 8.0 10.0 

Severity (%) 

Figure 2. Yield per plot of Vina nuts at harvest, expressed as a 

percentage of 100 fruit at fruit set, and disease severity observed on 

fruits at half full‐size diameter. 

DISCUSSION 

In Tasmania, epidemics of walnut blight appear to be either 

monocyclic or polycyclic, with polycyclic epidemics leading to all 

fruits developing disease symptoms. Preventing the onset and 

rate of increase of disease incidence and severity of fruits prior 

to fruits attaining half full‐size diameter appears critical to 

reducing crop loss. An empirical, weather‐based model for 

timing applications of copper is being developed. 


This project was supported by the Australian Government 

through Horticulture Australia Limited in partnership with 

Webster Walnuts, and was managed by Agronico P/L., 175 

Allport St. East, Leith, TAS, 7315 www.agronico.com.au 

REFERENCES 

1. Lang, M.D., Hills, J.L. and Evans, K.J. (2006). Preliminary studies 

towards managing walnut blight in Tasmania. Acta Hort. 705: 451– 

456. 

2. Miller, P.W. and Bollen, W.B. (1946). Walnut bacteriosis and its 

control: Technical Bulletin No. 9, United States Department of 

Agriculture, Oregon State College, Corvallis, USA. 

3. Adaskaveg, J.E., Forster, H., Dieguez‐Uribeondo, J., Thompson, D., 

Adams, C.J., Buchner, R. and Olsen, B. (2000). Epidemiology and 

management of walnut blight. See 

http://walnutresearch.ucdavis.edu/2000/2000_329.pdf 

Figure 1. Temporal progression of disease incidence observed on Vina 

and Franquette fruits in Tasmania. 


INTRODUCTION 

Sugarcane smut—disease development and mechanism of resistance 

S.A. Bhuiyan{ XE "Bhuiyan, S.A." } A , B.J. Croft B , R.C. James A , G. Bade A , and M.C. Cox A 

A BSES Limited, Private Bag 4, Bundaberg DC, QLD 4670, Queensland 

B BSES Limited, 90 Old Cove Road, Woodford, QLD 4514, Queensland 

Sugarcane smut caused by Ustilago scitaminea is an important 

disease worldwide. This disease can be effectively managed by 

replacing susceptible cultivars with resistant cultivars. The 

current smut rating system relies on artificial inoculation and a 

short plant and ratoon crop Ratings are based on % infected 

plants, not taking into account the severity of the disease. 

Infection of smut occurs through germinating or dormant buds 

of standing stalks or through germinating buds in the soil (1). 

Available literature suggests that there are two mechanisms of 

resistance to smut: i) bud scale or external resistance; and ii) 

internal resistance (2). Bud scale resistance is believed to be a 

combination of physical and chemical barriers to infection, and 

internal resistance is governed by interactions within plant 

tissue. It is also suggested that buds become increasingly 

resistant with age. 

The objectives of the study were to: i) monitor development of 

sugarcane smut; ii) compare disease incidence and severity; and 

iii) determine mechanisms of disease resistance of important 

sugarcane cultivars grown in Australia. 


Disease development. Twenty‐nine commercial cultivars were 

collected from various regions of Queensland. They were cut 

into one‐eye‐setts, inoculated by dipping in a spore suspension 

(10 6 spores/mL) and planted in September 2008 in 3 replications 

using a randomised complete block design. Disease incidence 

and severity were measured each month after planting. 

disease severity rating 

100 

80 

60 

40 

20 

y = 0.794x - 0.7452 

R 2 = 0.9199 

P

Session 2D—Disease management 

Dissemination of biological and chemical fungicides by bees onto Rubus and Ribes 

flowers 

M. Walter{ XE "Walter, M." } 1 , F.O. Obanor 2 , B. Donovan 3 , K.S.H. Boyd‐Wilson 1 , M. Neal 1 , H.J. Siefkes‐Boer 1 and G.I. Langford 1 

1 The New Zealand Institute for Plant and Food Research Limited, Private Bag 4704, Christchurch Mail Centre, Christchurch 8140, New 

Zealand 

2 CSIRO, Plant Industry, Queensland Bioscience Precinct, 306 Carmody Rd, St Lucia, QLD 4067, Australia 

3 DSIR, Private Bag 4704, Christchurch Mail Centre, Christchurch 8140, New Zealand 

INTRODUCTION 

Honey and bumble bees have shown to be capable of 

disseminating biological fungicides (BF) to achieve inoculation of 

berry flowers, such as strawberry, blueberry and blueberries. 

This in turn has caused a reduction in flower‐borne diseases. The 

aim of our work was to study the efficacy of a BF (year Y1) and a 

chemical fungicide (CF) (Y2) disseminated by honey bees and 

bumble bees (Y2 only) onto boysenberry (Rubus hybrid) and 

blackcurrant (Ribes nigrum) flowers. 


• BF: Sentinel® (Trichoderma atroviride) 

• CF: Switch® (fludioxonil+cyprodinil) finely ground and 

mixed with fluorescent dye (1:1, v/v) 

• Honey bees (Apis mellifera) and bumble bees (Bombus 

terrestris) at approx. 25000 and 250 bees/hive, respectively 

were used. 

• All experiments were conducted on commercial 

boysenberry and blackcurrant fields, with 2–4 replicate 

grower sites per crop and product. 

• The study was conducted separately for BF and CF over two 

flowering seasons. In Y1, honey bee and BF dissemination 

was examined. In Y2, honey and bumble bee CF 

disseminations were monitored, including CF residues in 

honey. 

In boysenberry, 2% and 1.3% of the flowers were visited by 

honey bees and bumble bees respectively, carrying 

Switch®+dye. The number of total honey bees (46) and bumble 

bees (0.7) observed was 0.5 honey and 0.08 bumble bees 

foraging on one boysenberry plant, with a daily average of 70–80 

open flowers/plant available. Bumble bee hive activity was, 

however, very low, with 0.05 bumble bees leaving the hive/15 

minutes. Approximately 5% of honey bees exposed to CF+dye 

vectored the fungicide to 2–4% of flowers. The product mixture 

probably was only available during approximately 15% of the 

actual foraging time for those bees. We can conclude that honey 

bees can vector biological and chemical fungicides to 

boysenberry flowers, however, in the level of disease control is 

not yet established. The role of bumble bees in boysenberry 

gardens is inconclusive, as the hive activities were very low. 

Switch® residues in honey from hives fitted with fungicide 

dispensers collected immediately after flowering were up to 5 

mg/kg active ingredient. No fungicide residues were measured in 

honey samples from adjacent hives, but without CF dispensers. 


The work was funded by The New Zealand Boysenberry Council 

Ltd, Blackcurrant New Zealand Ltd and the Sustainable Farming 

Fund (SFF) of the Ministry of Agriculture and Forestry (MAF) 

Grant 06/007. 


Y1: Application efficacy (% flowers inoculated) of bee‐applied 

Sentinel® was similar to spray‐applied BF. Irrespective of 

application method in boysenberry, 60–80% of flowers were 

inoculated; in blackcurrant, 40–50%. This resulted in >160 

Trichoderma colony forming units or cfu/boysenberry ovary and 

3–4 cfu/blackcurrant style. Bee application could be maximised 

by either equipping all hives with dispensing units and/or by 

increasing the release rate from three per week to daily releases. 

The BF, bee‐ or spray‐applied, did not improve disease control. 

Therefore in Y2, a CF was selected. 

Y2: CF or dye recovery on blackcurrant flowers was in the order 

of 5–14% for honey bees and 5–9% for bumble bees. The 

average number insects foraging per 10‐m row was 5 honey bees 

and 0.1 bumble bees. The average number of bees exiting the 

experimental hives during 1 and 5 min of observation was 300 

honey bees and 3.4 bumble bees, respectively. Bumble bees 

visited similar numbers of flowers as the honey bees, although 

there were 50 times more honey bees active in the crop than 

bumble bees. In addition, there were only 5 bumble bee hives in 

the blackcurrant field (>5 ha) compared with 14 honey bee hives 

for the same area (only two hives were equipped with the 

dispensers). 


Current studies on divergence and management of pepper yellow leaf curl disease in 

Indonesia 

INTRODUCTION 

Sri Hendrastuti Hidayat{ XE "Hidayat, S.H." } 1 , Sri Sulandari 2 , and Sriani Sujiprihati 1 

1 Bogor Agricultural University, Campus Darmaga, Bogor 16680, Indonesia 

2 Gadjah Mada University, Yogyakarta 55281, Indonesia 

Whitefly‐transmitted geminiviruses (WTGs) has been reported to 

infect several crops in Indonesia including tobacco, tomato, chilli 

pepper, ageratum, and cucumber. Infection of WTGs in chilli 

pepper causes severe crop damage and becoming a major threat 

since early 2000. The most unique symptoms associated with the 

virus infection involved yellowing and leaf curling, therefore it 

was known as pepper yellow leaf curl (PYLC) disease. Biological 

and molecular characterisation of the causal agent reveals that 

several WTGs are associated with the disease. Disease spread 

was very fast due to activity of its insect vector, Bemisia tabaci, 

which grows very prominently in the tropic climate. Therefore, 

disease control is becoming very difficult. Breeding program for 

WTGs resistance varieties is one of major activities in regard to 

disease control strategy in Indonesia since commercial cultivars 

carrying resistance to the diseases have not yet been released. 

Evaluation of chilli pepper genotypes showed that some 

germplasms are very promising for development of cultivars 

with resistance or tolerance to the disease. 


Analysis of Genetic Diversity. Pepper plant showing typical 

symptoms of PYLCV infection were collected from several chilli 

pepper production areas in Indonesia. Extraction of total DNA 

and PCR amplification was done according to procedure 

explained previously (1, 2). Sequence data obtained following 

nucleotide sequencing of the PCR product was analysed using 

ClustalW program version 1.83 EMBL‐EBI. 

Evaluation of 11 commercial cultivars and 27 genotypes of chilli 

pepper showed that the symptoms were developed within 2 to 3 

weeks after inoculation, although some genotypes required 

longer incubation period. Disease incidence was varied among 

different genotypes, i.e. in the range of 12 up to 100%. Selection 

of potential genotypes was proceeded for further breeding 

activity in order to develop resistant varieties for PYLCV. 


This research was supported in part by ACIAR—AVRDC Chilli 

Integrated Disease Management Project. 

REFERENCES 

1. Doyle JJ, Doyle JJ (1999) Isolation of plant DNA from fresh tissue. 

Focus 12, 13–15. 

2. Rojas MR, Gilbertson RL. Russel DR, Maxwell DP (1993) Use of 

degenerate primers in the polymerase chain reaction to detect 

whitefly‐transmitted geminiviruses. Plant Disease 77, 340–347. 

3. Aidawati N, Hidayat SH, Suseno R, Sosromarsono s (2002) 

Transmission of an Indonesian isolate of tobacco leaf curl virus by 

Bemisia tabaci Genn. (Hemiptera:Aleyrodidae). Plant Pathol J 18, 

231–236. 

4. Ikegami M, Morinaga T, Miura K (1988) Potential gene product of 

bean golden mosaic virus have higher sequence homologies to 

those of tomato golden mosaic virus than those of cassava laten 

virus. Virus Genes 1,191–203. 


Evaluation of Chilli Pepper Genotypes. Inoculation of PYLCV by 

B. tabaci was conducted as explained previously (3). Response of 

different chilli pepper genotypes was classified into three groups 

i.e. resistant, moderately resistant, and susceptible based on 

symptoms expression and disease incidence. 


Identity of geminivirus infecting chilli pepper in Indonesia was 

determined based on their hairpin loop structure and repetitive 

sequence found in the common region. These hairpin loop 

structure was found in all geminivirus sequences so far (4). 

Variability in the structure as well as the length of hairpin loop 

region was observed among PYLCV isolates. This may indicate 

the possible genetic diversity among WTGs infecting chilli pepper 

in Indonesia. Phylogenetic analyses involving 32 sequences 

showed that PYLCV isolates can be differentiated into several 

clusters. Interestingly, they are all quite different from WTGs 

infecting tomato in Indonesia but more closely related to tomato 

yellow leaf curl virus from Thailand. 



INTRODUCTION 

Fungicide resistance in cucurbit powdery mildew 

G. MacManus, C. Akem{ XE "Akem, C." }, K. Stockdale, D. Lakhesar, E. Jovicich and P. Boccalatte 

Horticulture and Forestry Science, Queensland Primary Industries and Fisheries, P.O. Box 15, Ayr, Qld 4807 

Powdery mildew, caused by Podosphaera xanthii, (Castagne) is a 

major constraint to commercial cucurbit production in Australia 

and worldwide. Management of this disease has relied primarily 

on the use of foliar fungicides sprays. The development of strains 

of the pathogen with resistance to systemic fungicides is 

becoming increasingly widespread with the excessive use of 

these fungicides. Resistance problems were first reported in 

Queensland in the late 1980s (1) and since then there has been 

no resistance monitoring program. 

The aim of this study was to determine if resistance had 

developed to the four systemic fungicides (Amistar, Bayfidan, 

Nimrod and Spinflo) registered in Australia for the control of 

powdery mildew in cucurbit crops in the Burdekin region of 

north Queensland. 

in the main production regions. Promoting integrated crop 

management strategies is vital. These include spraying only 

when needed, using resistant varieties and using fungicide 

alternatives as substitutes for protectant fungicides, as well as 

destroying old crop residues in finished strips. 

% Leaf Area Infected 

80 

60 

40 

20 

0 

Amistar 

Bayfidan 

Clare (Watermelon) 

Control 

Nimrod 

Treatment 

Spinflo 

Rating 1 

Rating 2 


In 2008, 21‐day old seedlings of a powdery mildew susceptible 

zucchini variety (Congo, SPS) were used in bioassays to test for 

resistance against current registered fungicides. Plants with good 

vigour were sprayed with the four systemic fungicides at half, 

full and double the recommended label rates of application and 

water as controls, 24 h prior to overnight field exposure in 

various cucurbit crops at seven different locations in the 

Burdekin production region. Actively growing apical shoots were 

removed from each plant leaving two cotyledons and three to 

four true leaves. 


80 

60 

40 

20 

0 

Amistar 

Guthalungra (Rockmelon) 

Bayfidan 

Control 

Nimrod 

Treatment 

Spinflo 

Rating 1 

Rating 2 

The exposed treated seedlings were randomly placed on 

benches in a glasshouse where night temperatures averaged 

about 20°C and day temperatures 30°C. Three lower true leaves 

of each seedling, which served as replications for each plant 

were rated for disease severity 11 and 15 days after field 

exposure. Disease severity (% leaf area infected) was estimated 

to the nearest 5%. The data collected was analysed using 

Genstat 11 to determine treatment differences. 

RESULTS 

Powdery mildew infection was first noticed on the watersprayed 

control seedlings 7 days after field exposure. Disease 

severity at the second rating was always higher than the first (Fig 

1; A‐C; based on the recommended label rate for each of the 

fungicides). There was low disease severity (≤15% on the 

controls) at four of the locations with no significant treatment 

differences for the first and second ratings. At the other three 

locations; Clare, Rocky Ponds and Guthalungra, disease severity 

on the controls was quite high (~60%). All the fungicide 

treatments were effective against the disease, except at Rocky 

Ponds and Guthalungra where they were not significantly 

different from the controls. 

DISCUSSION 

The results from Rocky Ponds and Guthalungra clearly show that 

there is a fungicide resistance problem in some areas in the 

Burdekin region. This is a major cause for concern. Similar results 

were recorded on seedlings exposed to isolates from the 

Bundaberg region of Central Queensland. 


60 

40 

20 

0 

Amistar 

Bayfidan 

Rocky Ponds (Honeydew) 

Control 

Nimrod 

Treatment 

Spinflo 

Rating 1 

Rating 2 

Figures 1. A‐C: Effect of systemic fungicides on powdery mildew disease 

severity in cucurbit crops in the Burdekin region of north Queensland. 

ACKNOWLEGEMENTS 

Funding for this work was provided by Horticulture Australia 

Limited (HAL) for which we are grateful. 

REFERENCE 

1. O’Brien, R.G., Vawdrey, L.L. and Glass, R.J. (1988). Fungicide 

resistance in cucurbit powdery mildew (Sphaerotheca fuliginea) 

and its effect on field control. Australian Journal of Experimental 

Agriculture 28, 417–423. 

These results reinforce the need for monitoring of isolate 

sensitivities to the main systemic fungicides on a seasonal basis 


Population genetic analyses of plant pathogens: new challenges and opportunities 

C.C. Linde{ XE "Linde, C.C." } 

Botany and Zoology, Research School of Biology, College of Medicine, Biology and Environment, Bldg. 116, Daley Rd, Australian National 

University, Canberra, ACT 0200, Australia 

INTRODUCTION 

The study of population genetics attempts to investigate 

evolutionary forces such as mutation, migration, genetic drift, 

selection and recombination, and how gene frequencies change 

in populations to shape their genetic structure. These 

evolutionary forces and the interaction amongst them are 

particularly important in plant pathogens where, combined with 

the pathogen’s life history characteristics, they determine the 

evolutionary potential. The population genetics of plant 

pathogens has been investigated for at least 30 years. Early 

studies on population genetics of plant pathogens concentrated 

on the effect sexual reproduction has on levels of genetic 

diversity in populations (Burdon and Roelfs, 1985a, b) and what 

impact that had on disease control. Similar studies have 

continued with investigations of pathogen capacities to rapidly 

adapt to new environments such as developing resistance 

against a fungicide or overcoming a resistance gene in the plant 

host (McDonald and Linde, 2002). 

Although the questions we ask in the population genetics of 

plant pathogens has not changed significantly, advances in DNA 

sequencing and analytical approaches have significantly 

improved the accuracy of parameter estimates. In particular, 

coalescent based approaches are a powerful extension of 

classical population genetics because it is a collection of 

mathematical models that can accommodate biological 

phenomena as reflected in molecular data. The emphasis in 

coalescent thinking is to view populations backwards in time, 

using the divergence observable in a population to estimate the 

time to a most recent common ancestor. This ancestor is the 

point where gene genealogies `coalesce’, in a single biological 

organism. 

The barley scald pathogen, Rhynchosporium secalis, will be used 

as an example to illustrate the importance of some of these 

evolutionary forces and how coalescent based methods 

significantly improved our understanding of the pathogens’ 

biology. 


Populations of R. secalis were characterised with 14 

microsatellite loci (Linde et al., 2009) and several sequence loci 

(Zaffarano et al., 2009). Several population genetic parameters 

were investigated, including migration among populations. This 

was investigated with a coalescent method in the program IM 

(Hey and Nielsen, 2004) and results were compared to estimates 

derived from traditional F ST estimates (Weir and Cockerham, 

1984). 

pathogen populations are constantly influenced by the host 

populations or human‐mediated migration. 

With coalescent methods, the direction of migration is obtained. 

This means the major source and sink populations for migration 

can be determined which is useful in determining breaches of 

quarantine or major migration routes due to eg prevailing wind 

currents. In R. secalis, unusually high migration rates in both 

directions between Australia and South Africa and Australia and 

New Zealand cause particular concern for disease management. 

A comparison of the results revealed that migration estimates 

based on coalescent analyses were frequently non‐symmetric, 

meaning one population contributed significantly more migrants 

than the other. This contributed to migration estimates derived 

from F st being over‐ or under‐estimated. Furthermore, F st derived 

migration estimates were usually underestimated when the 

migration was high, and/or when population sample sizes were 

low. 

Coalescent analyses provided population genetic parameter 

estimates that are more reliable, are less dependent on 

population sizes being stable and are affected less by 

populations with small sample sizes. Improved analyses and 

their usefulness in plant pathology are discussed. 

REFERENCES 

1. Burdon, J.J., Roelfs, A.P., 1985a. Isozyme and virulence variation in 

asexually reproducing populations of Puccinia graminis and 

Puccinia recondita on wheat. Phytopathology 75, 907–913. 

2. Burdon, J.J., Roelfs, A.P., 1985b. The effect of sexual and asexual 

reproduction on the isozyme structure of populations of Puccinia 

graminis. Phytopathology 75, 1068–1073. 

3. McDonald, B.A., Linde, C., 2002. Pathogen population genetics, 

evolutionary potential, and durable resistance. Annu. Rev. 

Phytopathol. 40, 349–379. 

4. Linde, C.C., Zala, M., McDonald, B.A., 2009. Molecular evidence for 

recent founder populations and human‐mediated migration in the 

barley scald pathogen Rhynchosporium secalis. Molecular 

Phylogenetics and Evolution 51, 454–464. 

5. Zaffarano, P.L., McDonald, B.A., Linde, C.C., 2009. 

Phylogeographical analyses reveal global migration patterns of the 

barley scald pathogen Rhynchosporium secalis. Molecular Ecology, 

279–293. 

6. Hey, J., Nielsen, R., 2004. Multilocus methods for estimation 

population sizes, migration rates and divergence times, with 

application to the divergence of Drosophila pseudoobscura and D. 

persimilis. Genetics 167, 747–760. 

7. Weir, B.S., Cockerham, C.C., 1984. Estimating F‐statistics for the 

analysis of population structure. Evolution 38, 1358–1370. 

Keynote speaker 


The results of this comparison revealed that coalescent based 

approaches offer several advantages over other analytical 

methods to estimate parameters such as migration and genetic 

drift. Traditional measures of the translation of F ST into gene 

flow assume that subpopulations have the same size, population 

sizes are constant, or that there are infinitely many populations, 

and that migration rates are all symmetric. Due to these 

underlying assumptions, migration estimates derived from F ST 

are almost always flawed and incorrect estimates are achieved 

when these assumptions are not met. This is often the case since 


Session 3A—Population genetics 

Genetic diversity of Botryosphaeria parva (Neofusicoccum parvum) in New Zealand 

vineyards 

INTRODUCTION 

J. Baskarathevan{ XE "Baskarathevan, J." }, M.V. Jaspers, E.E. Jones and H.J. Ridgway 

Faculty of Agriculture and Life Sciences, Lincoln University, PO Box 84, Lincoln 7647, New Zealand 

Species of the Botryosphaeriaceae cause disease on numerous 

woody and non‐woody hosts. Worldwide several species of 

Botryosphaeria have been reported to cause various symptoms 

on grapevine including decline and die‐back. In a survey carried 

out in 2007/08, six Botryosphaeria species were isolated from 

symptomatic New Zealand grapevines. Among these 

Botryosphaeria species, Neofusicoccum parvum was identified as 

the most prevalent species (1). The aim of this study was to 

analyse the genetic diversity of the N. parvum isolates collected 

from the New Zealand vineyards and to compare these with 

international isolates. 


Fungal isolates and DNA extraction. New Zealand isolates of N. 

parvum (49), collected from six grape growing regions as well as 

three Californian and four Australian isolates were used in this 

study. The identity of the New Zealand isolates was confirmed by 

using a published PCR‐RFLP (ARDRA) method (2). Genomic DNA 

was extracted from mycelium using the PUREGENE ® genomic 

DNA isolation kit and concentration was adjusted to 20 ng /µl for 

UP‐PCR. 

UP‐PCR procedure. For genetic variation analysis of N. parvum 

isolates, 11 UP‐PCR primers (3) were tested, of which five 

(AA2M2, Fok1, L15, 0.3‐1 and 3‐2) were chosen for further use, 

based on total number of bands, number of polymorphic bands 

and the band distribution. UP‐PCR amplification products were 

separated by electrophoresis on a 1% agarose gel for 3 h at 100 

V. 

Genetic variation analysis. Bands were counted if they were 

strong and reproducible. A binomial matrix was produced as 

follows: if a band was present it was indicated by a “1” and if 

absent by a “0”. The binomial matrix thus generated was used 

for phylogenetic analysis using PAUP version 4.0b10. A 

neighbour joining cladogram was generated to show the 

relationships between the genotypes produced for all 56 

isolates. 

Pathogenicity test. From each general branch of the N. parvum 

neighbour joining tree, two isolates were selected (15 isolates in 

total) for in‐vitro green shoot assays. Shoots of similar age and 

diameter, 25–30 cm long, were cut from glasshouse grown 

Sauvignon Blanc plants. They were prick‐wounded and 

inoculated with mycelium colonised agar plugs from 3 day old 

cultures, wrapped onto the wounds with parafilm. Inoculated 

shoots were arranged randomly in a growth chamber with five 

replicates for each isolate. Pathogenicity of isolates was assessed 

as the external lesion lengths, measured at 7 d post inoculation. 

The data were analysed using ANOVA (GenStat 11) Means were 

separated by Fisher’s protected least significance difference 

(LSD) test. 

RESULTS 

The 61 informative bands produced with the five UP‐PCR 

primers were used to compile a neighbour joining tree. This tree 

revealed a high degree genetic variability in the N. parvum 

populations studied. Genetic variability was higher for intervineyard 

rather than intra‐vineyard populations. Only one of the 

four Australian isolates grouped together with New Zealand 

isolates. All of the Californian isolates were grouped into a 

branch with three New Zealand isolates collected from a single 

region. The N. parvum isolates selected from different branches 

of the neighbour joining tree differed significantly (P

Anthracnose disease of chili pepper—genetic diversity, pathogenicity and breeding 

for resistance 

P.W.J. Taylor{ XE "Taylor, P.W.J." } 1 , O. Mongkolporn 2,3 , P. Montri 3,4 , P. Mahasuk 3 , N. Khumpeng 2,5 , T. Supakaew 3 , A. Auyong 1 , N. 

Ranathunge 1 , R. Ford 1 

1 Centre for Plant Health/BioMarka, School of Land and Environment, The University of Melbourne, Victoria, Australia 3010 

2 Department of Horticulture, Kasetsart University, Kamphaeng Saen Campus, Nakhon Pathom 73140, Thailand 

3 Center for Agricultural Biotechnology, Kasetsart University, Kamphaeng Saen Campus, Nakhon Pathom 73140, Thailand 

4 Current address: Royal Project Foundation, Chiang Mai, Thailand 

5 Current address: Syngenta Crop Protection Limited, Khon Kaen, Thailand 

INTRODUCTION 

Anthracnose disease of chili pepper (Capsicum annuum) is 

caused by a complex of Colletotrichum species with C. capsici, C. 

acutatum, C. gloeosporioides, being the most severe pathogens 

in SE Asia and Australia (1). Elucidation of the disease cycle for C. 

capsici indicated that quiescent leaf infection was an important 

source of inoculum thus necessitating more efficient use of 

fungicides to prevent fruit infection. 


Genetic Diversity: The genetic structure of populations of C. 

capsici collected from Australia, India, Sri Lanka and Thailand 

were analysed using loci‐specific microsatellite markers (2) The 

number of effective alleles and the genetic diversity was 

determined using genalex 6 software. 

Pathogenicity: Differential reactions based on qualitative host 

reactions (infection vs no infection) on mature green and ripe 

chili fruit of 10 genotypes from four cultivated Capsicum 

species—C. annuum, C. baccatum, C. chinense and C. frutescens 

were investigated after being inoculated with 33 isolates of C. 

capsici, C. gloeosporioides and C. acutatum from Thailand. 

Bioassay and host reaction was recorded as described in Montri 

et al. (2009). 

Breeding for Resistance: Resistance to anthracnose caused by 

Colletotrichum capsici and C. acutatum was investigated in C. 

chinense PBC932 and Capsicum baccatum PBC80 and PBC1422. 

Mature green and ripe fruit were inoculated with 13 isolates of 

the two Colletotrichum species. Bioassay and host reaction was 

recorded as described in Montri et al. (2009). 


Genetic Diversity: Screening of 117 isolates against 27 STMS 

markers revealed 92 haplotypes and a total of 148 alleles 

present across all the populations. A highly significant population 

differentiation (0.154) was found among the populations. The 

Australian population was relatively homogeneous with low level 

of gene diversity and high population differentiation suggesting 

their recent origin (probably caused by genetic bottlenecks) in 

comparison with highly diverse Indian, Sri Lankan and Thai 

isolates. The overall high gene flow and diversity indicated that 

C. capsici had a high adaptive potential to overcome control 

measures such as host resistance and fungicides. 

capsici and an Agrobacterium‐mediated fungal transformation 

system developed for assessing function of these genes. 

Breeding for Resistance: The resistant C. chinense genotype 

PBC932 showed a strong hypersensitive response to infection by 

C. capsici pathotypes. Resistance was found to be controlled by 

three recessive genes at specific growth stages. This resistance is 

being incorporated into commercial varieties through marker 

assisted selection. ie co1 at mature green fruit, co2 at ripe red 

fruit, and co3 at seedling stages of plant growth. Linkage analysis 

suggested that co1 and co2 were linked (recombination 

frequency 0.25), and that the co3 was not linked to the fruit 

resistances. Resistance at mature green fruit stage in C. 

baccatum to C. acutatum was found to be controlled by a single 

recessive gene co4 and at ripe fruit stage by a single dominant 

gene Co5. Linkage analysis between the two genes showed the 

genes to be independent. Markers to these genes will be 

developed for use in Marker Assisted Selection to enable the 

development of highly resistant chili varieties. 

REFERENCES 

1. Montri P, Taylor PWJ, Mongkolporn O (2009) Pathotypes of 

Colletotrichum capsici, the Causal Agent of Chili Anthracnose, in 

Thailand. Plant Disease 93: 17–20. 

2. Ranathunge NP, Ford R, Taylor PWJ (2009). Development and 

optimization of sequence‐tagged microsatellite site markers to 

detect genetic diversity within Colletotrichum capsici, a causal 

agent of chilli pepper anthracnose disease. Molecular Ecology 

Resources DOI: 10.1111/j.1755‐0998.2009.02608.x 

3. Mahasuk P, Khumpeng N, Wasee S, Taylor PWJ, Mongkolporn, O 

(2009). Inheritance of resistance to anthracnose (Colletotrichum 

capsici) at seedling, and fruiting stages in chili pepper (Capsicum 

spp.). Plant Breeding. (In press). 

4. Mahasuk P, Taylor PWJ and Mongkolporn O (2009). Identification 

of two new genes conferring resistance to Colletotrichum acutatum 

in Capsicum baccatum L. Phytopathology. (In press). 


Pathogenicity: Differential reactions on mature green and ripe 

chili fruit of 10 genotypes of cultivated Capsicum spp identified 

5, 11 and 3 pathotypes of C. capsici, C. gloeosporioides and C. 

acutatum respectively. This will have profound effect on chili 

breeding programs where novel sources of resistance genes 

from related species are being incorporated into commercial C. 

annuum varieties. Putative PR genes have been identified 

through transcriptional analysis from a virulent pathotype of C. 



INTRODUCTION 

The diversity of Colletotrichum infecting lychee in Australia 

J.M. Anderson{ XE "Anderson, J.M." } A,B , L.M. Coates A , E.K. Dann A and E.A.B. Aitken B 

A Queensland Primary Industries and Fisheries, 80 Meiers Rd, Indooroopilly, 4068, Qld 

B University of Queensland, John Hines Building, St Lucia, 4072, Qld 

Pepper spot caused by Colletotrichum gloeosporioides is a 

relatively new disease of lychee (Litchi chinensis Sonn.) in 

Australia. While the disease only causes superficial damage to 

the skin of the fruit it does result in lower financial returns to 

lychee growers (1). Unlike anthracnose of lychee, symptoms of 

pepper spot develop prior to harvest with out an apparent 

quiescent period for C. gloeosporioides. Host stress and 

environment have been suggested to contribute to pepper spot 

development; however it is not clear if the genotype of C. 

gloeosporioides affects pepper spot development. In this study 

we compared isolates of Colletotrichum spp. from anthracnose 

and pepper spot lesions on lychee to determine if a new 

genotype of Colletotrichum sp. is responsible for pepper spot of 

lychee. 


Collection and characterisation of isolates. One‐hundred and 

fifty isolates of C. gloeosporioides were collected from pepper 

spot and anthracnose lesions of lychee from three orchards in 

eastern Australia. Isolates derived from single germinated 

conidia were characterised on the basis of morphology (conidia 

shape and size, production of teleomorph) and molecular 

fingerprint using arbitrary‐primed PCR (ap‐PCR) using two 

primers. 

Field pathogenicity testing. Thirteen isolates representing the 

main genotypes identified using ap‐PCR were selected for field 

pathogenicity testing. An isolate of C. gloeosporioides 

(BRIP28734) from mango was included in the pathogenicity 

testing. Lychee fruit were inoculated two weeks prior to harvest 

and were assessed for the development of pepper spot at 

harvest and for the development of anthracnose after 10 days of 

storage at 20°C. 

Field pathogenicity testing. Only isolates ALPS11, ALAN11 and 

RLPS24 caused significant levels of pepper spot (Figure 1), all of 

these isolates were from the closely related group identified 

using ap‐PCR which contained the majority of isolates. The other 

isolates from this group ALPS15, ALAN12 and RLAN11 did not 

cause pepper spot but did cause high levels of anthracnose after 

storage. None of the isolates in the large closely related group 

produced the teleomorph in culture, unlike the isolates of C. 

gloeosporioides from other genotypes of which 60% produced 

the teleomorph. 

Fruit inoculated with the mango isolate (BRIP 28734) had levels 

of anthracnose similar to the uninoculated control. Of the lychee 

isolates, GLPS12 caused only low levels of anthracnose which 

were not significantly different to those of the mango isolate. 

GLPS12 was from the genotype where the majority of the 

isolates produced the teleomorph. It is possible that this group 

of isolates is not specific to lychee. 

On the basis of ap‐PCR and morphological studies there were no 

apparent differences found between pepper spot and 

anthracnose isolates. However, when assessed together, the 

pathogenicity testing and molecular work suggest that there may 

be a group of isolates more likely to cause pepper spot. To 

confirm the host specificity of the isolates cross pathogenicity 

testing is being conducted with a range of hosts. 


Collection and characterisation of isolates. Of the 150 isolates in 

the collection, nine were C. acutatum, isolated from anthracnose 

lesions. The rest of the isolates were C. gloeosporioides. Analysis 

of conidial measurements did not indicate a distinct subpopulation 

within C. gloeosporioides responsible for the 

development of pepper spot. The production of the 

teleomorphic stage was not limited to isolates from one 

symptom type or location. 

The ap‐PCR analysis did not differentiate the pepper spot 

isolates from the anthracnose isolates. The majority of the 

isolates (73%) grouped together with 75% similarity to each 

other. Within this group were isolates from both pepper spot 

and anthracnose as well as isolates from all three locations. 

Most other genotypes identified had only one or very few 

isolates, except for a genotype which contained 15 isolates from 

the same location. Of the latter, 14 isolates produced the 

teleomorph under laboratory conditions. Both pepper spot and 

anthracnose isolates were in this group. 

Figure 1. Preharvest pepper spot (solid columns) and postharvest 

anthracnose (white columns) development on lychee fruit inoculated 2 

weeks prior to harvest. Error bars indicate standard error. 


JA is recipient of a DAFF Science and Innovation Award 

REFERENCES 

1. Cooke AW and Coates LM (2002) Pepper spot: a preharvest disease 

of lychee caused by Colletotrichum gloeosporioides. Australasian 

Plant Pathology 31:303–304. 


INTRODUCTION 

Variation in Phytophthora palmivora on cocoa in Papua New Guinea 

J.Y. Saul Maora{ XE "Maora, J.Y.S." } 1 , D.I. Guest 2 and E.C.Y. Liew 3 

1 PNG Cocoa Coconut Institute, PO Box 1846 Rabaul, ENBP, Papua New Guinea 

2 Faculty of Agriculture, Food and Natural Resources, The University if Sydney, NSW 2006, Australia 

3 Royal Botanical Gardens Sydney, Botanic Gardens Trust, Mrs Macquaries Rd, Sydney, NSW 2000, Australia 

Phytophthora palmivora is the major cause of cocoa disease in 

PNG, although P. arecae, P. megakarya, P. nicotianae, and P. 

citrophthora have also been suggested as pathogens. The 

success of disease control strategies depends on a thorough 

knowledge of the pathogen and its population biology. 

Furthermore, all cocoa planting material is bred in ENB and 

distributed throughout the country, without any comprehensive 


This study tested the hypotheses that: 1. P. palmivora is the sole 

Phytophthora sp. causing disease on cocoa in PNG; and 2. there 

is variation between P. palmivora populations from different 

cocoa growing locations in PNG. 


ESP 

Karkar 

Madang 

Sampling locations in PNG 

ENB 

Bougainville 

Figure 1. Sampling locations in PNG 

Diseased pods were sampled hierarchical from 5 locations (Fig 

1); 8 farms/location, 8 diseased pods/farm. Isolates were grown 

on carrot agar in the dark at 25°C for 4 days and growth rates 

taken simultaneously with colony morphology. For sporangial 

morphology, isolates were grown as described for 10–14 days 

and sporangial length, breadth and pedicel length of fifty 

sporangia per isolate measured and length/breadth ratio 

calculated. Sporangiophore branching and caducity were also 

recorded. Mating type was determined using Duncan’s media 

(3). Genetic variation was studied using Randomly Amplified 

Microsatellite (RAMS) analysis. Genomic DNA was extracted and 

amplified by PCR and PCR products separated by agarose gel 

electrophoresis. Loci with clear bands only were scored. 

RESULTS 

Colony morphology of the isolates were stellate striate. 

Sporangiophore branching was simple sympodium and sporangia 

were caduceus. Mean Sporangia length, breadth, pedicel length 

and length:breadth ration were 50.1µm, 27.2µm, 4.7µm and 1.8 

respectively. Growth rates were not correlated with locations. 

Sporangia length, breadth and length:breadth ratio were 

different depending on locations. Both mating types A1 and A2 

are present in PNG. Genetic analysis revealed seven clonal 

groups (Figure 2). 

Figure 2. UPGMA dendogram based on RAMS analysis, representatives 

of 263 isolates of P. palmivora from PNG including references, P. capsici 

(Caps). 

DISCUSSION 

Isolates displayed striate/stellate colony morphology which is 

typical of P. palmivora (2). Sporangiophore branching, caducity 

and sporangial dimensions agree with descriptions of P. 

palmivora (4). Sporangia pedicel length was intermediate 

(~5µm), typical of P. palmivora (1). RAMS analysis clearly 

separated P. capsici from the PNG isolates and revealed that the 

population in PNG was generally clonal with emerging subpopulations 

in Bougainville and Madang. Both mating types A1 

and A2 are present in Madang posing a high risk of variation. P. 

palmivora is the sole Phytophthora sp causing disease on cocoa 

in PNG. The presence of a single species means concentrating 

cocoa breeding in one location is acceptable; however mixed 

cocoa cultivars should be deployed and integrated disease 

management promoted. Strict quarantine should be imposed, 

especially in Madang where both mating types are present. 


The scholarship provided by AusAid to undertake this study is 

highly appreciated. The assistance of CCIPNG staff for isolate 

collection and assistance provided by Dr Rose Daniel at The 

Sydney University is acknowledged. 

REFERENCES 

1. Al‐Hedaithy SSA, Tsao PH (1979b) Sporangium pedicel length in 

Phytophthora species and consideration of it’s uniformity in 

determining sporangium caducity. Mycological Research 72, 1–13. 

2. Brasier CM, Griffin MJ (1979) Taxonomy of Phytophthora palmivora 

on cocoa. Transactions British Mycological Society 72, 111–143. 

3. Duncan JM (1988) A colour reaction associated with formation of 

oospores by Phytophthora spp. Transactions British Mycological 

Society 90, 366–337. 

4. Erwin DC and Riberiro OK (1996) Phytophthora diseases worldwide 

APS Press: Minnesota, USA. 


Session 3B—Modelling and crop loss assessment 

Spore traps for early warning of smut infestations in Australian sugarcane crops 

INTRODUCTION 

R.C. Magarey{ XE "Magarey, R.C." } A , G. Bade B , K.S. Braithwaite C , AK.J. Lonie A and B.J. Croft D 

A BSES Limited, PO Box 566, Tully, 4854, Queensland 

B BSES Limited, PO Box 651, Bundaberg, 4670, Queensland 

C BSES Limited, PO Box 86, Indooroopilly, 4068, Queensland 

D BSES Limited, 207 Old Cove Road, Woodford, 4514, Queensland 

Sugarcane is Australia’s second most important agricultural 

export crop on a monetary basis, being grown on over 

400,000ha of land to produce >30m tonnes of harvest product 

and >3m tonnes of crystal sugar. There have been many climatic, 

market and disease threats to the industry and recently 

sugarcane smut (Ustilago scitaminea) has posed a major threat. 

In 2006 the disease was found for the first time in the major 

eastern seaboard sugarcane production area. Previous research 

showed that the majority of the Australian commercial cultivars 

were highly susceptible to the disease; rapid spread and 

escalation of the disease therefore threatened crop yields and 

profitability of the Australian sugarcane industry. As the disease 

is difficult to find in mature crops, and as early warning of the 

disease would provide the greatest opportunity for farmers to 

transition to more resistant cultivars, it was decided to use 

atmospheric spore trapping as an early warning tool. This paper 

describes how spore trapping has provided early warning of the 

presence of smut to the Australian sugarcane industry. 


Smut outbreak. Smut was found for the first time in the Childers 

region in June 2006, then shortly afterwards in the Mackay 

production area in November 2006 and in the Herbert River 

district in December 2006. Early warning research was principally 

applied therefore to other production areas: these included 

northern Queensland (Tully north), the Burdekin Irrigation Area, 

specific parts of central and southern Queensland and northern 

New South Wales. 

Spore traps. Burkard ‘spore and pollen samplers’ were sourced 

from the UK manufacturer; traps incorporate an air intake at 10l 

/ minute, a revolving internal drum that rotates once every 

seven days, and an attached sticky tape made from clear plastic 

coated with petroleum jelly. 

Detection of smut spores. Initial diagnosis of spore tapes was by 

light microscopy. There were several major issues with this 

method: i. it was very difficult to categorically state that a spore 

on a spore trap tape was U. scitaminea and not that of another 

smut species, ii. the diagnosis was time consuming, causing 

there to be significant delays between a spore trapping event 

and supply of the results, iii. operator fatigue was a very real 

issue. For this reason, a specific molecular test for U. scitaminea 

was developed and used to assay spore trap tapes. The 

advantages were the generation of a specific, faster result, 

though outcomes were then qualitative rather than quantitative 

(plus or minus smut only)—no quantification of the airborne 

inoculum was possible using this assay. 

Spore trapping program. Fifteen spore traps were purchased 

soon after the initial smut detection in June 2006; trapping 

began in the nominated areas in late 2006. Sites were selected 

across the relevant district with care taken to minimise tape 

contamination from dust associated with vehicular traffic on 

unsealed roads and tracks. Traps were operated for 1–2 days at 

each trap site before movement to another location within the 

district. Records of weather conditions, site GPS details and crop 

details allowed sites to be characterised for later interpretation 

of results. Mapinfo (version 8) software was used to provide GIS 

information on smut spore detections. 

RESULTS 

Early warning. Many detections of sugarcane smut spores within 

districts and regions were made before disease symptoms were 

found. In the Burdekin Irrigation Area, over 40% of trap sites 

returned positive spore trap detections in July 2007. Although 

careful crop inspections were undertaken at this time, and over 

the next 18 months, disease symptoms were not detected until 

October 2008. Similar observations were made in a number of 

districts (spore detections before crop symptoms); these are 

listed in Table 1. 

Table 1. Spore trap detections of U. scitaminea in Australian sugarcane 

production areas compared to when crop symptoms were first 

identified. 

District 

Spores detected 

Crop symptoms 

identified 

Mossman July 2007 December 2008 

Tableland July 2008 September 2008 

Mulgrave July 2008 September 2008 

Burdekin April 2007 October 2008 

Proserpine July 2007 December 2007 

Maryborough March 2007 January 2008 

DISCUSSION 

The smut spore trapping program successfully provided early 

warning of the disease in Queensland and New South Wales 

cane‐fields. 18 months pre‐emptive warning was provided in the 

Burdekin and Mossman areas of northern Queensland. Smut 

spores have been found in northern NSW but after 18 months, 

no crop symptoms have been seen in this region. Early warning 

has provided farmers with the opportunity to implement smut 

management plans much earlier than otherwise would have 

occurred. As sugarcane is a semi‐perennial crop, it is not possible 

to change cultivars on a whole farm basis within one year; in fact 

cultivar rotations usually take 4–5 years to complete—so early 

warning of a disease threat is very important in the transition to 

resistant varieties. This type of work has not been undertaken in 

other sugarcane‐producing countries. The work reported here 

illustrates the potential for early warning of sugarcane smut 

using commercial spore trap technology. 


We acknowledge the assistance of BSES Limited extension staff 

and Productivity Service personnel. 


Software‐assisted gap estimation (SAGE) for measuring grapevine leaf canopy density 

G.N. Hill{ XE "Hill, G.N." } 1 , R.M. Beresford 1 , P.N. Wood 2 , K.S. Kim 1 and P.J Wright 3 

1 The New Zealand Institute for Plant and Food Research Ltd. (Plant and Food Research), Private Bag 92169, Auckland 1025, New Zealand 

2 Plant and Food Research, Private Bag 1401, Havelock North 4157, New Zealand 

3 Plant and Food Research, Pukekohe Research Station, Cronin Rd, RD 1, Pukekohe 2676, New Zealand 

INTRODUCTION 

Botrytis bunch rot (botrytis), caused by Botrytis cinerea, is a 

major disease of wine grapes. Reducing vine canopy density 

through leaf plucking can reduce harvest disease severity. 

Determining the level of leaf plucking required to achieve useful 

botrytis control requires accurate measurements of canopy 

density. Existing methods, such as point quadrat (PQ) analysis 

(1), can be labour‐intensive, subjective, damaging, too 

complicated and/or impractical for many researchers or for 

routine use by vineyard managers. 

Software‐assisted gap estimation (SAGE) gives a measurement of 

the percentage of gap in the vine canopy. This study investigated 

the relationship between SAGE and PQ analysis, and their 

relationship to botrytis severity, to establish whether or not 

SAGE is a satisfactory alternative to PQ analysis for vine canopy 

density estimation. 


Vineyard Trials. Two trials were conducted during the 2008– 

2009 growing season on Sauvignon blanc vines in New Zealand, 

one on a commercial vineyard in Hawke’s Bay and the other at 

the Plant and Food Research vineyard in Pukekohe. Treatments 

were imposed to produce a range of canopy densities. No 

botryticides were used in the trials. Canopy density was 

measured by both SAGE and PQ analysis at pre‐bunch closure 

(PBC), veraison and harvest. An additional measurement was 

taken at Pukekohe between PBC and veraison. 

SAGE. A blue tarpaulin is suspended behind the vine row and is 

then photographed. The image is analysed using software that 

calculates the ratio of the area of tarpaulin to the area of leaves 

in the canopy, termed ‘gap’. 

PQ Analysis. PQ analysis was carried out as described by Smart 

& Robinson in Sunlight into Wine (1). Leaf layer number (LLN) 

was compared with gap. 

Botrytis severity. Percentage severity of botrytis was visually 

estimated on 25 randomly selected bunches from each vine. 

RESULTS 

Gap vs LLN. Gap was found to be highly correlated with LLN 

(Figure 1). Fitted regression lines for the two site were not 

identical. Linear regression analysis testing the hypothesis 

relating to differences in slope and intercept of the two sites 

found that the intercepts were significantly different (P


Evaluation of the efficacy of Brassica spot models for control of white blister in 

Chinese cabbage 

D.P.F. Auer{ XE "Auer, D.P.F." } A , E.J. Minchinton A , R. Kennedy B , J.E. Petkowski A , R.F. Faggian A , R.J. Holmes A and F.M. Thomson A 

A DPI Victoria—Knoxfield Centre, Private Bag 15 Ferntree Gully DC, 3156, Victoria 

B 

Warrick, HRI, Wellesbourne, Warrickshire, CV359EF, United Kingdom 

INTRODUCTION 

White blister caused by Albugo candida is a major disease of 

Chinese cabbage, Brassica rapa. A. candida causes blisters on 

abbatial leaf surfaces, necessitating their removal from heads at 

harvest, which increases production costs. Brassica spot , a 

disease predictive model was developed for white blister on 

broccoli, B. oleracea (1). This abstract reports on evaluation of 

two version of the model, the infection model (old) and the 

latent incubation period model (new) in Chinese cabbage against 

weekly spray programs for control of white blister. 


Trial design. Chinese cabbage variety Matilda was direct seeded 

at 3 rows per bed on 27/11/2008 and harvested on 19/1/2009 at 

a commercial market garden in Devon Meadows, Victoria. The 

trial was laid out in 6 blocks each divided into 6 plots with 

unequal replication using the randomised procedure in GenStat. 

Each plot contained approximately 60 plants. The four 

treatments applied to plots were: (i) control (unsprayed); (ii) 

weekly sprays of Tribase Blue (copper sulphate tribase) and Li‐ 

700 (soyal phospholypids and propionic acid); (iii) Amistar 

(azoxystrobin) sprayed according to the old version of the 

Brassica spot model and (iv) Amistar sprayed according to the 

new version of the Brassica spot model. The weekly program 

received five sprays starting at week 3, the old and new models 

predicted one spray each at weeks 3 and 4, respectively. 

Weather station and Brassica spot model. A ModelT weather 

station (Western Electronic Design) was placed in the crop and 

recorded average leaf wetness, temperature, relative humidity 

and total rainfall at 30 min. intervals. The model used this data 

to predict appearance of symptoms in the crop. 

Trial analysis. Disease incidence per plot was recorded as the 

number of plants out of 20, showing white blister symptoms. A 

Generalised Linear Mixed Model was used to analyse the data. 

Severity was scored as the number of the outer 4 free‐standing 

leaves that were showing white blister and these data were 

analysed using REML (residual maximum likelihood). Due to 

100% incidence of white blister on the unsprayed plots, these 

data were excluded from that analysis. 

RESULTS 

White blister first appeared in the crop four weeks after sowing 

in all treatments. At the harvest assessment, leaves appeared to 

be infected with white blister from oldest to youngest. No white 

blister symptoms were observed on the leaves covering the 

head. Conditions favoured white blister consistently throughout 

the trial, based on the Brassica spot model (Fig 1). Amistar 

applied according to the new Brassica spot model was the only 

treatment to significantly reduce incidence and severity of white 

blister on Chinese cabbage (Table 1). 

Figure 1. Brassica spot predictions for the old (top) and new (bottom) 

versions of the model for prediction for white blister in the Chinese 

cabbage trial. Old Brassica spot model: black bars = high disease 

pressure, grey bars = moderate disease pressure and white bars = low 

disease pressure. New Brassica 

spot model: when the 5% line (top) 

crosses the dashed index bar a spray is predicted (arrow). 

Table 1. Effect of timing sprays with the two versions of the Brassica spot 

disease predictive models to control white blister on Chinese cabbage at 

harvest. 

Treatment 

Mean incidence Mean severity on outer 4 

on plants (%) 1 leaves (scale 0-4) 1 

Control (unsprayed) 100 2.33a 

Weekly 95.59a 2.24a 

Old Brassica spot model 94.48a 2.17a 

New Brassica spot model 72.90b 1.17b 

1 Different letters against the predicted means indicates that they are significantly 

different (p=0.008) 

DISCUSSION 

Disease freedom on the outer 4 leaves of the harvested head is a 

critical commercial quality factor, but none of the treatments 

achieved this. Amistar applied according to the new Brassica spot 

model was the only treatment giving significant control of white 

blister on these outer leaves. The new model recommended a 

single spray 14 days before harvest, based on disease 

progression data from the crop inspections and environmental 

data, but spraying 14 d prior to harvest may co‐incidentally be 

the best phenological timing to protect the 4 unfolding leaves. 

Using the model is time consuming because it involves crop 

inspections. Further work is suggested to compare spraying 

according to new Brassica spot model against a single spray of 

fungicide 14 d before harvest. 


The authors thank HAL, AusVeg, the State Government of 

Victoria and the Federal Government for financial support and 

the growers for providing field trial sites. 

REFERENCES 

1. Kennedy, R. and T. Gilles (2003). Brassica spot a forecasting system 

for foliar disease of vegetable brassicas. 8th ICPP Christchurch, New 

Zealand, 2–7 February 2003, Christchurch New Zealand. 


evaluating an infection model of prune rust to improve the management of disease 

for almond and prune growers 

INTRODUCTION 

P.A. Magarey{ XE "Magarey, P.A." } A , T.J. Wicks B , N.A. Learhinan A and A. Horsfield C 

A South Australian Research and Development Institute, PO Box 411, Loxton, 5333, SA 

B SARDI, GPO Box 1671, Adelaide, 5064 SA 

C FarmOz, PO Box 1932, Milton BC QLD 4064 

Trials of an almond rust infection model could lead to financial 

savings by effectively controlling the disease with minimum 

chemical use. The threat of infection events for almond and 

prune rust (Tranzschelia discolour) in orchards is responsible for 

many fungicides being applied needlessly. We aim to identify the 

conditions that favour the pathogen to 1) more effectively 

predict disease and thus more accurately time spray 

applications, and 2) address key issues such as: the rising cost of 

fungicides and fuel, and the industry’s move to improve the 

carbon footprint of almond orchards. We plan to assess the 

potential for a disease advisory service for almond and prune 

growers similar to CropWatch as used in the South Australian 

grape industry. 


For the past two years, Model T MetStations®—two at Loxton in 

the Riverland and one on the Adelaide Plains ‐have monitored 

orchard micro‐climate while we have monitored disease 

progress. An infection model developed for prune rust (1) has 

been adapted for use in almonds and installed in the 

MetStations® as disease predictors. The MetStation® software 

used the model to process leaf wetness and temperature data 

and predict infections. We compared these with field 

observations to evaluate the model for accuracy. The foliage was 

monitored usually every 8 days (range 2–13 days). 

RESULTS 

We present data for 2008/09 at Loxton. In that season, rain 

events of >1.5 mm were rare: x2 in September; x1 October; x3 

November; x4 December and none in January‐March. Consistent 

with the dry conditions, new occurrence of rust (light infection 

only) occurred on only four occasions (Table 1). 

For example, on 2 November, a 10.7 mm rain induced 15 hours 

leaf wetness while temperatures ranged from 24.8°C–13.8°C. 

The model predicted an Infection Score (InfSc) of 5026 for this 

event. Since this was below the previously set threshold of 6,500 

for significant disease (data not shown), a light infection was 

expected. Previous experiments had measured incubation 

periods of between 17–21 days, so we anticipated a little rust 

would be first seen in the vicinity of 19 November. This matched 

well with observations of a few rust pustules on 17 November 

which increased in number by 24th. 

Table 1 shows the model outputs for this and three other events 

in which infection was observed. Similar or better accuracy was 

achieved on each of those occasions but an apparent failure 

occurred on two others, when no rust developed. 

In the period January‐March 2009, there were many days with 

no leaf wetness. The prototype model correctly predicted ‘no 

disease’ for these events. 

DISCUSSION 

The rarity of the rain events made it possible to decipher when 

infection actually occurred. One of the ‘failures’ occurred on 28 

November with a 12‐hour leaf wetness period for which the 

model predicted InfSc 3920, a light infection, comparable to that 

noted on 12 December, but none was seen. Analyses of the data 

for this and an additional predicted light infection event on 5 

December showed that relative humidity (RH) was low for much 

of the associated leaf wetness periods. This raised the question: 

would the prototype infection model be improved by adding a 

RH factor? 

Further review of the model is planned in subsequent seasons 

but evaluation to‐date suggests incorporation of RH as a factor 

would increase the model’s sensitivity in distinguishing potential 

light infections caused by leaf wetness alone, from conditions 

when RH is also high and more favourable for infection. For 

instance, a simple arbitrary multiplier could be included as 

follows: 

RH 00.0 – 89.9%, InfSc = InfSc x 1.0 (ie no change) 

RH 90.0 – 97.9%, InfSc = InfSc x 1.2; and 

RH ≥ 98%, InfSc = InfSc x 1.5. 

Conclusions The potential for success in adapting the Model T 

MetStation as a rust disease predictor to‐date has led to 

optimism in achieving project objectives. The current data have 

advanced the prospects of the prototype infection model as a 

useful tool for almond (and prune) growers to manage disease. 

The model has shown capacity to provide advice as to when 

sprays can be confidently withheld and when they are needed in 

rust control programs. 


We appreciate the assistance of Ben Brown, the Almond Board 

of Australia, and Horticulture Australian Ltd in facilitating this 

project. 

REFERENCES 

1. Kable, PF et al (1991) A computer‐based system for the 

management of the rust disease of French prunes. EPPO Bulletin 

Volume 21(3): 573–580. 


Table 1. Predictions of Infection Events and Disease Scores Compared to Observations of the Almond Rust Fungus Tranzschelia discolor. Site 1: Loxton 

Research Centre, Loxton, SA. 2008/09 

Date Time Score, Severity and Date of Predicted Disease Orchard Disease Observations 

2 Nov 16:00 5026 Light infection From 19 Nov Between 17–24 Nov. Few pustules 

13 Nov 23:40 5338 Light infection From 30 Nov Between 26 Nov – 2 Dec. Few pustules 

28 Nov 0130 3920 Light infection From 15 Dec None seen 

5 Dec 0250 3528 Light infection From 22 Dec None seen 

12 Dec 12:30 3808 V. light infection From 29 Dec On 29 Dec. Few pustules 

18 Dec 01:30 4088 Light infection From 4 Jan Between 29 Dec and 6 Jan. Few pustules 


Session 3C—Disease management 

Management of white blister on vegetable brassicas with irrigation and varieties 

INTRODUCTION 

E.J. Minchinton{ XE "Minchinton, E.J." } A , D.P.F. Auer A , J.E. Petkowski A , R.F. Faggian A , V. Galea B and F. Thomson A 

A BRD, DPI Victoria—Knoxfield Centre, Private Bag 15 Ferntree Gully DC, 3156, Victoria 

B School of Agronomy and Horticulture, The University of Queensland, Gatton Campus, 4334, Queensland 

White blister caused by the oomycete Albugo candida, has been 

the main foliage disease on red radish for at least 30 years. In 

the summer of 2001/2002, it caused up to 100% crop losses in 

broccoli and cauliflower in Victoria. A. candida infecting radish is 

generally classified as race 1 and A. candida infecting broccoli is 

classified as race 9. 

This abstract reports on systematic surveys undertaken 

seasonally during 2002 to identify if irrigation practices impacted 

upon the level of disease in commercial red radish crops, and 

whether similar IPM practices could be used to manage white 

blister on broccoli crops. 


Systematic surveys. Red radishes of all ages were assessed 

seasonally during 2002 by a ‘two‐stage sampling method’ (Nam 

Ky Nguyen, pers. comm.). This method was used to determine 

the number of beds to be selected for assessment of white 

blister in each half of a bay (section between over‐head sprinkler 

lines). The beds were then randomly selected. A bed of radish 

usually consists of 6 rows. In each of the selected beds, two 

sections each of 20 cm in length were randomly selected to 

assess for the incidence of white blister. During summer, 

autumn, winter and spring 26, 23, 25 and 27 crops were 

surveyed, respectively. Only growers who irrigated crops at the 

same times were included in the analysis. Due to the binary 

nature of the data, logistic regression was used to analyse the 

results. 

Irrigation field trial for broccoli. The trial, located at Dairy Road, 

Werribee, Victoria, was originally designed as a general split‐plot 

design. Each of 3 blocks contained 2 replicates. Each of the 6 

replicates consisted of two whole plots to which the two 

irrigation times of early morning (4.00 am) or evening (8.00 pm) 

were randomly allocated. The 8 treatment combinations of 

variety (consisting of the resistant variety ‘Tyson’ from Syngenta, 

or the susceptible variety ‘Ironman’ from Seminis) and four spray 

regimes (not reported here) were randomly allocated to 8 

subplots within each of the whole plots. 

Table 1. Effect of irrigation time on the incidence of white blister on red 

radish 

Incidence of white blister in 2002 (%) 

Time of irrigation Summer Autumn Winter Spring 

(Feb and Mar) (May) (Jul and Aug) (Oct and Nov) 

Evening (8-12pm) 7.9a 1 23.0a 4.8a 12.5a 

Late morning (9-12am) 0.8b 12.1b 0.4c 4.9b 

Early morning (approx.6.00 0.8b 3.4c 1.7b 1.5c 

1 Within each column (season), different letters against the means indicates that 

they are significantly different at the 5% level. 

Irrigation trial for broccoli. Irrigating the broccoli crop in the 

evening approximately doubled the incidence of white blister 

compared with early morning irrigation for both varieties (Table 

2). Tyson which is a resistant variety showed few symptoms of 

white blister. 

Table 2. Effect of irrigation time on broccoli varieties susceptible and 

tolerant to white blister 

Time of irrigation 

Mean incidence 

(%) of white 

Mean incidence (%) of 

white blister 

blister var. Tyson var. Ironman 

Evening (8.00 pm) 2.9 a 0.57 14.37 

Early morning (4.00 am) 1.3 b 0.25 6.8 

The means are significantly different (p=0.005). 

DISCUSSION 

Early morning irrigation (4.00 am or 6.00 am) can be a useful IPM 

tool to reduce the risk of white blister in red radish and broccoli 

crops. Growing a resistant variety may further reduce the risk of 

white blister. 


The authors thank HAL, AusVeg, the State Government of 

Victoria and the Federal Government for financial support and 

the growers for providing field trial sites. 

Seedlings, aged 8 weeks, were planted 2 rows per bed on 23 July 

2008. Subplot dimensions of beds were 8 m long and contained 

approximately 52 plants. The middle 20 plants per subplot were 

assessed for the incidence (presence or absence) of white blister 

on broccoli heads at harvest. A generalised linear mixed model 

(GLMM) was fitted to the data. 

RESULTS 

Systematic surveys of red radish. White blister on red radish 

was most prevalent during autumn and spring (Table 1). Red 

radish crops irrigated in the evening (8.00pm–12.00pm) had 

significantly higher incidence of white blister compared with 

other times of irrigation. Crops that were irrigated in the early 

morning (approximately 6.00 am) showed lower levels of white 

blister in 3 of the 4 seasons surveyed (Table 1). Data collected on 

age of crop, cultivar and regional differences are not reported 

here. 


Alternative screening methods for sugarcane smut using natural infection and tissue 

staining 

INTRODUCTION 

S.A. Bhuiyan{ XE "Bhuiyan, S.A." } A , V. Barden A , R.C. James A , G. Bade A , B.J. Croft B and M.C. Cox A 

A 

BSES Limited, Private Bag 4, Bundaberg DC, QLD 4670, Queensland 

B 

BSES Limited 90 Old Cove Road, Woodford, QLD 4514, Queensland 

Sugarcane smut caused by Ustilago scitaminea was first 

detected in the Ord River Irrigation Area, WA in 1998, and in 

Queensland in 2006 (1). BSES had rated cultivars for resistance 

to smut in Indonesia and WA prior to the arrival of the disease in 

Queensland but commenced a program to screen sugarcane 

clones for resistance in Queensland when it clear the disease 

could not be eradicated. The current screening method involves 

inoculation of sugarcane setts by dipping into smut spore 

suspension. Although this method is internationally accepted, it 

has some drawbacks: i) it does not replicate natural infection; 

and ii) it is relatively time consuming and expensive. 

The objectives of this research were: i) obtain data on sugarcane 

cultivar reaction to natural infection and compare with existing 

standard ratings; and ii) develop a histological method to screen 

for smut resistance. 


Natural infection. Nine cultivars with a range of smut ratings 

were planted at the Bundaberg smut research farm, using 

randomised complete block design with 10 replicates in 

September 2007. Rows of smut susceptible cultivar Q205 A 

inoculated with smut were planted between the rows of the test 

plots. The trial was inspected for smut twice in 2008 in the plant 

crop, and monthly from February 2009 in the first ratoon (regrowth) 

crop. The number of infected plants and total number 

plants in each plot were counted. Data were log‐transformed 

(log 10 (smut%+1)) for regression analysis to determine the 

relationship between standard smut rating and smut incidence 

for natural infection. 

there is potential to reduce the time of screening by discarding 

susceptible cultivars early in the screening program. 

Table 1. Incidence (%) of smut infected plants in natural 

infection trial in Bundaberg, assessed in March 2009 

Cultivar Standard rating Mean smut % * 

Q151 1 1.43 (1.43) 

Q232 A 3 2.00 (2.0) 

Q190 A 4 9.71 (5.5) 

QS97‐2067 4 6.43 (5.0) 

Q135 5 12.20 (4.6) 

QS94‐91 6 23.02 (6.5) 

Q188 A 7 22.08 (5.6) 

Q138 8 21.78 (3.3) 

Q205 A 9 93.17 (3.3) 

* values in parenthesis are ±standard error of means 

Log(smut%+1) 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

y = 0.1836x + 0.1479 

R 2 = 0.9 

P1 mm sections of bud were cut, and stained with trypan blue 

(Figure 2), and observed under a light microscope, and 

subsequently photographed. 


Natural infection. Except Q205 A , no smut symptoms were 

observed in the plant crop in 2008. High incidence of smut was 

observed on susceptible cultivars (rating 6–9) in the first ratoon 

crop compared with resistant cultivars (Table 1). The regression 

results suggest that there was a highly significant (P


Interruption of cool chain and strawberry fruit rot by leak‐causing fungi Rhizopus 

species 

M. Walter{ XE "Walter, M." }, H.J. Siefkes‐Boer and K.S.H. Boyd‐Wilson 

The New Zealand Institute for Plant and Food Research Limited, Canterbury Research Centre, PO Box 5, Lincoln 7640, New Zealand 

INTRODUCTION 

The causal agents of strawberry leak are several different species 

grouped in the fungus‐like class of zygomycetes (kingdom: 

Chromista), which are fast growing organisms 1 . Zygomycetes 

have been associated with strawberry fruit leak, mostly from the 

Rhizopus genus, but similar disease symptoms are also 

associated with Mucor infections 1 . The recent detection of 

several cold‐tolerant leak isolates 2 has prompted research into 

cool chain management for NZ strawberry. The work described 

here shows how breaks in the cool chain increase leak rots and 

therefore dramatically decrease the shelf‐life of strawberry fruit. 


Six leak isolates (Rhizopus stolonifer) were used to inoculate 

(mycelium) potato dextrose agar (PDA) and sliced strawberry 

fruit (5 mm). Cool chain incubation (4ºC) was interrupted at 

staggered intervals (daily) by exposure to room temperature 

(20°C) for 2 h, resulting in continuous cool chain incubation or 1– 

6 interruptions. Fungal growth was assessed daily during the ‘2 h 

at room temperature cycle’. There were 2 replicates/isolate and 

substrate. The experiment was repeated. 

An additional whole fruit experiment was conducted. Eight fruit 

per tray (with 10 individual compartments) were inoculated with 

a mycelial tuft from one of the six isolates and two fruit served 

as non‐inoculated controls (injury only). There were two 

replicate trays per isolate. Incubation and interruptions were as 

above. Rot was assessed employing a fruit score, where 0=no 

symptoms; 1=small sunken lesion; 2=large sunken lesion; 

3=sunken lesion with juice leaking; 4=fruit covered in mycelia. At 

completion of the experiment all fruit were left for 2 days at 

20ºC to check for delayed onset of disease symptoms. 

RESULTS 

Mycelial growth and fruit score for continuous incubation at 

20ºC and 4ºC (with 1–6 interruptions) are shown in Figures 1. 

Growth and disease symptoms increased during incubation at 

both temperature regimes. At the 4ºC incubation, the number of 

interruptions (or hours exposed to 20ºC) significantly increased 

(P

Enhancing Papua New Guinea smallholder cocoa production through greater adoption 

of integrated pest and disease management 

INTRODUCTION 

Yak Namaliu{ XE "Namaliu, Y." } A , John Konam A,B , Josephine Saul A , Rosalie Daniel C and David Guest C 

A PNG Cocoa and Coconut Institute, PMB 10 Rabaul, PNG 

B Secretariat of the Pacific Community, Suva, FIJI 

C Faculty of Agriculture, Food and Natural Resources, The University of Sydney AUSTRALIA 

More than 80% of Papua New Guinea’s annual cocoa production 

is produced by 150,000 smallholder farming families. The current 

average yield of 300 kg dry beans/ha reflects poor management 

and high losses to Phytophthora pod rot and canker 

(Phytophthora palmivora) and Vascular Streak Dieback 

(Oncobasidium theobromae). Since 2007 cocoa pod borer (CPB) 

has also been recognised as a serious pest after the eradication 

program in Gazelle district of ENB failed. Apart from improved 

cocoa genotypes, technology adoption is poor and over 95% of 

108 farmers surveyed had no knowledge of cocoa disease and 

pest management, leading observers like Frank Jarrett (1) to ask 

‘‘how do farmers (in PNG) find out about innovations and just 

what sources of information are important?” 

We developed interventions that are synchronised with the 

cocoa cropping cycle and the resources available to farmers and 

link stakeholders through active participation. Four Integrated 

Pest and Disease Management (IPDM) options have been piloted 

in 3 different provinces. 


The IPDM strategy was designed with inputs programmed in 

relation to peak flowering, cherelle setting and peak ripening 

and also in relation to the pest and disease cycle so that the 

IPDM inputs are applied when the pest and disease are at their 

weakest point of their cycle (2). Four IPDM packages including a 

conventional management option were tested in East New 

Britain (ENB), Bougainville and Madang (Table 1). 

Table 1. IDPM options developed for PNG cocoa farmers 

Option IPDM Input Activities 

1 Low Current practice (minimal) 

2 Medium Sanitation, weekly harvests, cocoa and 

shade tree pruning, weed management 

3 High Option 2 + canker treatment, fertiliser 

and manures 

4 Very high Option 3 + insect management 

The piloting of options involved three village communities in 

Bougainville, Madang and ENB. At each site 12 to 15 farmer 

families were selected and the four options were established 

through Participatory Action Research (PAR). In the start up 

workshop in November 2005, selected and interested farmers 

participated in presentations and discussions. Some smallholder 

communities were provided with information on improved 

cocoa management from trials at the CCI research station. 

Selected farmers, their families and extension officers were 

trained and were engaged in observing and analysing the 

condition of trees in each option before applying treatments for 

each management package. Each selected family treated one 

tree in each option and the trees were given the name of the 

farmer involved. The four options were applied in each farmers 

block, and fully replicated by the 12 participating farmers. Thus 

there were 36 farmers trained in each province. Farmers visited 

their trees every month, carried out observations and took 

notes. The managed cocoa tree themselves have became the 

farmer’s principle educator. Baseline surveys were carried out at 

the beginning and a second followup survey using the same 

questionnaire was conducted in 2008 to determine if farmers 

had changed their management of cocoa. 


We aim to transform the industry from the current 90% low 

input to 50% medium input farms. Over 108 PAR trials have been 

established and more than 1500 farmers trained. The uptake of 

options is close to 100%, and over 80% of farmers prefer the 

higher input options. Yield increases of more than 100% have 

been reported and PNG smallholders are investing in cocoa for 

the first time. National production has increased from 42,000T in 

2005 to 56,000T in 2008. Farmers in CPB‐infested areas in ENBP 

report increased yields following the implementation of IPDM 

despite the impact of CPB. 

In the delivery of IPDM, direct transfer of the technology and 

establishment of research programs with farmers via PAR 

provides a unique opportunity to increase adoption of research 

results. Through this approach smallholders were trained to 

record inputs and production data, and are able to understand 

plant health management and develop improved cocoa 

management and production. 

Establishing demonstration plots and conducting field days has 

increased the profile of research and extension agencies, which 

are now much more engaged with the day‐to‐day problems 

faced by the farmers. The feedback from farmers has in turn 

improved the capacity of supporting researchers at CCI to focus 

their research on industry needs. 

The work highlights the importance of packaging research results 

into recommendations to improve technology adoption. 


This work was supported by ACIAR (PHT/2003/015). 

REFERENCES 

1. Jarrett FG. 1985. Innovation in Papua New Guinea Agriculture. 

Discussion Paper 23. Institute of National Affairs, Port Moresby. 

2. Konam JK et al. 2008. Integrated Pest and Disease Management for 

Sustainable Cocoa Production. Monograph 131, ACIAR, Canberra. 




INTRODUCTION 

Molecular cytology of Phytophthora‐plant interactions 

Adrienne R. Hardham{ XE "Hardham, A.R." } 

Plant Cell Biology Group, Research School of Biology, The Australian National University, Canberra, 2601 ACT 

Many of the more than 60 species of Phytophthora are 

aggressive plant pathogens that cause extensive losses in 

agricultural crops, horticultural plants and natural ecosystems. 

Some Phytophthora species have narrow host ranges; others 

have extremely broad host ranges. P. cinnamomi, for example, is 

now known to infect over 3,500 plant species, many of them 

native to Australia. 

motifs. Cysts germinate from a pre‐determined site that has 

been oriented towards the plant surface. Germ tubes penetrate 

either directly through the outer periclinal wall or along an 

anticlinal wall. Phytophthora species contain large multigene 

families encoding cell wall degrading enzymes whose secretion 

facilitates penetration and colonisation of host tissues. Nutrients 

are acquired from living or dead plant cells, allowing host 

colonisation and pathogen reproduction within 2–3 days. 

Phytophthora and other members of the class Oomycetes form 

fungus‐like hyphae and conidia‐like asexual sporangia, but they 

are not fungi. The Oomycetes group with a range of other 

protists such as diatoms, coloured algae and malarial parasites 

within the Stramenopiles, an assemblage whose taxon‐defining 

characteristics include possession of tubular hairs on their 

flagella. 

Species of Phytophthora produce motile, biflagellate zoospores 

that play a key role in the initiation of plant disease. Zoospores 

target suitable infection sites where they encyst and attach. 

Cysts soon germinate and attempt to invade the underlying 

plant tissues. Some Phytophthora species are hemibiotrophs and 

initially establish a stable relationship with living host cells, 

obtaining nutrients through the development of haustoria within 

infected cells. The majority are necrotrophs that feed on dead or 

dying cells. Like fungi, Phytophthora and other Oomycetes 

secrete effector proteins that are required for pathogenicity. 

Some effectors, such as cell wall degrading enzymes, function in 

the plant apoplast but others are transported across the plant 

plasma membrane into the host cytoplasm from where, in 

susceptible plants, they orchestrate metabolic changes that 

favour pathogen growth. In resistant plants, recognition of the 

invading pathogen induces a rapid defence response that 

inhibits disease development. In this presentation, I will review 

our current understanding of cellular and molecular aspects of 

the interactions between plants and Phytophthora pathogens. In 

so doing, I will highlight how modern molecular cytology is 

revolutionising our ability to elucidate the roles of selected 

proteins and cell components in Phytophthora pathogenicity and 

plant defence. 


Early studies of the interactions between plants and species of 

Phytophthora used light and electron microscopy to describe the 

major features of disease development and the plant defence 

response. More recently, these traditional approaches have 

been extended by advanced light and electron microscopy 

techniques that use a variety of methods, such as 

immunocytochemical labelling, GFP‐tagging and confocal 

microscopy, to mark and visualise a range of plant and pathogen 

molecules and cell components. This molecular cytology not only 

facilitates identification of specific cell structures in fixed and 

sectioned material but it can also do so in living cells. 

Plant defence. Plants react rapidly to attempted infection by 

Phytophthora. Some of the earliest responses observed include 

an increase in cytoplasmic Ca 2+ concentration, cytoplasmic 

aggregation, formation of wall appositions beneath the invading 

hyphae and synthesis of reactive oxygen species, pathogenesisrelated 

proteins and phytoalexins. Immunocytochemistry and 

GFP‐tagging have revealed that cytoplasmic aggregation is 

accompanied by dramatic and dynamic reorganisation of actin 

and microtubular cytoskeletons, the endoplasmic reticulum (ER), 

Golgi bodies (GA) and peroxisomes. Actin, ER, GA and 

peroxisomes become focused on the infection site and are likely 

to be responsible for secretion of toxins and formation of wall 

appositions that inhibit hyphal penetration of the plant cell wall. 

Recent studies of GFP‐tagged Arabidopsis plants indicate that 

the rapid plant cell response may be triggered by detection of 

the pressure exerted by the invading pathogen hypha. 

Figure 1. Attack and defence. A. CryoScanning electron micrograph of a 

Phytophthora spore that has penetrated the plant surface along the 

anticlinal wall between adjacent epidermal cells. Events leading up to 

this stage include zoospore chemotaxis to a suitable infection site, 

polarised cyst germination and secretion of cell wall degrading enzymes 

from the hyphal tip. B. Confocal microscopy of transgenic Arabidopsis 

plants expressing GFP‐tagged hTalin to visualise actin microfilament 

arrays in living plant epidermal cells responding to attack. Aggregations 

of filamentous actin form directly underneath sites of attempted 

penetration. 

The genomes of four Phytophthora species have now been 

sequenced with others in the pipeline. Extensive transcriptome 

data are also available for P. infestans and P. nicotianae. 

Together with data from a number of host plants, this sequence 

information provides an invaluable resource for molecular 

cytology studies of protein and organelle function during 

Phytophthora‐plant interactions. 


Phytophthora pathogenicity. Phytophthora zoospores are 

chemotactically and electrotactically attracted to specific regions 

on the plant surface that are favourable infection sites. 

Zoospores encyst and attach to the plant through rapid secretion 

of adhesive material that includes high molecular weight 

proteins containing multiple thrombo‐spondin type1 repeat 


Gene expression changes during host‐pathogen interaction between Arabidopsis 

thaliana and Plasmodiophora brassicae 

INTRODUCTION 

A. Agarwal{ XE "Agarwal, A." } A,D , V. Kaul B , R. Faggian C and D.M. Cahill D 

A Department of Primary Industries, Private Bag 15, Ferntree Gully DC, 3156, Victoria 

B School of Botany, The University of Melbourne, Parkville, 3010, Victoria 

C Department of Primary Industries, 32 Lincoln Square, North Carlton, 3052, Victoria 

D School of Life and Environmental Sciences, Deakin University, Geelong, 3217, Victoria 

Plasmodiophora brassicae is a biotrophic obligate plant 

pathogen that causes developmental changes in susceptible host 

cells, leading to the development of root galls (clubroot) and 

stunted growth. It is one of the most devastating diseases of 

vegetable brassicas worldwide and significantly reduces crop 

yield. In Australia, clubroot is managed using a combination of 

integrated control methods and recently introduced resistant 

varieties. Breeding resistant cultivars is difficult because of the 

genetic variation in the field populations of the pathogen. A 

host‐pathogen interaction between Arabidopsis thaliana 

ecotype Col‐0 and Plasmodiophora brassicae (Australian field 

population) was examined at the cellular and molecular levels to 

gain a better understanding of the pathogenic mechanisms. This 

study reports on the gene expression study (microarray analysis) 

conducted for this compatible host‐pathogen interaction during 

the key developmental stages of the disease prior to ten days 

after inoculation. 


A modified sand‐liquid culture method was developed to grow 

test‐plants such that observation of the primary life‐cycle stages 

of P. brassicae within Arabidopsis (ecotype Col‐0) roots was 

possible at very early time points. A real‐time quantitative PCR 

(qPCR) assay was also developed to quantify P. brassicae DNA in 

roots from day 1 onwards and up to 23 days after inoculation. 

Microarray analysis was conducted at 4, 7 and 10 days after 

inoculation using the 22K Arabidopsis ATH1 microarray chip. 

Gene expression at greater than a 1.5‐fold increase or decrease 

at a 95% confidence level relative to controls was considered 

biologically significant in this study. Data analysis was carried out 

using the AVADIS software package and selected genes were 

validated using real‐time reverse transcriptase quantitative PCR 

(RT‐qPCR). 


According to the microscopic study, pathogen attachment and 

penetration occurred from day 4 onwards and root galls were 

fully developed within 28 days. QPCR confirmed that P. brassicae 

DNA was detectable in infected Arabidopsis roots from day 4 

onwards. The amount of amplified pathogen DNA increased by 

day 23 as the disease progressed equating to the amount of 

pathogen DNA amplified from 10 8 resting spores. 

Microarray analysis conducted at these early time points (days 4, 

7 and 10) demonstrated significant changes in gene expression. 

At 4 days after inoculation (dai), 147 genes were differentially 

up‐ or down‐regulated relative to control plants compared to 27 

genes at 7 dai and 37 genes at 10 dai. All genes were categorised 

into their functional groups and metabolic pathways. At day 4, 

when the pathogen had attached to the root hair and had 

possibly commenced penetration, differential expression of 

several genes known to be important for pathogen recognition 

and signal transduction in resistant interactions, such as the 

WRKY transcription factor, TIR‐NBS‐LRR and leucine‐rich repeat 

protein, were induced. Genes involved in cell growth, jasmonic 

acid biosynthesis and lipid biosynthesis were also induced. 

However, genes involved in the biosynthesis of lignin, 

phenylpropanoids (salicylic acid), ethylene, cytokinin, reactive 

oxygen species and pathogenesis related proteins (chitinase) 

were repressed (Table 1). 

Table 1. Summary of up- and down-regulated genes expressed in 

Arabidopsis roots 4 days after inoculation with P. brassicae 

Up-regulated genes 

Down-regulated genes 

Signalling 

Oxidative burst/stress 

WRKY transcription factor 

leucine-rich repeat protein 

MAPKK 

CDPK 

TIR-NBS-LRR 

Cell growth and modification 

expansin 

xyloglucan:xyloglucosyl transferase 

pectinesterase 

hydroxyproline-rich glycoprotein 

arabinogalactan 

Jasmonic acid biosynthesis 

Lipid metabolism 

peroxidase 

glutathione S-transferase 

NADP oxidoreductase 

Lignin biosynthesis 

Salicylic acid biosynthesis 

Ethylene biosynthesis 

Cytokinin biosynthesis 

PR proteins 

Genes differentially expressed were fewer in number at the 7 

and 10 day time points, which is the time when the pathogen 

has established within the roots and has developed into primary 

plasmodia and zoosporangia, without any morphological 

changes in the host. Four candidate genes expressed at day 4 

(WRKY transcription factor, lipoxygenase, phytoalexin‐deficient 4 

protein and TIR‐NBS‐LRR) were confirmed by RT‐qPCR. 

In conclusion, the microarray study identified changes in gene 

expression among many host‐plant genes that are known to 

have important roles during plant‐pathogen interactions that 

may be amenable to manipulation to increase disease 

resistance. Microscopic observations of host roots during the 

infection process showed correlations between gene expression 

and pathogen life‐cycle stage. The most important time point, in 

terms of gene‐expression changes in the plant was 4 days after 

inoculation. Suppression of specific gene activity and/or 

functional groups of genes in the host may lead to susceptibility 

in this host‐pathogen interaction. 


This work has been funded by DPI Victoria and Horticulture 

Australia Limited (HAL) using the vegetable levy and matched 

funds from the Australian Government. We would also like to 

thank DPI, Victoria for providing access to facilities. 

Session 4A—Plant pathogen interactions 



Hairpin RNA derived from viral NIa gene confers immunity to wheat streak mosaic 

virus infection in transgenic wheat plants 

INTRODUCTION 

Muhammad Fahim{ XE "Fahim, M." } 1,2 , Ligia Ayala‐Navarrete 1 , Anthony A. Millar 2 and Philip J. Larkin 1 

1 CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia 

2 Australian National University, Canberra ACT 2601, Australia 

Wheat streak mosaic virus (WSMV) has recently been identified 

from wheat and other cereals in Australia. The difficulties in 

finding adequate natural resistance in bread wheat and durum 

wheat prompted us to develop transgenic resistance based on 

induced siRNA mechanisms. We are reporting a successful 

strategy to develop resistance in Wheat against WSMV. 


A hairpinRNA construct was designed derived from Nuclear 

Inclusion ‘a’ gene of WSMV. BobWhite26 was stably cotransformed 

with two separate plasmids: one containing a 

hairpin with WSMV sequences and the other one with the nptII 

selectable marker. 

RESULTS 

Using biolistics we obtained a transformation efficiency of 3.5%. 

When progeny T 1 individuals were assayed against WSMV ten 

out of 16 tested families showed extreme resistance in 

transgenic segregants. The resistance in transgenic T 1 segregants 

was classified as immunity by four criteria: no disease symptoms 

were produced; ELISA readings were as in uninoculated plants; 

viral sequence could not be amplified from sap; the same saps 

failed to give infections in susceptible plants when used in testinoculation 

experiments. In one of four transgenic families 

examined in greater detail, the resistance segregated in a simple 

Mendelian ratio along with the transgene (Fig 1); the T 0 parent 

(hpWS2b) of this family had a single transgene insert by 

Southern hybridisation. Also in the T 1 family of hpWS2b the 

antibiotic resistance gene nptII, introduced on a separate 

plasmid by co‐bombardment, segregated independently of the 

hairpin transgene. 

DISCUSSION 

This paper reports for the first time engineered RNAi mediated 

immunity in wheat against WSMV using a hairpin RNA derived 

from Nuclear inclusion protein a (NIa) protease gene. WSMV is 

arguably the third most important virus of wheat behind BYDV 

and CYDV (barley and cereal yellow dwarf viruses). Marker‐free 

transgenics have advantages for regulatory approval and public 

acceptance (1, 2). Our study indicates that marker‐free WSMV 

immune plants can be readily produced using hairpinRNA genes, 

biolistics and co‐bombardment. 


We acknowledge AusAID for the studentship support of MF, 

Peter Waterhouse for invaluable advice on hairpin RNA design, 

Terese Richardson and Anna Mechanicos for technical support. 

REFERENCES 

1. Miki B, Abdeen A, Manabe Y and MacDonald P (2009) Selectable 

marker genes and unintended changes to the plant transcriptome. 

Plant Biotechnology Journal 7:211–218. 

2. Miki B and McHugh S (2004) Selectable marker genes in transgenic 

plants: applications, alternatives and biosafety. Journal of 

Biotechnology 107:193–232. 

ELISA ratio (I/H ± SEM) 

Syptoms Severity 

Plant Height 

15 

10 

5 

0 

4 

3 

2 

1 

0 

60 

50 

40 

30 

20 

10 

0 

HpWS2b-1 

HpWS2b-2 

HpWS2b-3 

HpWS2b-4 

HpWS2b-5 

HpWS2b-6 

HpWS2b-7 

HpWS2b-8 

HpWS2b-9 

HpWS2b-10 

HpWS2b-11 

HpWS2b-12 

HpWS2b-13 

HpWS2b-14 

HpWS2b-15 

HpWS2b-16 

HpWS2b-17 

HpWS2b-18 

HpWS2b-19 

HpWS2b-20 

HpWS2b-21 

HpWS2b-22 

HpWS2b-23 

HpWS2b-24 

HpWS2b-25 

HpWS2b-26 

HpWS2b-27 

HpWS2b-28 

HpWS2b-29 

HpWS2b-30 

HpWS2b-31 

HpWS2b-32 

HpWS2b-33 

HpWS2b-34 

Figure 1. WSMV inoculation of hpWS2b T 1 transgenic family. Shown are 

the ELISA ratio at 14 dpi, symptom severity and plant height at booting 

stage. The asterisk shows which plants amplified both ends of the hairpin 

transgene. This family showed simple mendelian inheritance of the 

transgene cosegregating with the immunity. 


Characterising inositol signalling pathways in Phytophthora spp. for future 

development of selective antibiotics 

D. Phillips{ XE "Phillips, D." } 1 , D. Cahill 2 and P.L. Beech 1 

1 Centre for Cellular and Molecular Biology, Deakin University, Burwood Vic 3125 

2 Deakin University, Waurn Ponds Vic 3216 

Phytophthora is probably best known for causing the Irish potato 

famine of the 1840s, but this plant pathogen is not just an issue 

of history. Recent estimates show P.sojae to cause $1–2 billion in 

soy bean and $400 million in tomato crop losses p.a., and that 

P.infestans costs ~$290 million p.a. in management and losses of 

potato crops in the USA (e.g. 1). In Australia, P. cinnamomi is one 

of the greatest risks to our terrestrial ecosystems: it destroys 

numerous non‐arid habitats, having a wide host range of up to 

2500 plant species (2), and is thus considered a key threat under 

the Commonwealth Environmental Protection and Biodiversity 

Conservation Act 1999. Development of a control for 

Phytophthora spp. is critical to future sustainable agriculture and 

will be invaluable in maintaining numerous ecosystems in 

Australia and abroad. This project aims to directly target 

Phytophthora in the same manner used to develop the antiinfluenza 

drug, Relenza⎢(3) by identifying and solving the 

structure of a protein(s) unique to and critical for the survival of 

Phytophthora, we aim to provide the information required for 

future development of customised antibiotics. 

Only a handful of biological components are so critical to life that 

they are conserved throughout all organisms. For example, 

ribosomes are required for protein synthesis and as such are 

found in every living cell. So too, several signaling cascade 

enzymes appear to have been conserved across life; 

phospholipase C (PLC) is one such enzyme conserved from 

bacteria to humans and, just as the loss of ribosomes would be 

fatal, the loss of PLC would be catastrophic to the cell. How is it 

then, that plant pathogens of the genus Phytophthora do not 

have any recognizable PLC (4)? Phospholipase C is a transient 

membrane protein that, upon GTP activation, hydrolyses the 

phospholipid phosphoinositide bisphosphate (PIP 2 ) into the 

secondary messengers (1,4,5) inositol triphosphate (IP 3 ) and 

diacylglycerol (DAG), which inter alia activate protein kinase 

pathways, phospholipase D pathways and mediate rapid calcium 

release from the endoplasmic reticulum (5). 

We propose that PLC has been replaced by an alternative 

protein we call AltPLC. Existence of such an alternate protein 

would not only represent significant insight into the evolution of 

Phytophthora, but may indeed represent an ideal target for anti‐ 

Phytophthora antibiotics. 

We have approached the problem of identifying the AltPLC from 

three directions, utilising structural bioinformatics, differential 

proteomics, and biochemical analysis. 

METHODS 

Structural bioinformatics: We have identified all proteins within 

the P. sojae genome which bind to PIP 2 using Hidden Markov 

Models to search for patterns which convey the structure of 

Plekstrin homology domains –a structure known to specifically 

bind to PIP 2. This data set was then scrutinised by a number of 

domain‐architecture mapping and structural prediction 

algorithms. 

lipid‐regulating proteins to the membrane fragment. After 

washing the membrane, elution is achieved by removing Ca 2+ 

and allowing dissociation. Analysis of these fractions was 

performed by MS/MS and in vitro hydrolysis reactions. 

Biochemical analysis: IP 3 was isolated using the method of Lorke 

et al. (2004)(6) and analyzed by MDD‐HPLC (7). 

RESULTS 

Using MDD‐HPLC we have shown that P. cinnamomi does 

produce IP 3 endogenously and DAG in vitro by hydrolysis 

reactions with differentially isolated transient membrane protein 

fractions. This evidence supports our hypothesis of an 

alternative PLC in the Phytophthora genus. Using our 

combinatorial bioinformatics approach we have uncovered a 

single protein with all necessary structural components to 

perform PIP 2 hydrolysis. Furthermore, this protein is conserved 

among P. sojae P. ramourum and P. infestans and, as 

hypothesised, is unique to the Phytophthora genus. We have 

cloned and continue to isolate, recombinant AltPLC and its 

activator RAS protein for functional and structural analysis. 

although final correlation between PIP 2 hydrolysis and our 

putative AltPLC protein has yet to be achieved. Beyond the 

obvious development of novel control methods, identification of 

a phospholipase C protein of independent evolutionary origin is 

a unique and significant discovery that may ultimately aid in 

elucidating / refining the evolutionary origins of Phytophthora, 

and give us an insight into the process of independent 

convergence events in general terms. 

REFERENCES 

1. Tyler,B.M., Henkart,M. (2005) Genome information from plant 

destroyers could save trees, beans and chocolate. National science 

foundation 

press. 

http://www.nsf.gov/news/news_summ.jsp?cntn_id=107973&org= 

NSF&from=news 

2. Hardham, A. (2005) Phytophthora cinnamomi. Molecular Plant 

Pathology 6: 589–604 

3. Coleman,P,M., Hoyne,P,A., Lawrence,M,C. (1983) Sequence and 

structure alignment of paramyxovirus hemagglutininneuraminidase 

with influenza virus neuraminidase. Journal of 

Virology 67: 2972–2980 

4. Tyler BM. et al. (2006) Phytophthora genome sequences uncover 

evolutionary origins and mechanisms of pathogenesis. Science 313: 

1261–1266. 

5. Durrell,J. Sodd,M,A. Friedel,R.O. (1968) Acetylcholine stimulation of 

phosphodiesteratic cleavage of the guinea pig brain 

phosphoinositides. Journal of Life Science 7: 363–368 

6. Lorke DE. Gustke H, Mayr GW (2004) An Optimized Fixation and 

Extraction Technique for High Resolution of Inositol Phosphate 

Signals in Rodent Brain Neurochemical Research, Vol. 29, No. 10, 

pp. 1887–1896 

7. Mayr GW (1988) A novel metal‐dye detection system permits 

picomolar‐range h.p.l.c. analysis of inositol polyphosphates from 

non‐radioactively labelled cell or tissue specimens Biochem. J. 

(1988) 254, 585–591 


Differential proteomics: we have developed a method of 

isolating transient membrane proteins. This involves cracking the 

cells under high calcium and low temperature conditions, to bind 



INTRODUCTION 

Systemic acquired resistance—a new addition to the IPM clubroot toolbox? 

A. Agarwal A , E.C. Donald{ XE "Donald, E.C." } A , R. Faggian B , D.M. Cahill C , D. Lovelock C and I.J. Porter A 

A 

Department of Primary Industries Victoria, Private Bag 15, Ferntree Gully Delivery Centre, 3156, Victoria 

B 

Department of Primary Industries Victoria, 32 Lincoln Square Nth, Carlton, 3053, Victoria 

C Deakin University, School of Life and Environmental Sciences, Waurn Ponds Campus, Geelong, 3217, Victoria 

Clubroot caused by Plasmodiophora brassicae affects the 

Brassicaceae family of plants causing root galling, stunting and 

wilting of many important vegetable crops. There has been no 

‘silver bullet’ solution to clubroot but a number of ‘tools’ are 

available to manage the disease. Integrated use of these ‘tools’, 

including detection of P. brassicae and prediction of yield loss 

due to clubroot, identification and elimination of hygiene risks 

together with in‐field cultural methods, use of resistant varieties, 

manipulation of soil pH, calcium and boron amendment and 

strategic use of pesticides has been extremely effective in 

vegetable production systems (1). 

Figure 1. Arabidopsis plants 50 days after inoculation with P. brassicae. 

Plants on the right have been pretreated with salicylic acid to induce 

SAR. 

Microarray analysis conducted at the early time points during 

the infection process of P. brassicae in Arabidopsis (4, 7 and 10 

days after inoculation) identified a number of genes and 

pathways that may regulate disease expression in Arabidopsis 

(2). Manipulation of the salicylic acid (SA) signalling pathway may 

induce systemic acquired resistance (SAR), a state of heightened 

defensive capacity in plant species. This paper describes 

preliminary experiments to study the effect of SA as an inducer 

of SAR in Arabidopsis and broccoli, and assess the potential for 

SAR to be incorporated into the IPM ‘toolbox’ for clubroot 

management. 


A proof of concept study was conducted using Arabidopsis. 

Roots were treated with 0.5 mM SA for 1 minute and then 

inoculated with P. brassicae resting spores 4 hours after 

treatment. Plants were assessed for disease expression 50 days 


A broader range of SA dip rates (1–10 mM) and contact times 

were evaluated in order to induce SAR in broccoli. Plants were 

inoculated with a spore suspension of P. brassicae 24 hours after 

treatment and assessed for disease expression 6 weeks after 

inoculation. A real‐time reverse transcriptase quantitative PCR 

(RT‐qPCR) assay was developed to determine the expression of 

the chitinase gene in broccoli roots and leaves. Biochemical 

methods are also being developed to confirm SAR induction. 


Clubroot disease was strongly suppressed in salicylic acid treated 

Arabidopsis plants (Fig 1). Fifty days post‐inoculation SA treated 

plants had a much lower disease index and infection rate (DI=20, 

IR=50%) compared to untreated plants (DI=81.5, IR=100%). 

A 15 min root dip in 1 mM SA 24 hours before inoculation was 

the most effective method of SAR induction in broccoli. This 

treatment consistently increased expression of the chitinase 

gene by between 2.3 and 5.5 fold in roots and leaves confirming 

a systemic response. At concentrations in excess of 1 mM SA, 

changes in the expression of the chitinase gene were less 

consistent. Frequently these higher concentrations of SA caused 

a decrease in the expression of the chitinase gene. At the higher 

rates SA might not be translocated or it may alter the physiology 

of the plant. A similar result (ie. increased control only at the 

lowest rate 1 mM) was obtained from disease expression studies 

using broccoli (Fig 2). SA was phytotoxic to plants at 10 mM. 

Figure 2. Symptoms of clubroot on roots of broccoli plants 6 weeks after 

inoculation which occurred 24 hrs after treatment with SA (clockwise 

from top left 0, 1, 2.5 and 10 mM SA). Each image shows the range of 

symptoms in each treatment group. 

This is the first evidence that SAR induction may be a useful 

addition to the IPM clubroot ‘toolbox’. Work is ongoing to 

further optimise rates and timing of application of SA, to identify 

and evaluate other inducers and to extend the work to other 

pathogens. 




funds from the Australian Government. 

REFERENCES 

1. Donald C, Porter I (2009) Integrated control of clubroot. Journal of 

Plant Growth Regulation (In Press). doi: 10.1007/s00344‐009‐9094– 

7 

2. Agarwal A (2009) Interactions of Plasmodiophora brassicae with 

Arabidopsis thaliana. PhD thesis, Deakin University. 


Prevalence and pathogenicity of Botryosphaeria lutea isolated from grapevine 

nursery materials in New Zealand 

INTRODUCTION 

R.G. Billones{ XE "Billones, R.G." }, E.E. Jones, H.J. Ridgway and M.V. Jaspers 

Lincoln University, PO Box 84, Lincoln 7647, Canterbury, New Zealand 

Botryosphaeria species are considered important pathogens of 

grapevines worldwide; they are associated with dieback in 

mature vines and decline of young vines. They have been 

isolated from scion and rootstock canes in France and Spain (1, 

2). A 2008 survey of nine grapevine nurseries around New 

Zealand showed that 23% of the canes and grafted plants 

collected were infected with Botryosphaeria spp. From the 

isolates recovered, 59% were identified as B. lutea (unpublished 

data), making it the most important of the Botryosphaeria 

species to threaten New Zealand vineyards. 

This paper reports the distribution and prevalence of B. lutea in 

plant materials from different grapevine nurseries in New 

Zealand, as well as the variation between nurseries in 

pathogenicity of their isolates. 


Isolation and Identification of Botryosphaeria spp. from 

nursery plant materials. Plant materials comprising 5–15 

samples of each tissue type [apparently healthy grafted plants, 

failed grafted plants (or Grade 2 plants), scion and rootstock 

cuttings of different varieties] were collected from 9 grapevine 

nurseries from different climatic zones in New Zealand. 

Isolations were made from the surface‐sterilised plant samples, 

with 0.5 cm pieces cut from different parts of each sample 

placed onto potato dextrose agar with 0.5 g/L streptomycin 

sulphate (PDAS). Plates were incubated for 72 h and 

Botryosphaeria‐like colonies were subcultured onto prune 

extract agar (PEA) plates to induce sporulation. Isolates were 

later identified by conidial characteristics and by molecular 

methods. 

Pathogenicity Tests of B. lutea. Mycelium plugs from 4 day old 

B. lutea PDA cultures were inoculated onto the wounds created 

when the shoot tips were cut from rooted one‐year‐old 

Sauvignon blanc canes. Four rooted cuttings were used per 

isolate and control plants were inoculated with sterile agar. The 

inoculated plants were kept in the greenhouse for 28 days and 

then the bark peeled off so that the cane lesions could be 

measured. Re‐isolation onto PDAS was done with 1 cm sections 

of the canes that were cut from 0 to 5 cm beyond each lesion. 

The plates were incubated in the dark for 72 h at room 

temperature and assessed for characteristic growth of B. lutea. 

RESULTS 

Botryosphaeria lutea Prevalence and Distribution. B. lutea was 

isolated from seven of the nine nurseries sampled (Table 1). 

However, one of the two nurseries that were negative for B. 

lutea submitted only part of the sample types requested. The 

presence of B. lutea in different grapevine nurseries was 

statistically significant using the Pearson Chi‐square test 

(P


Infection and disease progression of Neofusicoccum luteum in grapevine plants 

INTRODUCTION 

N.T. Amponsah{ XE "Amponsah, N.T." }, E.E. Jones, H.J. Ridgway and M.V. Jaspers 

Department of Ecology, Faculty of Agriculture and Life Sciences, PO Box 84, Lincoln University, New Zealand 

Species of the Botryosphaeriaceae are major pathogens of 

grapevines worldwide that are frequently found to be associated 

with trunk and cane dieback, internal necrotic stem tissues and 

bud mortality (3). An accurate monitoring of disease progression 

is therefore important to evaluate disease susceptibility in 

grapevine plants. Although some fungi have evolved a variety of 

morphogenic strategies to enter plants using infection structures 

such as appressoria (2), the invasion of grapevine tissues by 

species of the Botryosphaeriaceae mostly occurs through 

wounds made by pruning or other injuries (unpublished data). 

Initial pathogenicity experiments indicated that shoots of the 

major grapevine cultivars grown in New Zealand were equally 

susceptible to infection, with Neofusicoccum luteum being the 

most prevalent and pathogenic species. The aim of this research 

was to investigate infection processes and the progression of N. 

luteum infection on grapevine leaves and shoots. 


Conidia of N. luteum were obtained by inducing their production 

on infected, green grapevine shoots (1). The conidial 

suspensions used for all inoculations were adjusted to a final 

concentration of 10 4 conidia/mL. The grapevine plants used were 

18 months old potted Pinot noir growing in a shade house. 

Wounding on leaves and shoots was done by scraping the 

surface layer of a tiny section (2–5 mm 2 ) with a sterile scalpel, 

after which a drop of the conidial suspension was applied onto 

both wounded and non wounded sections of attached or 

detached leaves and shoots. Controls were inoculated with 

sterile distilled water. There were six replicates for each type of 

inoculated site. 

The detached leaf and stem tissues were observed by SEM 24 h 

after inoculation. For the attached tissues, plants were grown for 

4 months and watered daily. Scanning electron microscopy 

(SEM) observation or pathogen re‐isolation was done on the 

leaves 24 to 72 h after inoculation and on the shoots at monthly 

intervals for 4 months. Pathogen re‐isolation from the shoots 

tissues were taken at 1 cm intervals below and above the 

inoculation point. 

RESULTS 

No infection occurred in any non wounded shoots or leaves 

(attached or detached); no fungal cultures characteristic of N. 

luteum were isolated from these tissues. The SEM observations 

of inoculation sites on the unwounded attached leaves revealed 

no conidia on the surfaces at 24 h after inoculation. However, on 

the surfaces of the attached (wounded) shoots and leaves, the 

conidia were observed to have germinated, with the germ tubes 

penetrating into the wounded tissue at 24 h after inoculations 

(Fig. 1A). On the detached (wounded) shoots and leaves, there 

were networks of mycelium at 24 h after the inoculations. Reisolation 

from these tissues yielded 100% N. luteum. 

Further SEM of the pathogen at 3 months after inoculation onto 

the wounded shoots showed long threads of mycelium growing 

in through the vessels (Fig 1B). Detection of pathogen movement 

by monthly re‐isolation at 1 cm intervals below and above the 

inoculation points showed pathogen progression increased with 

time, being greater in the upward than the downward direction 

(Fig. 2). 

A 

Figure 1. Development of N. luteum on wounded grapevine tissue (A) 

arrow shows conidia germinating on an attached leaf surface after 24 h, 

(B) mycelium growing through shoot xylem vessel 3 months after 

inoculations. 

Distance moved by 

pathogen (mm) 

70 

60 

50 

40 

30 

20 

10 

0 

-10 

-20 

Upwards 

Downwards 

Jan-08 Feb-08 Mar-08 Apr-08 

Dates on which pathogen was assessed 

Figure 2. Recovery of N. luteum from tissue above and below wounded 

inoculation sites of 18 months old Pinot noir grapevines. 

DISCUSSION 

No infection by N. luteum conidia was seen on non wounded 

tissue and no conidia were observed at 24 h after the 

inoculations on non wounded (attached) leaf surfaces. This 

suggests that the conidia could not attach to the surfaces and 

were lost from them. The faster development of germinating 

conidia on the attached shoots and leaf surfaces (wounded) than 

on the detached tissues at 24 hr after infection could be due to 

active inhibitory plant‐pathogen interactions. This may also 

explain why plants under water stress had enhanced 

susceptibility to infection. In stems of 18 months old vines, 

movement of the pathogen was faster in the upward than 

downward direction, possibly because it followed xylem flow, 

SEM observations showed pathogen presence in xylem vessels, 

which may allow for the non‐symptomatic progression 

previously observed (unpublished data) 


The authors gratefully acknowledge funding from the New 

Zealand Winegrowers Inc. 

REFERENCES 

1. Amponsah N.T, Jones E.E, Ridgway, H.J, and Jaspers MV (2008). 

Production of Botryosphaeria species conidia using grapevine green 

shoots. New Zealand Plant Protection, 61, 301–305 

2. Egan M.J and Talbot N.J (2008). Genomes, free radicals and plant 

cell invasion: recent developments in plant pathogenic fungi. 

Current Opinion in Plant Biology, 11(4), 367–372. 

3. Phillips A. J. L. (1998). Botryosphaeria dothidea and other fungi 

associated with excoriose and dieback of grapevines in Portugal. 

Journal of Phytopathology 146, 327–332. 

B 


Carbohydrate stress increases susceptibility of grapevines to Cylindrocarpon black 

foot disease 

INTRODUCTION 

D.S. Dore{ XE "Dore, D.S." }, E.E. Jones, H.J. Ridgway and M.V. Jaspers 

Agriculture and Life Sciences Faculty, Lincoln University 7647, Canterbury, New Zealand 

Stress can predispose woody plants to pathogen infection, 

increasing both disease incidence and severity (1). Defoliation by 

means of leaf plucking can stress a plant by decreasing the 

availability and concentration of photosynthate, compromising 

its resistance to other biotic and abiotic stresses (2). This 

experiment investigated the effect of carbohydrate stress, as 

induced by leaf plucking of grapevines, on the disease severity 

and incidence of black foot disease, a serious threat to vineyards 

around the world. This disease is caused by Cylindrocarpon 

species including C. destructans, C. macrodidymum, and C. 

liriodendri (3). 


Plants (1 year old) of Sauvignon Blanc scion wood grafted to 

rootstocks 101–14 or Schwarzmann (ten per treatment), were 

grown in a 50/50 mix of vineyard soil and potting mix. Pots were 

laid out in a completely randomised design in a greenhouse in 

September 2006. Leaves were plucked (Nov 2006) from scion 

shoots above the fourth node, to induce three different levels of 

carbohydrate stress, being none (level 0; no removal), moderate 

(level 1; every third leaf removed) and high (level 2; every third 

leaf was left). Plucking treatments were performed three times 

at three weeks apart on new shoot growth and then the root 

systems of all the vines were wounded by slicing down into the 

soil, four times around each plant. For each stress level, half the 

plants were inoculated with 50 mL (per plant) of a mixed (three 

C. destructans isolates) conidial suspension (10 6 /mL) poured 

over the soil surface followed by 50 mL of tap water. The 

remaining plants were treated with 100 mL of tap water. 

varieties, 101–14 (19.2 g) and Schwarzmann (16.8 g), which 

responded differently to stress (P=0.062), being 17.9 g and 13.2 

g, respectively in the highly stressed treatment. There was no 

significant effect of carbohydrate stress (P=0.259) or inoculation 

(P=0.885) on shoot dry weight 

Table 1. Effects of the three carbohydrate stress treatments (analysis a), 

and two stress treatments (0+1 compared with 2; analysis b) on C. 

destructans disease severity (% infected wood pieces) of grapevines. 

Data are combined averages for inoculated and uninoculated plants for 

two rootstock varieties. 

Stress level * 

0:none 7.15 

1:moderate 8.15 

Disease 

severity Stress level ** 

Disease 

severity 

0 + 1 7.60 

2:high 19.65 2 19.65 

P value P=0.138 P=0.043 

*Analysis a 

**Analysis b 

DISCUSSION 

This study showed that carbohydrate stress caused by leaf 

plucking significantly increased the severity of black foot disease 

and decreased root dry weight. There was also some indication, 

although not significant, that Schwarzmann was more affected 

by carbohydrate stress than 101–14. These results are relevant 

to the industry since canopy thinning is a regular practice in the 

vineyard. Hunter et al. (4) reported that no negative effects were 

thought to be associated with the practice; however, in light of 

these results care should be taken with deciding the intensity of 

canopy thinning in areas at risk to Cylindrocarpon infection. 


Plants were grown for a further six months prior to assessment. 

Root and shoot dry weights were recorded and isolations made 

by plating sections of surface sterilised trunk tissue onto potato 

dextrose agar. Plates were incubated at 20˚C for 7 d and 

assessed for the presence of C. destructans colonies (3). 

RESULTS 

Cylindrocarpon destructans disease severity and incidence was 

similar for both Schwarzmann (8.4% and 29.3%, respectively) 

and 101–14 rootstocks (14.9% and 31.0%, respectively). 

Although not significant, the highest disease severity was seen 

with high carbohydrate stress compared with moderate or no 

stress (Table 1). However, when data for the moderate and no 

stress treatments were combined (because the effects were 

similar), the disease severity was significantly higher for the 

highly stressed plants (P=0.043). Stress did not influence disease 

incidence (P=0.551). Infection also occurred in the un‐inoculated 

plants, due to the soil being infested by Cylindrocarpon spp., but 

disease severity was higher in the plants inoculated with C. 

destructans (40.5%) than those that were not (19.5%). 


New Zealand Winegrowers and Lincoln University for funding 

this project. 

REFERENCES 

1. Schoeneweiss DF (1981) The role of environmental stress in 

diseases of woody plants. Plant Disease 65, 308–314 

2. Marcais B, Breda N (2006) Role of an opportunistic pathogen in the 

decline of stressed oak trees. Journal of Ecology 94, 1214–1223 

3. Halleen F, Schroers HJ, Groenwald JZ, Crous PW (2004) Novel 

species of Cylindrocarpon (Neonectria) and Campylocarpon gen. 

nov. associated with black foot disease of grapevines (Vitis spp.). 

Studies in Mycology 50, 431–455 

4. Hunter JJ, Ruffner HP, Volschenk CG, Le Roux DJ (1995) Partial 

defoliation of Vitis vinifera L. cv. Carbernet Sauvignon/99 Richter: 

Effect on root growth, canopy efficiency, grape composition and 

wine quality. American Journal of Enology and Viticulture 46, 306– 

314. 

Root dry weights were similar in inoculated and uninoculated 

plants, but were significantly lower for highly stressed plants 

(15.6 g) than both the moderately stressed (19.9 g; P=0.000) and 

unstressed plants (18.5 g; P=0.003). An interaction between 

inoculation and stress (P=0.031) showed that inoculated and 

highly stressed plants had the lowest root dry weight (14.9 g). 

Root dry weights differed (P=0.0001) between the rootstock 



Botryosphaeria spp. associated with bunch rot of grapevines in south‐eastern 

Australia 

N. Wunderlich{ XE "Wunderlich, N." } A , G.J. Ash A , C.C. Steel A , H. Raman B and S. Savocchia A 

A National Wine and Grape Industry Centre, School of Agricultural and Wine Sciences, Charles Sturt University, Locked Bag 588, Wagga 

Wagga, 2678, NSW 

B New South Wales Department of Primary Industries, Private Mail Bag, Wagga Wagga, 2650, NSW 

INTRODUCTION 

Species of Botryosphaeria are common wood pathogens of 

grapevines and are responsible for the disease known as ‘Bot 

canker’ (1). Recently some species have also been implicated in 

bunch rot of Vitis vinifera in Australia (2). While pathogenicity 

tests have been conducted on grapevine wood for several 

species, it is unknown which of these infect bunches and how 

they enter the berry. 


Plant survey. Between 2007 and 2009 two vineyards in the 

lower Hunter Valley, NSW, were sampled for species of 

Botryosphaeria. Samples were collected from 200 each of 

Chardonnay and Shiraz grapevines symptomatic of Bot canker at 

different phenological stages: dormant buds (B), flowers (F), peasized 

berries (P) and berries at harvest (H). Samples were also 

collected from the margin of healthy and discoloured internal 

wood (W) from the trunks of each plant. 

Fungal isolation and identification. Samples were surface 

sterilised, placed onto Potato Dextrose Agar (PDA) amended 

with Streptomycin Sulfate and incubated at 25ºC in the dark. 

Fungal cultures characteristic of Botryosphaeria spp. were subcultured 

onto PDA and/or triple autoclaved pine needles on 1% 

water agar maintained under near UV light (12hr light/dark) to 

encourage sporulation. Botryosphaeria spp. were identified 

according to spore morphology and sequencing of the rDNA 

internal transcribed spacer region. 

Pathogenicity tests on berries. Disease‐free, surface sterilised 

Shiraz and Chardonnay berries at harvest were inoculated with 

10 μL spore suspensions from 19 isolates belonging to the 

species listed in table 1. Conidial suspensions at concentrations 

of 10 6 and 10 4 spores/mL were used in trial 1 and 2, respectively. 

Control berries were inoculated with 10 μL of sterile distilled 

water. The berries were incubated in 24 well plates at 27ºC in 

the dark for 15 days. A constant relative humidity was 

maintained by the addition of 20 mL of sterile water to each 

plate. Disease incidence (%) and severity (1–10) was recorded for 

each treatment. A disease index (DI) was calculated for each 

treatment replicate at each time of recording: 

DI = ∑diseased berries ÷ ∑total berries X ∑disease severity 

scores ÷ sum max disease severity scores. 

mutila and Lasiodiplodia theobromae. Abundance and origin of 

each species are listed in Table 1. 

Table 1. Botryosphaeria spp. isolated from grapevine tissue. 

Species 

Origin tissue 

B F P H W 

D. seriata 83 2 3 6 27 

B. dothidea 15 0 0 3 7 

N. parvum 7 1 0 2 4 

N. luteum 3 0 0 2 2 

D. viticola 3 0 0 0 2 

D. mutila 0 0 0 0 4 

L. theobromae 0 0 0 0 1 

Pathogenicity tests All isolates produced bunch rot symptoms 

on berries including the formation of mycelia and pycnidia, 

darkening of the berry skin, oozing and berry collapse. Disease 

indices for each replicate treatment varied significantly from 

control berries. Variation in the rate of increase of the disease 

index was detected within and between species. Inoculation of 

canes showed lesion development and pycnidia formation on 

the cane surface. There were significant variations in lesion 

lengths between species. In both berry and cane pathogenicity 

tests, virulence appeared to be independent from the origin of 

the isolate. 

DISCUSSION 

Results suggest that Botryosphaeria spp. have the potential to 

contribute to grapevine bunch rots and infect grapevine canes. 

Botryosphaeria spp. appear to be non‐tissue specific in their 

pathogenicity toward grapevine. Trials are in progress to 

establish if these results can be reproduced under field 

conditions and whether the infection of buds or flowers by 

Botryosphaeria results in bunch rot at harvest. 


The authors would like to thank Chris Haywood for assistance 

with field sampling and the growers for access to their vineyards. 

This work was supported by a National Wine and Grape Industry 

Centre (NWGIC) Scholarship and through the Wine Growing 

Futures program, a joint initiative of the Grape and Wine 

Research and Development Corporation and the NWGIC. 

Pathogenicity tests on canes. Detached one year old canes were 

inoculated with 4 mm diameter mycelium plugs of 14 

Botryosphaeria isolates, previously tested on berries, by 

inserting the plugs into the wood. Canes were incubated on 

moist filter paper in Petri dishes at 27ºC in the dark. After 15 

days, lesion lengths were measured for each isolate. 

RESULTS 

Survey and fungal identification. To date, a collection of 177 

isolates of Botryosphaeria spp. has been established. The species 

isolated included Diplodia seriata, Botryosphaeria dothidea, 

Neofusicoccum parvum, N. luteum, Dothiorella viticola, Diplodia 

REFERENCES 

1. Savocchia S, Steel CC, Stodart, BJ, Somers A (2007). Pathogenicity 

of Botryosphaeria species isolated from declining grapevines in 

sub‐tropical regions of eastern Australia. Vitis 46, 27–32. 

2. Taylor AS (2007) ‘Scoping study on the non‐Botrytis bunch rots that 

occur in Western Australia’. Grape and Wine Research 

Development Corporation Final Report RT 05/05‐2. 


Honey bees—do they aid the dispersal of Alternaria radicina in carrot seed crops? 

INTRODUCTION 

R.S. Trivedi{ XE "Trivedi, R.S." } 1 , J.G. Hampton 1 , M.V. Jaspers 2 , J.M. Townshend 3 and H.J. Ridgway 2 

1 Bio‐Protection Research Centre, PO Box 84, Lincoln University, Canterbury, New Zealand 

2 Department of Ecology, PO Box 84, Lincoln University, Canterbury, New Zealand 

3 Midlands Seed Ltd, PO Box 65, Ashburton, Canterbury, New Zealand 

A. radicina is a seed and soil‐borne pathogen of carrot (Daucus 

carotae) crops now common in Canterbury, New Zealand. A. 

radicina causes black rot disease, but can also reduce seed 

germination and seedling establishment. For carrot seed 

production, honey bees (Apis mellifera) are introduced into the 

crop to improve pollination. During this process, if bees visit A. 

radicina infected umbels and pathogen spores adhere to them, 

they may disperse the pathogen within the crop. 


To test this hypothesis, both live and dead bees were collected 

from around beehives that had been placed in three seed crops 

in the Ashburton region, Canterbury, NZ. Fifty bees were 

selected at random, placed in 100 ml sterile distilled water in a 

250 ml bottle and shaken using a Wrist action shaker (Griffin) at 

maximum speed (1000 rpm) for 15 min to dislodge any spores 

on the cadavers. The suspension was filtered using sterile 

Whatman paper No. 105 and the filtrate centrifuged in 50 ml 

tube at 4000 rpm for 5 min. The supernatant was discarded, the 

pellet reconstituted in 100 µl water and plated on A. radicina 

semi selective agar and incubated at 27°C. After 7 d fungi 

growing on these plates were isolated into pure culture. The 

isolated fungi were identified by morphological, cultural and 

sporulation characteristics. To confirm those cultures 

preliminarily identified as A. radicina, the fungal DNA was 

obtained using Puregene® DNA purification kit protocol. The 

universal primers ITS 4 and ITS 5 were used to amplify a portion 

of the rDNA. For each PCR reaction 1 µl of DNA (10 ng/μl) was 

mixed with 24 µl of PCR mixture containing the manufacturer’s 

buffer, 200 µM of each dNTP, 1.5 mM MgCl 2 , 5 pmol of each 

primer, 1.25 U Faststart Taq (Roche). A negative control without 

DNA template was also included. Amplification was done using a 

Mastercycler® Gradient (Eppendorf, USA) using the following 

thermal cycles: initial denaturation at 94°C for 3 min then 35 

cycles of: denaturation at 94°C for 2 min, annealing at 57°C for 

30 s and extension at 72°C for 1 min for 35 cycles following final 

extension at 72°C for 10 min and hold at 4°C. The PCR product 

was separated by electrophoresis on a 1% agarose gel in 1X TAE 

buffer and visualised using ethidium bromide dye under UV light 

(Versadoc Imaging Systems Model‐3000; Bio‐Rad, USA). The PCR 

product was sequenced in 3130 xl genetic analyser (ABI Prism, 

Applied Biosystems) and the obtained sequence of the rDNA was 

then compared with sequences present on GenBank 

(http://www.ncbi.nlm.nih.gov/) using a Blast search to confirm 

its identity. 

RESULTS 

In addition to A. radicina, a few other fungal colonies were also 

grown on selective agar medium. Honey bees from different 

carrot fields carried different amounts of inoculum of A. radicina 

on their bodies. The average numbers of colonies recovered 

from 50 bees were ~166 and spore per bee ratio was 3.3:1. The 

electrophoresis resulted in a single band of ~600 bp on the 

agarose gel (Fig 1). The DNA sequence obtained from this band 

was confirmed using Blast as A. radicina. The sequence had 

maximum similarity (100%) with accession numbers AY154704.1, 

DQ394073.1 and EU807870.1. The sequence from the honey bee 

(597 bp) was deposited in GenBank as accession number 

FJ958190. 

2000 bp‐ 

1000 bp‐ 

650 bp‐ 

Figure 1. Agarose gel electrophoresis of the amplified rDNA region of A. 

radicina colonies recovered from honey bee bodies collected from three 

infected fields. Lane M contains 1 kb plus DNA ladder (Invitrogen); lane 

1, negative control; lane 2, infected site A; lane 3 infected site B; lane 4, 

infected site C. 

DISCUSSION 

The detection of A. radicina conidia (38 x 19 µm in size) on the 

body of honey bees suggests that they have the potential to play 

a role in the spread of the disease within and among the carrot 

seed crops. This research supports that of many past researchers 

that concluded some other insects and mollusc, like flea beetles 

(1) and slugs (2) in cabbage and, pollen beetles and seed pod 

weevil (3) in oil rape were able to play an important role in 

dispersal of Alternaria spp. Future work is now focused on 

quantification of A. radicina through real time PCR and the 

identification of other fungal species carried on the body of 

honey bees. 


The Foundation for Research Science and Technology and 

Midlands Seed Ltd funded this research. 

REFERENCES 

M 1 2 3 4 

1. Dillard, H.R., Cobb, A.C. & Lamboy, J.S. 1998. Transmission of 

Alternaria brassicicola to cabbage by flea beetles (Phyllotreta 

cruciferea). Plant Disease 82: 153–157. 

2. Hasan, S. & Vago, C. 1966. Transmission of Alternaria brassicicola 

by slugs. Plant Disease Reporter. 50:764–767. 

3. Quak, F. 1956. De biologie en de bestrijdingsmogelikheden van de 

veroorzakers van spikkelziekte (Alternaria sp.) in Koolzaad 

(Brassicae napus) In Alternaria brassicicola and Xanthomonas 

Campestris pv. Campestris in organic seed production of Brassicae: 

Epidemiology and seed infection. Plant Research International, 

Wageningen. 




Translating research into the field: meta‐analysis of field pea blackspot severity and 

yield loss to extend model application for disease management in Western Australia 

INTRODUCTION 

M.U. Salam{ XE "Salam, M.U." } A , J. Galloway A , W.J. MacLeod B , M. Seymour A , I. Pritchard A , M.J. Barbetti A,B and T. Maling A 

A 

Department of Agriculture and Food Western Australia, Locked Bag 4, Bentley Delivery Centre WA 6983, Australia 

B School of Plant Biology, The University of Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia 

Blackspot or ascochyta blight, caused predominantly by 

Mycosphaerella pinodes, is the most destructive foliar pathogen 

of field peas and causes considerable yield loss. The amount of 

yield loss is mainly driven by primary infection, i.e. spread of 

wind‐borne ascospores from infected pea stubble of previous 

seasons’ crops. In this paper, we present a meta‐analysis to 

show observed disease severity and associated yield loss in 

Western Australia (WA), explore the feasibility of chemical 

control, and describe the development and application of a 

weather‐based model to manage the disease. 


The meta‐analysis, using different forms of regressions, was 

done using data from 14 experiments conducted at 13 sites over 

8 seasons in WA. The model, “Blackspot Manager” was 

developed using daily weather data to predict the timing of 

onset, and progression, of ascospore maturity (Salam et al., 

2006). The model was tested with independent field data from 

agricultural regions in WA. A system was developed to provide 

model output to the agribusiness community and farmers via 

internet (http://www.agric.wa.gov.au/cropdiseases). 

RESULTS 

Potential blackspot severity decreases as the season progresses 

and can be quantified as a function of time of sowing (results not 

shown). Under the “No control” scenario, the potential disease 

severity remains above rating 2 until early July (Fig. 1); however, 

it varies between regions (data not shown). Application of an infurrow 

fungicide cannot decrease the severity below rating 2 

before mid‐June; and fortnightly sprays not before mid‐May. 

growing season. Disease severity rating does not exceed 2 until 

crop has been exposed to more than predicted 40% of seasonal 

ascospores (Fig. 3). 

Potential yield reduction (%) 

60 

45 

30 

15 

0 

0 1 2 3 4 5 

Disease severity 

Figure 2. Relationship between blackspot disease severity ratings and 

potential yield reduction in field pea. 

Blackspot severity 

5 

4 

3 

2 

1 

0 

0 10 20 30 40 50 60 70 80 90 100 

Predicted exposed ascospore-load 

(% of seasonal total) 

No control 

In-furrow fingicide 

Fortnightly spray 

No control (fitted) 

In-furrow fingicide (fitted) 

Fortnightly spray (fitted) 

Figure 3. Relationship between predicted exposures to ascospores from 

infected stubble and disease severity rating at flowering on standing field 

pea crops. 

Disease severity 

5 

4 

3 

2 

1 

CONCLUSION 

This research shows that chemical control for blackspot 

management is unlikely to be economical. Consequently, 

growers must rely of appropriate sowing dates. The outcome of 

this work is a model that predicts the temporal ascospore‐load 

and allows for the determination a sowing date that minimises 

potential yield loss. 

0 

27-Apr 14-May 31-May 17-Jun 4-Jul 21-Jul 

Time of sowing 

Figure 1. Fitted curves of potential severity of blackspot disease on field 

pea across WA in response to no control, in‐furrow fungicide or 

fortnightly fungicide spray. 

Potential yield reduction does not occur before disease severity 

rating 1 (Fig. 2). At disease severity rating 2, it reaches around 

15%, whereas, the maximum rating of 5 corresponded to a 

potential yield reduction of around 55%. 


We thank the Australian Grains Research and Development 

Corporation (GRDC) the Department of Agriculture and Food 

Western Australia for supporting this research. 

REFERENCES 

1. Salam, M.U., Galloway, J., MacLeod, W.J. and Diggle, A. (2006) 

Development and use of computer models for managing ascochyta 

diseases in pulses in Western Australia. 1st International ascochyta 

workshop on grain legumes. 2–6 July, 2006, Le Tronchet, France. 

The Blackspot Manager uses the pre‐season temperature and 

rainfall to forecast the onset and progression of ascospore 

release from infected field pea stubble prior to and during the 


Development of a model to predict spread of exotic wind and rain borne fungal pests 

INTRODUCTION 

S.A. Coventry A , J.A. Davidson B , M. Salam{ XE "Salam, M." } C and E.S. Scott A 

CRC for National Plant Biosecurity, FECCA House, 4 Phipps Close, Deakin, 2600, ACT 

A School of Agriculture, Food and Wine, The University of Adelaide, PMB1, Glen Osmond, 5064, South Australia 

B South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001, South Australia 

C Department of Agriculture and Food Western Australia, PO Box 483, Northam, 6401, Western Australia 

Exotic fungal plant pathogens pose a threat to Australian 

agriculture. Some of the most devastating fungal pathogens are 

transported by rain splash, wind dispersal or a combination of 

both. The transport of fungal pathogens via rain and wind makes 

containment and eradication difficult. Ascochyta rabiei, causal 

agent of ascochyta blight of chickpea, is a wind/rain borne 

pathogen already present in Australia. A. rabiei, therefore, 

provides a suitable pathogen for modelling the potential spread 

of an exotic fungal pathogen dispersed by wind and rain. 


Field trials and laboratory studies were conducted to examine 

key environmental factors influencing the short distance (rain 

splashed) and long distance (wind borne) distribution of spores. 

Field trials. were undertaken at Kingsford Research Station, 

53 km north‐east of Adelaide in 2007 (S 34.54521, E 138. 78117), 

and at Turretfield Research Station, approximately 60 km northeast 

of Adelaide in 2008 (S 34.54760, E 138.82225). Plots (11 x 

11 m) at each site were planted with 3 cultivars of chickpea; 

Howzat (moderately susceptible), Almaz (moderately resistant) 

and Genesis 090 (resistant) (Figure 1). Infested stubble was 

placed at the centre of each plot and disease spread was 

recorded weekly. The percentage of plants infected in 1 m 2 

quadrats and the number of growing points (number of main 

stems and branches) for three plants of each cultivar were 

recorded over time. Weather data were collected via an 

automated weather observation system at the Roseworthy, 

within 13 km of the field sites. 

Almaz 

(mr) 

Genesis 

Howzat 

(ms) 

parameters. The adjusted parameters produced a model output 

in Mathematica that best fit field disease observations. 

RESULTS 

The model. For (a) number of growing points (Figure 2) collected 

from the 2007 field experiments and (b) spore dispersal in wind 

and rain tunnel experiments were used as parameter inputs for 

the model. Plant infection data from the 2007 field experiments 

were compared and calibrated with simulations run in the 

model. Data for disease incidence and severity in the 2008 field 

trial were then used to validate the model. 

Growing points (m -2 ) 

6000 

5000 

4000 

3000 

2000 

1000 

0 

Gp (model) 

Gp (observation-Howzat) 

0 500 1000 1500 2000 

Growing degree-days 

Figure 2. Growing points (Gp, main stems and branches) influenced by 

degree days as predicted by the model and compared to field 

observations in chickpea cv. Howzat at Kingsford 2007. 

DISCUSSION 

The outcome of this work is a model calibrated with 

experimental data and tested with field observations for 

accuracy. Weather data are entered into the model and 

pathogen spread is predicted by graphical output showing 

disease occurrence in the field. The number of conidia produced 

per lesion on each of the cultivars will be estimated, to add more 

information to the model. When fully developed, the model will 

provide a basis for predictive models for exotic plant pathogens. 

It will also facilitate improved management of disease through 

forecasting, and more precise application of fungicide and timing 

of crop sowing. 


Figure 1. Aerial photograph of 11 x 11‐m chickpea plots at Turretfield in 

2008. Top, Almaz with moderate disease incidence; middle, Genesis 090 

with no disease; bottom, Howzat with severe disease. 

Laboratory experiments. were conducted to investigate the 

effect of wind speed (m/s), rain splash (ml/m) and a combination 

of the two factors on the dispersal of conidia in a purpose‐built 

wind and rain tunnel. 

Model development. A model for determining the spread of rain 

and wind‐borne pathogens was developed for ascochyta blight 

based on the spatiotemporal model for simulating the spread of 

anthracnose in lupin fields (1). The data collected from the field 

trials and laboratory experiments were entered as the model 


We thank the CRC for National Plant Biosecurity, the University 

of Adelaide, South Australian Research and Development 

Institute, and Department of Agriculture and Food Western 

Australia for supporting this research. 

REFERENCES 

1. Diggle, A., Salam, M., Thomas, G., Yang, H., O’Connell, M. & 

Sweetingham, M. (2002) AnthracnoseTracer: A Spatiotemporal 

Model for Simulating the Spread of Anthracnose in a Lupin Field. 

Phytopathology, 92, 1110–1121. 



Psyllid transmission of huanglongbing from naturally infected Shogun mandarin to 

orange jasmine 

INTRODUCTION 

R. Sdoodee{ XE "Sdoodee, R." } A , W. Teeragulpisut A and P. Tippeng A 

A 

Department of Pest Management, Faculty of Natural Resources, Prince of Songkla University, Hat Yai, Thailand 90112 

Huanglongbing (HLB), previously known as citrus greening is a 

devastating disease of citrus. It affects all citrus cultivars and 

causes rapid decline of trees. HLB is caused by a phloem limited 

fastidious bacterium, Candidatus Liberibacter a gram negative 

bacterium belonging to alpha proteabacteria (1). At least 3 

species of Candidatus Liberibacter have been reported to be 

associated with HLB, Ca. L. africanus, Ca. L. asiaticus, and Ca. L. 

americanus. The two Ca. Liberibacter species, africanus and 

asiaticus, are transmitted by the psyllid vectors Trioza erytreae 

(Del Guercio) in Africa and Diaphorina citri (Kuwayama) in Asia, 

respectively. 

Candidatus Liberibacter can infect nearly all citrus species, 

cultivars and hybrids. Later, orange jasmine, Murraya paniculata 

(L.) Jack and Chinese box orange, Severnia buxifolia (Poiret) 

Men., have been reported to harbor HLB pathogen (2, 3). 

This paper reported transmission of Ca. L. asiaticus, Asian form 

HLB, by its psyllid vector, D. citri from naturally infected Shogun 

mandarin, Citrus reticulata Blanco, to orange jasmine (M. 

paniculata). 


Insect vector. Adults of disease free D. citri were caged on 

naturally infected Shogun mandarins grown at Prince of Songkla 

university experimental plot for one month. The vectors were 

then used in transmission test. 

Transmission test. The insect vectors were released to feed on 

healthy M. paniculata seedlings (test plants) using 0, 1 and 15 

insects per test plant. Healthy test plants were also placed under 

infected Shogun mandarin trees to obtain natural transmission. 

Detection of HLB pathogen. Total DNA of M. paniculata plant 

was extracted from 0.1–0.5 g of leaf midribs using CTAB method 

(3). PCR detection of Ca. Liberibacter asiaticus, HLB pathogen, 

was carried out with primers specific to 16S rRNA gene of Asian 

HLB (1). 


D. citri successfully transmitted HLB pathogen from the naturally 

infected shogun mandarin to M. paniculata even by single insect 

vector (Table 1). Transmission occurred within 7 and 9 weeks 

after released the insect vector on M. paniculata test plant using 

1 and 15 insects, respectively. For natural transmission (NT, 

placing test plants under diseased mandarin tree), test plant 

became infected within 28 weeks. Single insect transmission rate 

was as high as by 15 insects (50%) but it was slightly lower than 

the natural transmission (75%). All of HLB infected M. paniculata 

by insect vector showed typical symptom (Fig 1) resembling HLB 

infected citrus (3). HLB pathogen as tested by PCR remained in 

infected M. paniculata with typical symptom more than 30 

weeks which was contrast to a previous report (4). 

Table 1. Transmission of HLB pathogen (Ca. L.asiaticus) by D. citri insect 

vector. 

No. of insect 1 

No. of transmission 

/total test plant 2 

Transmission rate 

(%) 

0 0/4 0 

1 2/4 50 

15 2/4 50 

NT 3/4 75 

1 Number of D. citri insect vector feeding on one test plant (healthy Murraya 

paniculata), NT (natural transmission), healthy test plant placed under infected 

shogun mandarin. 

2 Transmission determined by HLB symptom on test plant and followed by PCR 

amplification of HLB DNA. 

A 

Figure 1. Infected Murraya paniculata showing typical HLB symptoms 

(interveinal chlorosis and blochy mottle leaves) 

A by single Diaphorina citri insect vector 

B by 15 insect vectors 

C by natural transmission 


We wish to thank Thailand Research Fund (TRF) and Nakajima 

Peace Foundation for financial support and also to Department 

of Pest Management, Faculty of Natural Resources, Prince of 

Songkla University, for providing laboratory facilities. 

REFERENCE 

1. Jagoueix S, Bove JM, Garnier M (1996) PCR detection of two 

Liberibacter associated with greening disease of citrus. Molecular 

and Cellular Probes 10, 43–50. 

2. Hung TH, Wu ML, Su HJ (2000) Identification of the alternative host 

of the fastidious bacteria causing citrus greening disease. Journal of 

Phytopathology 148, 321–326. 

3. Sdoodee R, Tothaum P, Jumpaduang A (2008) PCR detection of 

Candidatus Liberibacter asiaticus from Murraya paniculata and 

psyllid vector in Thailand. Journal of Plant Pathology 90 (2, 

supplement) S2.450. 

4. Li T, Ke C, (2002) Detection of the bearing rate of Liberibacter 

asiaticum, in citrus psylla and its host plant Murraya paniculata by 

nested PCR. Acta Phytophylacica Sinica 29, 31–35. 

B 

C 


Transmission of ‘Candidatus Phytoplasma australiense’ to Cordyline and Coprosma 

INTRODUCTION 

R.E. Beever{ XE "Beever, R.E." } A , M.T. Andersen B and C.J. Winks A 

A Landcare Research, Private Bag 92170, Auckland 1142, New Zealand 

B Plant and Food Research, Private Bag 92169, Auckland 1142, New Zealand 

Phytoplasmas are specialised plant pathogenic bacteria (class 

Mollicutes) that live in the phloem tissue of host plants and in 

the tissues of phloem‐feeding insects that transmit them. The 

phytoplasma “Candidatus Phytoplasma australiense” is 

associated in New Zealand with diseases of three naturally 

occurring host species, New Zealand flax, (Phormium tenax, 

family Phormiaceae), New Zealand cabbage tree (Cordyline 

australis, family Laxmanniaceae), and karamū (Coprosma 

robusta, family Rubiaceae), as well as one cultivated host, 

strawberry (Fragaria x ananassa, family Rosaceae). Previous 

work (4, 5) has established that “Ca. P. australiense” can be 

transmitted from Phormium to Phormium by the New Zealand 

flax planthopper Zeoliarus (Oliarus) atkinsoni (family Cixiidae). In 

this study, we have identified that a second species in this genus, 

Zeoliarus oppositus, acts as a vector between two of the 

naturally occurring hosts. 

Table 1. Phytoplasma detection in tissue samples from symptomatic 

cabbage trees. 

Plant 

Days after 

insects 

caged 

Shoot 

apex 

Leaf 

bases 

Ca7 89 + not + 

tested 

Ca2 131 + + + 

Ca1 164 ‐ + ‐ 

Ca9 196 + + ‐ 

Rhizome 

apex 

DISCUSSION 

We conclude that Z. oppositus is a vector of “Ca. P. australiense”, 

capable of transmitting this phytoplasma from Coprosma to both 

Cordyline and Coprosma. 

Session 4D—Prokaryotic pathogens 


Small saplings of Cordyline australis and Coprosma robusta were 

grown from seed. Z. oppositus adults were collected from the 

wild by ‘beating’ symptomatic and non‐symptomatic plants of C. 

robusta. Transmission experiments were set up by caging 10 

individuals of Z. oppositus onto seedlings of the test species (10 

replicates). 

DNA was extracted from various plant tissues and whole insects. 

Phytoplasma presence in insects and plant samples was 

examined by one stage and nested PCR using the “universal” 

phytoplasma 16S primers (P1+P7, R16F2 + R16R2) (1). 

RESULTS 

Insect donors. Zeoliarus oppositus adults collected from the 

donor population in early summer were examined for the 

presence of phytoplasma using one stage PCR. A total of 4 were 

positive from 33 individuals examined, indicating an infection 

rate of c. 12%. Other adults were caged onto Cordyline and 

Coprosma seedlings. Over 60% were still alive on removal at 3–4 

weeks. 

Cabbage tree. Four of the ten plants exposed to Z. oppositus 

developed symptoms within one year. Symptoms closely 

resembled those of ‘initially‐affected’ tufts of diseased trees 

observed in the field (1). At least one of the tissue samples from 

all 4 symptomatic plants were positive using one stage PCR 

(Table 1). 

Karamū. After one year, 8 of the 10 Coprosma plants exposed to 

Z. oppositus showed leaf reddening of older leaves and one of 

these also showed dieback of the main shoot, symptoms 

consistent with phytoplasma infection in this host (3). Two 

plants that had been exposed to Z. opposites tested positive for 

phytoplasma. 

Both species of Zeoliarus are endemic to New Zealand. The 

ecology of Z. oppositus is consistent with the proposal that it is a 

vector for “Ca. P. australiense”. It is a very common species 

where it is found in natural and modified habitats throughout 

the country. Given the polyphagous nature of Z. oppositus, it is 

apparent that it may transmit the phytoplasma to other plants. 


This work was funded by New Zealand’s Foundation for 

Research, Science and Technology and Ministry of Research, 

Science and Technology. We thank Lia Liefting and John Charles 

for useful discussions. 

REFERENCES 

1. Andersen MT, Beever RE, Sutherland PW, Forster RLS (2001) 

Association of ‘Candidatus Phytoplasma australiense’ with sudden 

decline of cabbage tree in New Zealand. Plant Disease 85, 462–469. 

2. Beever RE, Forster RLS, Rees‐George J, Robertson GI, Wood GA, 

Winks CJ (1996) Sudden decline of cabbage tree (Cordyline 

australis): search for the cause. New Zealand Journal of Ecology 20, 

53–68. 

3. Beever RE, Wood GA, Andersen MT, Pennycook SR, Sutherland PW, 

Forster RLS (2004) “Candidatus Phytoplasma australiense” in 

Coprosma robusta in New Zealand. New Zealand Journal of Botany 

42, 663–675 

4. Cumber RA (1953) Investigations into yellow‐leaf disease of 

Phormium. IV. Experimental induction of yellow‐leaf condition on 

Phormium tenax Forst. by the insect vector Oliarus atkinsoni Myers 

(Hem. Cixiidae). New Zealand Journal of Science and Technology 

34A (Supplement 1), 31–40. 

5. Liefting LW, Beever RE, Winks CJ, Pearson MN, Forster RLS (1997) 

Planthopper transmission of Phormium yellow leaf phytoplasma. 

Australasian Plant Pathology 26, 148–154. 



Australian grapevine yellows phytoplasma found in symptomless shoot tips after a 

heat wave in South Australia 

P.A. Magarey{ XE "Magarey, P.A." } A , N. Habili B , J.A. Altmann C and J.D. Prosser D 

A South Australia Research and Development Institute, PO Box 411, Loxton, 5333, SA, B The University of Adelaide, PMB1, Glen Osmond, 

SA, 5064 

C Fruit Doctors, Balfour Ogilvy Avenue, Loxton, South Australia, 5333, D 115 Nildottie‐Bakara Road, Nildottie, South Australia, 5238 

INTRODUCTION 

In 2008/09, extremely high incidences of Australian Grapevine 

Yellows (AGY) in cv. Riesling vineyards at Nildottie, near Loxton, 

South Australia, suggested incursion of a new yellows pathogen. 

To investigate, in March 2009 we surveyed vineyards, tested 

material via PCR and examined the role of a period of very high 

temperature on symptom expression. The findings challenged 

our previous theory on the pathogenesis of AGY. 


Vineyard Surveys. In Nildottie vineyards (Table 1), 50 

vines/block, ≥ 3 blocks/transect and ≥ 3 transects /vineyard were 

scored for typical AGY viz. yellowed, downward curled leaves, 

unlignified shoots and shrivelled bunches. 

PCR‐Tests. Following a heat wave in Jan‐Feb 2009 with 13 

consecutive days ≥ 38°C (5 ≥ 42°C), ~5 shoots with typical AGY 

symptoms were selected from each of several cultivars (Table 2) 

for replicated two‐step PCR analysis with both positive and 

negative controls to detect AGY phytoplasma (AGYp) as per (1,2). 

Samples were taken from: 1) mature, yellowed leaves; and 2) 

symptomless new growth on shoot‐tips. 

respectively) were warmer compared with March averages 

(28.2°C/11.8°C). 

Table 2. PCR‐tests of AGY‐affected shoot material and new tip‐growth in 

several cultivars after a heat wave, Nildottie, South Australia, March 

2009. 

Vineyard 1 # 

Shoots 

with AGYp 

PCR‐Tests for AGYp 

# 

Shoots 

Tested 

# 

Shoot Tips 

with AGYp 

Riesling 1 4 5 4 4 



Sangiovese 1 1 ‐ ‐ 

Shiraz 2 1 1 ‐ ‐ 

Sauv. Blanc 0 1 ‐ ‐ 

1 

The same vineyards as in Table 1. 2 Weakly positive for AGYp. 

# 

Shoot Tips 

Tested 

Elsewhere in 2008/09, surveys also showed higher severity but 

little new incidence (data not shown). 2) Incidence: The higher 

incidence at Nildottie suggests an increased activity of AGYp 

vector(s) but raises the possibility of an incursion of a more 

infective vector(s). 


Vineyard Surveys. Previous levels of AGY in the Riesling 

vineyards at Nildottie had averaged 3–5% vines but, in 2008/09, 

the incidence was extreme and unprecedented in Australia 

(Table 1). Adjacent, usually symptomless red cultivars were also 

diseased. 

Table 1. Incidence of AGY in vineyards of several cultivars, Nildottie, 

South Australia, March 2009. 

Scores of AGY Incidence 

Vineyard 

# 

Vines 

% 

AGY 

Vineyard 

# 

Vines 

% 

AGY 

Riesling 1 562 99.8% Chardonnay 1 292 1.7% 

Riesling 2 366 94.8% Chardonnay 2 146 Nil 

Riesling 3 388 88.9% Shiraz 1 150 3.3% 

Sangiovese 1 150 19.3% Sauv. Blanc 150 Nil 

1 

From conservative assessment—actual incidence was likely higher. 

The highest incidence we had previously seen on any cultivar 

was 86% (on Riesling in Renmark, SA, in 1978/79). At Nildottie, 

the severity of disease was also extreme. Whereas usually only 

3–5 shoots/vine are affected by AGY, in 2008/09, most shoots 

were diseased and in Riesling Vineyards 1 and 2, crop loss was 

complete. 

PCR‐Tests. AGYp were found in a high proportion of samples 

(Table 2). This was consistent with previous tests (data not 

shown) and counteracted the idea that incursion of a new 

pathogen caused the extreme disease. 

Why were levels of AGY so high in 2008/09? Two possibilities 

are: 1) Severity: Seasonal increases in temperatures from 

autumn to early spring in 2008 may have increased the 

multiplication of overwintering AGYp, raising their titre and so 

the severity of symptoms seen in 2008/09. In March 2008 at 

Loxton, mean max./min. temperature (T) (at 32.7°C/12.5°C 

Why the observed remission of symptoms? New growth of AGY 

affected shoots 10–14 days after heat waves has been seen 

many times (data not shown). Symptomless new shoot growth 

produced after the 13‐day heat wave of Jan‐Feb 2009 was PCR 

+ve for AGYp (Table 2), suggesting that not all AGYp were killed 

or denatured by the heat. Hot water treatments (e.g. 45 minutes 

at 50°C) delivering ~40°C‐hrs/treatment at 50°C or ~200°C‐hrs at 

45°C, are used in Europe to reduce transmission rates of FD and 

other yellows pathogens (3). The 2009 heat wave delivered a 

lesser though similar heat treatment to the vines at Nildottie. A 

46°C max T delivered ~180°C‐hrs at ≥45°C and a 45°C max T 

delivered ~230°C‐hrs at ≥43°C. We had supposed that these 

temperatures were lethal to AGYp and thus triggered the 

observed new shoot growth but this theory is now questioned. 

AGY‐affected shoots show signs of disturbed phloem cell 

function, hormone imbalance and deposition of callose in sieve 

cells (data not shown) but these were insufficient to prevent 

significant reactivation of shoot growth soon after the heat 

wave. If AGY symptoms were the result of that damage, the swift 

‘remission’ of AGYp‐infected and severely diseased shoots raises 

conjecture as to the cause of AGY symptoms. 


Dr David Cartwright, Primary Industries and Resources SA, 

provided some financial assistance for the PCR‐tests. 

REFERENCES 

1. Davis R., et al, 1997. “Candidatus Phytoplasma australiense”, a new 

phytoplasma taxon associated with Australian grapevine yellows. 

International Journal of Systematic Bacteriology 47: 262–269. 

2. Kirkpatrick, B.C. et al, 1994. Phylogenetic relationship of plant 

pathogenic MLOs established by 16/23S rDNA spacer sequences. 

IOM Let. 3: 228–229. 

3. Caudwell A., et al. 1997. Flavescence dorée (FD) elimination from 

dormant wood of grapevines by hot‐water treatment. Australian 

Journal of Grape and Wine Research 3, 21–25. 


Association of phytoplasmas with papaya crown yellows disease—a new disease of 

papaya in Northern Mindanao, Philippines 

R.G. Billones{ XE "Billones, R.G." } A , M.P. Natural B , C.M. Vera Cruz C , E.Y. Ardales B , C. Streten D , L. Tran‐Nguyen D and K.S. Gibb D 

A Del Monte Phils, Inc, Bukidnon, Philippines 

B Crop Protection Cluster, University of the Philippines‐Los Baños, Philippines 

C International Rice Research Institute, Los Baños, Philippines 

D Faculty of Education, Health and Science, Charles Darwin University, NT, 0909 Australia 

INTRODUCTION 

“Papaya crown yellows” (PCY) disease of unknown etiology was 

first observed in Northern Mindanao, Philippines in 2001. PCY 

was thought to be associated with phytoplasma because its 

symptoms are similar to phytoplasma diseases of papaya in 

Australia. The occurrence of PCY poses a potential threat to the 

papaya industry in Northern Mindanao as well as the whole 

country. Thus, this research aimed to investigate the etiology of 

the PCY disease and to determine its identity using sensitive 

molecular and genetic techniques. 

1650 bp 

1000 bp 

100 bp 

DNA marker 

Symptomless 

Natumolan 1 

Natumolan 2 

Natumolan 3 

Natumolan 4 

Malitbog 1 

1 2 3 4 5 6 7 8 9 10 11 12 13 

Malitbog 2 

Malitbog 3 

Malitbog 4 

Ca. P. Aus 

TBB strain 

SDW 

880 bp 



Sample Collection. Seventy symptomatic and 33 symptomless 

papaya leaf samples were collected at 8 different locations in 

Northern Mindanao in April‐June 2004. An additional 12 

symptomless samples were collected at Los Baños, Laguna 

province in July 2004 where PCY disease was not observed. 

Detection of Phytoplasmas from Papaya DNA using Polymerase 

Chain Reaction (PCR). DNA was isolated from papaya leaf 

samples using phytoplasma enrichment nucleic acid extraction 

method by Dellaporta (1). Universal primer pair fu5/rU3 (2) of 

the 16S rRNA gene was used for general detection of 

phytoplasmas in papaya DNA. The group‐specific primer pair Tuf 

f40 and Tuf r1150 (Streten, unpublished) that amplifies 1110 bp 

of the tuf gene was used to detect papaya dieback phytoplasma 

Candidatus P. australiense in papaya DNA. Ca. P. aurantifolia 

(TBB strain) and Ca. P. australiense were used as positive 

controls while healthy papaya DNA and sterile distilled water 

(SDW) were used as negative controls. 

Restriction Fragmnent Length Polymorphism (RFLP) Analysis. 

PCR products were digested using 1U of TaqI restriction enzyme 

(Biolabs, Australia) and were incubated overnight at 65°C. DNA 

fragments were separated by electrophoresis in an 8% 

polyacrylamide gel and visualised by staining with 5% ethidium 

bromide. Ca. P. aurantifolia (TBB and SPLL‐V4 strains) and Ca. P. 

australiense were used as references. 

RESULTS 

Detection of phytoplasmas from papaya using PCR. Of 70 

symptomatic samples collected in Northern Mindanao, 8 

samples (4 from Natumolan area and 4 from Malitbog area) 

were positive to phytoplasmas using fU5/rU3 universal primers 

(Figure 1) but none were positive using group‐specific primer Tuf 

f40/r1150. All symptomless samples were negative to PCR. 

RFLP Analysis. RFLP analyses of the 16S rRNA gene using TaqI 

restriction digest enzyme indicated that the phytoplasmas 

associated with PCY disease were identical to Ca. Phytoplasma 

aurantifolia, the phytoplasma associated with papaya yellow 

crinkle and papaya mosaic in Australia and not Ca. P. 

australiense causing papaya dieback. 

Figure 1. Lane 1, 1 kb plus DNA ladder; 2, symptomless papaya; 3–6, 

diseased papaya from Natumolan area; 7–10, diseased papaya from 

Malitbog area; 11, Ca. P. australiense (Ca. P. aus); 12, Ca. P. aurantifolia‐ 

TBB strain; 13, sterile distilled water 

650 bp 

500 bp 

400 bp 

300 bp 

200 bp 

100 bp 

DNA ladder 

Malitbog 1 

Malitbog 2 

Malitbog 3 

Malitbog 4 

Natumolan 1 

1 2 3 4 5 6 7 8 9 10 11 12 

Natumolan 2 

Figure 2. Digestion of fU5/rU3 PCR products with TaqI restriction 

enzyme. Lane 1, 1 kb plus DNA ladder, 2–5, diseased papaya from 

Malitbog area; 6–9, diseased papaya from Natumolan area, 10, Ca. P. 

aurantifolia‐TBB strain; lane 11, Ca. P. aurantifolia‐SPLL‐V4 strain, lane 

12, Ca. P. australiense. 

DISCUSSION. 

This is the first report of a phytoplasma association in diseased 

papaya in the Philippines. The identification of the associated 

pathogen for PCY is an important step to be able to establish 

control measures for the disease. 


Del Monte Philippines, Inc. for the research fund. 

REFERENCES 

1. Dellaporta SL, Wood J, Hicks JB, 1983. A plant DNA 

minipreparation: Version II. Plant Molecular Biology Reporter 1, 19– 

21. 

2. Lorenz K‐H, Schneider B, Ahrens U, Seemueller E, 1995. Detection 

of the apple proliferation and pear decline phytoplasmas by PCR 

amplification of ribosomal and nonribosomal DNA. Phytopathology 

85, 771–776. 

Natumolan 3 

Natumolan 4 

TBB strain 

SPLL-V4 

Ca. P. aus 



Phytoplasma diseases in citrus orchards of Pakistan 

Shazia Mannan{ XE "Mannan, S." } A , Shahid Nadeem Chohan B,C , Muhammad Ibrahim A , Obaid Aftab B , Raheel Qamar B , M. Kausar Nawaz 

Shah B , Iftikhar Ahmad D , Paul Holford C , G. Andrew C. Beattie C 

A Department of Biosciences, COMSATS Institute of Information Technology, Sahiwal, 520‐B Civil Lines, Sahiwal, Pakistan 

B Department of Biosciences, COMSATS Institute of Information Technology, Chak Shahzad Campus, Islamabad, Pakistan 

C Centre for Plant and Food Science, University of Western Sydney, Locked Bag 1797, Penrith South DC, NSW 1797, Australia 

D National Agricultural Research Centre, Pakistan Agricultural Research Council, Park Road, Islamabad, Pakistan 

INTRODUCTION 

Citrus fruits are one of the major export commodities of Pakistan 

and are grown in an area of 160,000 ha with production of 1.5 

MMT annually (1). Most of this citrus is grown in the province of 

Punjab. Citrus species and hybrids [Sapindales: Rutaceae] are 

affected by a number of destructive diseases and plants infected 

with ‘Candidatus Phytoplasma asteris’ have been detected in 

orchards close to Islamabad (4). However, the extent of infection 

is not known and the vector(s) has not been identified. 

Therefore, a study is under way to detect the presence of 

phytoplasmas in citrus from orchards in the districts of Sahiwal, 

Pakpattan and Multan, some 500 km west of Islamabad in the 

province of Punjab, as well as to identify possible alternative 

hosts and the vector(s). 


Leaves showing phytoplasma‐like symptoms were collected from 

plants including sweet and blood oranges, grapefruit (C. × 

aurantium L.), mandarins (C. reticulata Blanco), lemons (C. × 

limon (L.) Osbeck) and limes (C. × aurantiifolia (Christm.) 

Swingle) [Sapindales: Rutaceae]. In order to identify possible 

alternative hosts, weeds including couch grass Cynodon dactylon 

(L.) Pers. and wild oat Avena fatua L., [Poales: Gramineae], field 

bindweed Convolvulus arvensis L. [Solanales: Convolvulaceae], 

and fat‐hen Chenopodium album L. [Caryophyllales: 

Chenopodiaceae] were collected. Potential vectors, including 

Asiatic citrus psylla Diaphorina citri Kuwayama [Hemiptera: 

Psyllidae], and leafhoppers (possibly Balclutha punctata 

(Fabricius) and Empoasca decipiens Paoli [Hemiptera: 

Cicadellidae]) were collected, most from around plants showing 

phytoplasma‐like disease symptoms. 

DNA was extracted from the petioles and midribs of samples 

using the method of Doyle and Doyle (3). Both single and nested 

PCR were used to amplify phytoplasma DNA sequences. Single 

PCR used the O‐MLO primers of Doyle and Doyle (3). The P1/P7 

primer pair of Deng and Hiruki (2) and Schneider et al (6) was 

used in conjunction with primers R16F2n/R16R2 and 

R16mF2/R16mR1 (5) for nested PCR. DNA of ‘Candidatus 

Phytoplasma aurantifolia’, obtained from Central Science 

Laboratory, UK, was used as a positive control during 

amplifications. 

Figure 1. Typical PCR amplification products. Lanes 1–3, single PCR; lanes 

4–7, nested PCR; lanes 1, 2 and 4–6, infected sweet orange; lanes 3 and 

7, control (‘Ca. Phytoplasma aurantifolia’); lane 8 molecular weight 

markers 


We would like to acknowledge the Higher Education Commission 

of Pakistan for their financial support of this study. 

REFERENCES 

1. Anon (undated) All about—Citrus. 

http://www.pakissan.com/english/allabout/orchards/citrus/index.s 

html (accessed 30/4/2009) 

2. Deng S, Hiruki D (1991) Amplification of 16S rRNA genes from 

cultureable and nonculturable mollicutes. J. Microbiol. Methods 14, 

53–61. 

3. Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. 

Focus 12, 13–15. 

4. Fahmeed, F, Arocha Rosete Y, Acosta Perez K, Boa E, Lucas J (2009) 

First report of ‘Candidatus Phytoplasma asteris’ (Group 16SrI) 

infecting fruits and vegetables in Islamabad, Pakistan. J. 

Phytopathology doi: 10.1111/j.1439‐0434.2009.01549.x 

5. Gundersen DE, Lee I‐M (1996) Ultrasensitive detection of 

phytoplasmas by nested‐PCR assays using two universal primer 

pairs. Phytopathologia Mediterranea 35: 144–151. 

6. Schneider B, Seemuller E, Smart CD, Kirkpatrick BC (1995) 

Phylogenetic classification of plant pathogenic mycoplasma‐like 

organisms or phytoplasmas. In ‘Molecular and diagnostic 

procedures in mycoplasmology, Vol. 1’.(Eds S Razin, JG Tully) pp. 

369–380. (Academic Press: San Diego) 

RESULTS 

Single PCR amplified a 558 bp sequence from the phytoplasma 

16S rRNA gene of from DNA extracted from infected plants and 

nested PCR amplified a 1.2 kb fragment confirming infection 

with a phytoplasma (Fig. 1). The amplicons will be sequenced to 

determine which group the phytoplasma belongs to. To date, a 

total of 20 samples of sweet orange have been tested from the 

Sahiwal district, 15 from farmer orchards and 5 from the 

Horticulture Research Center at Sahiwal: 6 samples from 

farmers’ orchards and 3 from the Center were found to be 

infected. Screening of the insects as well as the weeds collected 

from the orchards is in progress and the survey is currently being 

extended to include the rest of Punjab Province to ascertain the 

incidence and prevalence of disease caused by phytoplasmas. 


Mechanisms modulating fungal attack in postharvest pathogen interactions and their 

modulation for improved disease control 

Dov Prusky 

Department of Postharvest Science of Fresh Produce, Agricultural Research Organization, Bet Dagan 50250, Israel 

Email: dovprusk@agri.gov.il 


As biotrophs, insidious fungal infections of postharvest 

pathogens remain quiescent during fruit growth while at a 

particular phase during ripening and senescence the pathogens 

transform to necrotrophs causing typical decay symptoms. 

Exposure of unripe hosts to pathogens (hemi‐biotroph or 

necrotrophs), initiates defensive signal‐transduction cascades 

that limit fungal growth and development. Exposure to the same 

pathogens during ripening and storage activates a substantially 

different signalling cascade which facilitates fungal colonisation. 

This presentation will focus on modulation of postharvest hostpathogen 

interactions by pH and the consequences of these 

changes. Host pH can be raised or lowered in response to host 

signals, including alkalisation by ammonification of the host 

tissue as observed in Colletotrichum and Alternaria, or 

acidification by secretion of organic acids as observed in 

Penicillium and Botrytis. These changes sensitise the host and 

activate transcription and secretion of fungal hydrolases that 

promote maceration of the host tissue. This sensitisation is 

further enhanced at various stages by accumulation of fungal 

ROS that can further weaken host tissue and amplifies fungal 

development. Several particular examples of coordinated 

responses which follow this scheme in Colletotrichum and 

Penicillium will be described, followed by discussion of the 

means to exploit these mechanisms for establishment of new 

approaches for postharvest disease control. 



ABA‐dependant signalling of PR genes and potential involvement in the defence of 

lentil to Ascochyta lentis 

INTRODUCTION 

B.M. Mustafa, D.T.H. Tan, P.W.J. Taylor and R. Ford{ XE "Ford, R." } 

BioMarka, Melbourne School of Land and Environment, The University of Melbourne, 3010, Victoria 

Pathogenesis‐related (PR) proteins are an important component 

of inducible defence mechanisms in plants. Their accumulation is 

triggered by pathogen attack or by abiotic stress (1). Recently, a 

PR‐4 and a PR‐10a gene were differentially transcribed in 

response to the important fungal pathogen, Ascochyta lentis, 

between the resistant (ILL7537) and susceptible (ILL6002) lentil 

genotypes (2). 

This paper outlines the cloning and expression analyses of the 

PR‐4 and PR‐10a genes from ILL7537 in response to exogenous 

treatments of the global signalling molecules abscisic acid (ABA), 

the immediate ethylene precursor aminocyclopropane 

carboxylic acid (ACC), methyl jasmonate (MeJA) and salicylic acid 

(SA); known to control plant defence pathways (3). This will give 

an insight into the regulatory mechanism controlling specific PR 

gene expression in lentil and if broadly applicable to defence, 

these genes may be targeted for future resistance breeding 

strategies. 


SMART RACE cDNA amplification (Clontech, USA) enabled fulllength 

cDNA cloning of the lentil PR‐4 and PR‐10a cDNAs. For 

expression studies, 14‐day‐old seedlings were sprayed with a 

100 µM solution of ABA, ACC, MeJA or SA. Seedlings were also 

inoculated with a 10 5 A. lentis spore suspension. Control plants 

were sprayed with sterile water. Bulk seedling foliage (leaf and 

shoot) from five plants was harvested at 6, 24, 48, and 96 hours 

post treatment (hpt) using the RNeasy Plant Mini Kit (Qiagen, 

USA). The bioassay was repeated with another set of 

independently grown seedlings. cDNA synthesis was carried out 

by reverse‐transcribing 1.5 µg of each RNA sample using an oligo 

dT18 primer (Roche, Germany) and the Omniscript RT kit 

(Qiagen, USA). Triplicate qPCR reactions were performed on 

each hpt cDNA sample. All PCR products were subjected to 

melting curve analysis and the comparative C t method (ΔΔC t ) 

was used to calculate the relative fold changes of gene 

expression. 

RESULTS 

The full length PR‐10a cDNA was 783 bp long with an ORF 

encoding a peptide of 156 amino acids with an N‐terminal 

methionine and a C‐terminal leucine. The full length PR‐4 cDNA 

was 636 bp long, with 39 bases of 5` untranslated and 157 bases 

of 3` untranslated sequence, and a poly(A) tail. 

PR‐4 and PR‐10a gene expression was up‐regulated in lentil by 

ABA at all hpt with PR‐10a being more highly expressed than PR‐ 

4. Neither gene was up‐regulated by the other signalling 

molecules (ACC, MeJA and SA; Fig 1). Thus we proposed that the 

signalling pathway for both of these genes is ABA‐dependent 

and JA‐independent. 

Figure 1. Relative fold changes in transcript levels of PR‐4 and PR‐10a in 

14‐day‐old ILL7537 seedlings at 6, 24, 48 and 96 hpt following ABA, ACC, 

MeJA, SA or Ascochyta lentis treatment. 

DISCUSSION 

Since, both PR‐4 and PR‐10a were also up‐regulated in response 

to the important fungal pathogen Ascochyta lentis (2), we 

propose that ABA may play a pivotal role in the signal 

transduction of defence responses against A. lentis in lentil. This 

is in agreement with other host/pathogen interaction studies (4). 

However, further functional validation of ABA modulation of 

defence responses to such pathogenic stimuli is required to 

facilitate the identification and characterisation of key genes 

involved in the ABA‐dependent signalling pathway in lentil. 

REFERENCES 

1. van Loon LC, Rep M, Pieterse CM (2006) Significance of inducible 

defense‐related proteins in infected plants. Annual Review of 


2. Mustafa BM (2008) Functional mechanisms of Aschochyta blight 

resistance in lentil. PhD Thesis. The University of Melbourne, 

Australia. 

3. Bostock RM (2005) Signal Crosstalk and Induced Resistance: 

Straddling the Line Between Cost and Benefit. Annual Review of 

Phytopathology, 43, 545–580. 

4. Kaliff M, Staal J, Myrenas M, Dixelius C (2007) ABA is required for 

Leptosphaeria maculans resistance via ABI1‐ and ABI4‐dependent 

signaling. Molecular Plant‐Microbe Interactions 20, 335–345. 


Fundamental components of resistance to Phytophthora cinnamomi: using model 

system approaches 

INTRODUCTION 

J.A. Cullum, T.K. Gunning, J.E. Rookes and D.M. Cahill{ XE "Cahill, D.M." } 

School of Life and Environmental Sciences, Deakin University, Geelong, 3217, Victoria 

Compared with the number of plant species known to be 

susceptible to Phytophthora cinnamomi, few are known to be 

resistant (1). Understanding how plants are able to resist this 

pathogen will enable strategies to be developed to enhance 

individual species survival and to restore structure and 

biodiversity to the ecosystems under threat. Natural resistance 

to pathogens can be characterised at a number of levels ranging 

from specific gene involvement to whole plant responses. 

The aims of this project are to determine at the cellular, 

biochemical and molecular levels what constitutes resistance of 

native plants to P. cinnamomi by identifying the pathways within 

plants that regulate resistance and then exploring the potential 

to manipulate them. Our research is centred on further defining 

and understanding natural resistance in native Australian plant 

species. Most studies on resistance against pathogens have been 

undertaken on aerial plant parts (ie stems and leaves) thus there 

is a requirement for a good, fundamental understanding of rootbased 

resistance. Here we have used a model system approach 

to characterise the fundamental components of resistance 

against P. cinnamomi. 


Arabidopsis model. The interaction between Arabidopsis 

thaliana ecotype Columbia‐0 and P. cinnamomi was examined in 

detail (2). Leaf and root analysis and examination of responses in 

signal transduction pathway mutants were carried out. 

Zea model. Gene expression analysis of defence‐related genes 

was conducted following inoculation of Zea mays root tissue 

over several time points ranging from 0–120 hours. In addition, 

regulation of defence‐related genes in response to the defence 

hormones jasmonic acid, salicylic acid and ethylene was 

examined to determine which signalling pathways may operate 

in this pathosystem. 

Lupin model L. angustifolius was grown in a soil‐free plant 

growth system (3) and roots inoculated with zoospores. This well 

recognised, highly susceptible interaction is typified by the 

development of dark lesions in the root that extend through the 

vascular system causing root decay. We developed a nontargeted 

method to extract, separate and identify metabolites 

produced following inoculation. 

RESULTS 

Arabidopsis thaliana. P. cinnamomi was found to induce active 

defence responses in Arabidopsis. Tissue specific differences in 

levels of infection and defence responses induced were found 

between inoculated root and leaf tissue. Molecular analysis of 

defence‐related genes also showed differential induction 

between root and leaf tissue. It is likely that the 

resistance/tolerance that Arabidopsis displays against P. 

cinnamomi is provided by a multi‐faceted defence response. 

maize specific microarray has identified genetic pathways that 

regulate defence to P. cinnamomi. 

Lupinus angustifolius. The metabolic profiles (in the form of 

HPLC chromatograms) from both un‐inoculated (healthy) and 

inoculated (diseased) plant root tissue were compared. The data 

strongly suggests differences in metabolic activity. Multiple 

experimental repeats were performed and were statistically 

analysed using principal components analysis which confirmed 

that the profiles were statistically different. The variables loading 

identified the peaks/metabolites that caused the data to 

separate into distinct groups. The separated extracts were then 

passed through a Time of Flight Mass Spectrometer (TOF 

MS/MS) to determine identity/chemical structure of 

metabolites. 

DISCUSSION 

We have examined the potential for using model plant systems 

for the analysis of the interaction of P. cinnamomi with roots. 

This research has provided a number of important outcomes 

that will alter the way in which we approach disease caused by 

P. cinnamomi in Australian native plants. If we know what the 

mechanisms of resistance are then there is the potential to 

manipulate them and to devise new methods for control that 

may include induction of specific resistance mechanisms in 

susceptible species and development of markers for resistance 

(for example, anatomical, morphological, molecular‐based). 

Additionally, we are developing screening techniques that will 

enable concentration of effort on those species that are the 

most susceptible, vulnerable and rare. Resistant plants can also 

be used to restore vegetation structure on P. cinnamomiaffected 

sites where the pathogen may still be present. 


We thank the Australian Government Department of 

Environment, Heritage, Water and the Arts for funding. Dr Xavier 

Conlan and Professors Neil Barnett and Mike Adams (Deakin 

University and RMIT University) have provided valuable advice 

on chemical analyses. 

REFERENCES 

1. Cahill DM, Rookes JE, Wilson BA, Gibson L, McDougall K (2008) 

Phytophthora cinnamomi and Australia’s biodiversity: impacts, 

predictions and progress towards control. Australian Journal of 

Botany 56, 279–310. 

2. Rookes JE, Wright M, Cahill DM (2008) Elucidation of defence 

responses and signalling pathways induced in Arabidopsis thaliana 

following challenge with Phytophthora cinnamomi. Physiological 

and Molecular Plant Pathology, 72, 151–161. 

3. Gunning TK and Cahill DM (2009) A soil‐free plant growth system to 

facilitate analysis of plant pathogen interactions in roots. Journal of 

Phytopathology, In press. 


Zea mays. A resistant monocot model system (Zea mays) for 

gene expression analysis of defence pathways was optimised. A 

suite of maize defence‐related genes was analysed in response 

to infection with P. cinnamomi. Genome‐wide analysis using a 



Genes involved in hypersensitive cell death responses during Fusarium crown rot 

infection in wheat 

Jill E. Petrisko{ XE "Petrisko, J.E." } 1 , Mark W. Sutherland 1 , Juliet M. Windes 2 

1 Centre for Systems Biology, University of Southern Queensland, Toowoomba, Queensland, 4350, Australia 

2 University of Idaho, Plant, Soils, and Entomological Sciences, University Place, 1776 Science Center Drive, Suite 205, Idaho Falls, Idaho 

INTRODUCTION 

Hypersensitive plant cell death is activated by the accumulation 

of hydrogen peroxide and nitric oxide (1), and is strictly 

controlled by several genes including cysteine proteases, 

hydrogen peroxide and superoxide scavengers, and cell death 

regulators (2). In contrast to biotrophic fungal pathogens, 

necrotrophic pathogens like Fusarium pseudograminearum and 

F. culmorum that cause Fusarium crown rot infections, benefit 

from plant cell death by utilising dying plant tissue to facilitate 

their spread throughout the plant (3). 

83402 


Table 1. Gene transcript levels expressed during infection with 

F. culmorum. 

Genes 2–49 Puseas 

Cathepsin B 1.58 2.09 

Mlo‐like protein 2.26 ‐1.05 

Catalase ‐2.19 ‐4.40 

Manganese SOD 

superoxide dismutase ** 

40.69 1 


Seedling Germination.‐Seeds of the Fusarium crown rot 

susceptible wheat cultivar Puseas and partially resistant wheat 

line 2–49 were sterilised in 5% NaOCl for 1 hour and were then 

germinated in the dark on petri dishes containing 2% water agar. 

Seedling Inoculation.‐Seedlings were inoculated with a single 

spore of F. culmorum or F. pseudograminearum on a 2% water 

agar block using an adapted procedure of Mergoum et al. (4) and 

harvested 10 days post‐inoculation. 

Microarray analysis of F. culmorum infection. RNA was 

extracted from non‐inoculated and F. culmorum inoculated 

seedlings of 2–49 and Puseas and hybridised to Affymetrix® 

wheat gene chips. Gene transcripts in the inoculated treatments 

determined to be significantly induced or repressed two‐fold 

over the non‐inoculated treatments were analysed using the 

GeneSpring GX_7_3 program (Agilent). 

Deoxynivalenol (DON) Application.‐10 ul of 10 mg/ml 

deoxynivalenol was applied to a block of 2% water agar attached 

to growing seedlings of 2–49 and Puseas and was taken up by 

the seedling for 24 hours. 

Staining for cell death was visualised in some of the seedlings by 

applying a second agar block containing 10 ul of 0.1% Evans blue 

dye below the block containing DON and allowing the stain to be 

taken up with the DON for 24 hours. 

RNA extraction, cDNA, and real‐time PCR.‐RNA from F. 

pseudograminearum inoculated or DON applied seedlings was 

extracted using the Plant RNA Purification Reagent protocol 

(Invitrogen). cDNA was produced using gene specific primers in a 

reverse transcriptase reaction. cDNA transcripts were assayed 

using real‐time quantitative PCR using SYBR green in the Rotor‐ 

Gene 6000 thermocycler. 

Genes involved in the hypersensitive cell death response during 

F. culmorum infection (Table 1) were identified using a 

microarray analysis with the Affymetrix® wheat chip. Cathepsin 

B, a plant cysteine protease, was induced in the susceptible 

cultivar Puseas during F. culmorum infection. Catalase, an 

enzyme preventing hydrogen peroxide accumulation, was 

repressed in Puseas. A Mlo‐like protein (cell death regulator) and 

manganese superoxide dismutase were up‐regulated in the 

resistant wheat line 2–49. These genes are under current 

investigation during infection studies with F. 

pseudograminearum and DON application to determine what 

role they have in the response of these cultivars to infection. 

Infection with F. pseudograminearum spores and DON has been 

shown to elicit hydrogen peroxide formation and plant cell death 

as well induce genes involved in defence responses in wheat (5). 

It is not known whether hypersensitive cell death or avoidance 

of hypersensitive cell death during infection with Fusarium 

species plays a role in the susceptibility or resistance of wheat 

cultivars to Fusarium crown infection. Further investigation of 

these genes during the infection process with F. 

pseudograminearum and DON is needed in order to determine if 

different levels influence hypersensitive cell death and the role 

they have in either enhancing susceptibility or resistance in 

wheat during Fusarium crown infection. 

REFERENCES 

1. Delledonne M, Zeier J, Marocco A, Lamb C. (2001) Signal 

interactions between nitric oxide and reactive oxygen 

intermediates in the plant hypersensitive disease resistance 

response. Proc of the Nat Acad of Sci 98, 13454–59. 

2. Gilroy EM, Hein I, van der Horn R, Boevink PC, Venter E, McLellan 

H, Kaffarnik F, Hrubikova K, Shaw J, Holeva M, Lopez EC, Borras‐ 

Hidlago O, Pritchard L, Loake, GJ, Lacomme C, Birch PR. (2007) 

Involvement of cathepsin B in the plant resistance hypersensitive 

response. Plant J 52, 1–13. 

3. Govrin EM, Levine A (2000) The hypersensitive response facilitates 

plant infection by the necrotrophic pathogen Botrytis cinerea. Curr 

Biol 10, 751–57. 

4. Mergoum M, Hill JP, Quick J (1998). Evaluation of resistance of 

winter wheat to Fusarium accuminatum by inoculation of seedling 

roots with single, germinated macroconidia. Plant Dis 82, 300–2. 

5. Desmond OJ, Manners JM, Stephens AE, Maclean DJ, Schenk PM, 

Gardiner DM, Munn AL, Kazan K (2008) The Fusarium mycotoxin 

deoxynivalenol elicits hydrogen peroxide production, programmed 

cell death, and defence responses in wheat. Mol Plant Pathol 9, 

435–45 


Fishing for Phytophthora across Western Australia’s water bodies 

D. Hüberli{ XE "Hüberli, D." } A,B , T.I. Burgess A and G.E.St.J. Hardy A 

A Centre for Phytophthora Science and Management, School of Biological Sciences and Biotechnology, Murdoch University, Perth, 6150, 

WA 

B Present Address: Plant Pathology, Department of Agriculture and Food, 3 Baron‐Hay Court, South Perth, 6151, WA 

INTRODUCTION 

Most Phytophthora surveys in native ecosystems in Australia 

have focused exclusively on isolations from samples of soil and 

symptomatic plant tissue including the extensive vegetation 

health surveys conducted in Western Australia (WA) (1). The 

outbreak of P. ramorum in California and Europe, where early 

detection of an infested area was important to the success of 

containment and eradication efforts, has popularised the stream 

surveys in native ecosystems. In Australia, it has recently been 

used to detect Phytophthora spp. in Victoria resulting in several 

species being isolated from four streams which varied according 

to the winter and summer sampling season (2). In our study, the 

baiting technique was used to survey a wide range of WA’s 

waterways for Phytophthora spp. during October to early 

December 2008. 

(VHS16108) and P. inundata. That P. inundata is apparently 

widespread in the south coast and some wheatbelt regions is of 

concern given that it has been associated with dying native 

vegetation in WA’s southwest (3). Currently, little is known 

about P.sp.12 and P.sp.13, but our study clearly shows that they 

are widespread across many regions of WA. 

P.sp.3 and P.sp.11 were not common (Table 1); P.sp.3 has 

previously been isolated from dying Eucalyptus marginata, 

Banksia spp. and Pinus radiata (1). P.sp.8, P.sp.11, P.sp.12 and 

P.sp.13 fit within a strongly supported clade with P.sp.3, and (1) 

proposed that these would be common in water bodies. Our 

sampling during October to December 2008 shows that this 

hypothesis is true with the exception of P.sp.3 and P.sp.11. 

Table 1. Phytophthora species found in water bodies in nine regions of 

Western Australia during the October to December 2008 sampling (see 

Figure 1). Reg = Region, na = not applicable (too few samplings) 

Reg. Phytophthora spp. Most common spp. 

1 P. inundata, P.sp.11, P.sp.13 P.sp.13 

2 P. inundata, P.sp.11, P.sp.13 P. inundata 

3 P. inundata, P.sp.13 P. inundata 

4 P.sp.3, P.sp.12, P.sp.13 P.sp.12, P.sp.13 

5 P.sp.12 na 

6 P. hydropathica, P. inundata, P.sp.3, 

P.sp.8, P.sp.11, P.sp.12, P.sp.13 

P.sp.12 

7 P.sp.8, P.sp.11 P.sp.8 

8 P. inundata, P.sp.3, P.sp.8, P.sp.11, 

P.sp.13 

9 P. parvispora, P. hydropathica na 

P. inundata, P.sp.8 


Figure 1. Water bodies in nine regions of Western Australia sampled for 

Phytophthora species in October to December 2008. Some sites were 

sampled on four occasions. Region 6 is Perth. 


Waterways (streams, lakes, ponds and estuaries) in WA were 

sampled up to four times during October to early December 

2008. Sites were selected across 50 regional locations from 

Kununurra (northern site) to Esperance (southern site), and 37 

locations in the Perth suburbs (Figure 1, Table 1). Bait bags 

containing leaves of Banksia attenuata, Pittosporum sp., Hakea 

sp. and Quercus sp., and lupin seedlings were sent via overnight 

post to 16 volunteers who deployed, and retrieved and returned 

baits after ~10 days in the water. Leaves were plated onto 

NARPH agar plates, a medium selective for Phytophthora, and 

incubated in darkness for up to 2 weeks at 20°C during which 

plates were periodically checked for Phytophthora colonies. 

Colonies were isolated into pure culture and grouped into 

morpho‐types. One representative morpho‐type from each site 

per sampling was identified using the sequence of the ITS region 

of the rDNA, conducting a BLAST search on Genbank and a 

phylogenetic analysis (1). 


A total of eight Phytophthora species were isolated during the 

October to December 2008 survey of water bodies in nine 

regions of WA (Table 1). Species yet undescribed were assigned 

taxa numbers as described in (1). The most frequently isolated 

species in the southwest were P.sp.12 (VHS5185), P.sp.13 

P. hydropathica frequently isolated from irrigation water, was 

only isolated on two occasions; once in Perth and once in the 

north of WA from an irrigation channel (Table 1). Additionally, P. 

cinnamomi var. parvispora was only recovered once during the 

sampling, also from the irrigation channel in the north. Our 

results in relation to the Victorian study will be discussed. 


We thank all the volunteers who deployed and returned the 

baits and WWF for funding support. Additional assistance was 

provided by C. Fletcher, T. Paap, D. White and N. Williams. More 

information at www.f4p.murdoch.edu.au. 

REFERENCES 

1. Burgess TI, Webster JL, Ciampini JA, White D, Hardy GEStJ, Stukely 

MJC (2009) Re‐evaluation of Phytophthora species isolated during 

30 years of vegetation health surveys in Western Australia using 

molecular techniques. Plant Disease 93, 215–223. 

2. Smith BW, Smith IW, Cunnington J, Jones RH (2007) An evaluation 

of stream monitoring techniques for surveys for Phytophthora 

species in Victoria, Australia. In ‘Fourth Meeting of IUFRO Working 

Party 7.02.09 on Phytophthoras in Forests and Natural Ecosystems, 

26–31 August.’ Monterey, California, US. (Poster) 

3. Stukely MJC, Webster JL, Ciampini JA, Dunstan WA, Hardy GEStJ, 

Woodman GJ, Davison EM, Tay FCS (2007) Phytophthora inundata 

from native vegetation in Western Australia. Australasian Plant 

Pathology 36, 606–608. 



Incidence of fungi isolated from grape trunks in New Zealand vineyards 

D.C. Mundy{ XE "Mundy, D.C." } A , S.G. Casonato B and M. A. Manning B 

A 

The New Zealand Institute for Plant and Food Research Limited, Marlborough Wine Research Centre, PO Box 845, Blenheim, New 

Zealand 

B 

The New Zealand Institute for Plant and Food Research Limited, Mt Albert Research Centre, Private Bag 92169, Auckland Mail Centre, 

INTRODUCTION 

With the growth of the New Zealand wine industry in size and 

geographic distribution, the number of observations of grape 

vine trunk disease symptoms has increased. Within the industry, 

identification of fungi present in trunks of unthrifty vines has 

been a low priority. Previous studies have often focused on a 

single genus (1) or regional record of disease (2). 

In order to reduce the impact of trunk diseases in New Zealand 

vineyards, it is important first to establish which fungi are 

present. This survey is a preliminary investigation of the range 

and incidence of fungi isolated from trunk wood across a 

number of vineyard sites in New Zealand. 

New Zealand 

Table 1. Recoveries of fungal genera regarded as wood pathogens from 

a survey of thirty‐seven vineyard blocks. The survey of incidence of 

fungi was conducted in the North and South Islands of New Zealand 

during 2007 and 2008. 

Genus 

North Is. 

n=24 

South Is. 

n=13 

Botryosphaeria 20 5 

Phaeomoniella 19 3 

Phaeoacremonium 3 0 

Phomopsis 8 3 

Cylindrocarpon 2 3 

Eutypa 12 8 


Field survey. A survey was conducted on vines from 37 vineyard 

blocks in the North and South Islands of New Zealand. Core 

samples were taken from the trunks of five vines at each site, 

using a MATTSON N° 4333 forestry corer. This device removed a 

5‐mm core approximately 80 cm up the trunk, passing directly 

through the wood until the bark was ruptured on the far side. 

The corer was cleaned between samples with 70% ethanol to 

prevent cross contamination. The entire core sample was 

transferred in a sterile tube to the laboratory. 

Isolations. Each core was surface sterilised for 30 sec in 70% 

ethanol, 2 min in 3.5% w/v sodium hypochlorite and 30 sec in 

70% ethanol. Samples were cut into 5–10 mm pieces and placed 

on potato dextrose agar (PDA; DIFCO) amended with 100 µg/mL 

streptomycin sulphate and 100 µg/mL Penicillin G potassium 

salts and incubated at 20°C with lights (12 h photoperiod). 

Identification. After one week, fungi were identified by 

morphological features and confirmed by amplifying the internal 

transcribed spacer regions of the rDNA using the polymerase 

chain reaction (PCR) primers ITS1‐F and ITS‐4. PCR products were 

sequenced using the BigDye Terminator V. 3.1 cycle sequencing 

kit (Applied Biosystems, UK). The resultant sequences were 

characterised by Basic Local Alignment Search Tool analysis from 

the most closely related sequences on GenBank. Fungal 

morphological characteristics were re‐examined after a month 

to confirm identification further and to allow time for slower 

growing fungi to be isolated and identified. Not all fungi were 

identified to the species level so results are given as a summary 

by genera. 

RESULTS 

The most commonly isolated fungi were species of the genera 

Botryosphaeria, Phaeomoniella and Eutypa at multiple sites 

(Table 1). Less commonly, Phaeoacremonium spp. and 

Cylindrocarpon spp. isolates were also found. The same genera 

were not isolated from all 37 sites sampled. Phaeoacremonium 

sp. were found only in Hawke’s Bay, although the other fungal 

isolates were not confined to a single region. Other fungi 

isolated during the survey included species of Acremonium, 

Alternaria, Cadophora, Cladosporium, Epicoccum, Gliocladium, 

Mucor, Penicillium, Phoma, Trichoderma, Ulocladium and 

Xylaria. 

DISCUSSION 

The incidence of species of Botryosphaeria, Phaeomoniella and 

Eutypa in many of the vineyard blocks surveyed suggests that 

these fungi should be the focus of more detailed research to 

establish their importance to the industry. The isolation of a 

fungus from a block does not prove that it is the organism 

responsible for the disease symptoms. If multiple fungi are 

present, the incidence does not allow the determination of 

which fungi are the most likely to be causing symptoms at that 

site. 

As the sample size in each vineyard block was limited, we cannot 

be certain that failure to detect a particular species indicates 

that these fungi were not present. For example additional 

isolations will be needed to determine if Phaeoacremonium is 

restricted to Hawke’s Bay only. 


Funding for this project was provided by the Ministry of 

Agriculture and Forestry Sustainable Farming Fund and the 

Marlborough Wine Research Centre Trust. We would also like to 

thank all industry representatives who allowed us to sample 

vines. 

REFERENCES 

1. Amponsah NT, Jones EE, Ridgway HJ, Jaspers MV 2008. Production 

of Botryosphaeria species conidia using grapevine green shoots. 

New Zealand Plant Protection 61: 301–305. 

2. Mundy DC, Manning MA 2006. Initial investigation of grapevine 

trunk health in Marlborough, New Zealand. 5th International 

Workshop on Grapevine Trunk Diseases. Department of Plant 

Pathology University of California, Davis, CA. 


Isolation and characterisation of strains of Pseudomonas syringae from waterways of 

the central North Island of New Zealand 

J.L. Vanneste{ XE "Vanneste, J.L." } A , D.A. Cornish A , J. Yu A , and C.E. Morris B 

A 

The New Zealand Institute for Plant and Food Research Limited, Ruakura Research Centre, Private Bag 3123, Hamilton, New Zealand 

B 

INRA, UR 407 Pathologie Végétale, F‐84140 Montfavet, France 

INTRODUCTION 

Epiphytotics of plant bacterial diseases can occur where 

previously no or little inoculum was thought to be present. The 

source of the primary inoculum of these epiphytotics is not 

always easy to determine, especially for pathogenic bacteria, 

which are good epiphytes, such as Pseudomonas syringae, one 

of the most economically important bacterial plant pathogens. 

This project aimed to determine whether rivers from the Central 

North Island of New Zealand could constitute a reservoir for P. 

syringae. P. syringae is a complex group of strains which can be 

grouped in about 50 different pathovars (strains which have the 

same pathogenicity and the same host range) or in nine 

genomospecies (strains which belong to the same species based 

on DNA/DNA homology) (1). In this study we isolated some 

strains of P. syringae and tried to determine to which 

genomospecies or which pathovar they belong based on 

polymerase chain reaction (PCR) experiments. 


Collection of water samples and isolation of bacteria. Water 

samples were collected from the Waikato River (Hamilton) and 

from the Whakapapanui Stream (Tongariro National Park). The 

isolation of bacteria was carried out as described previously (4). 

Ten strains from Whakapapanui and five strains from the 

Waikato River, which showed all the characteristics of strains of 

P. syringae: ability to produce a fluorescent pigment on a 

modified King’s B medium, ability to cause a hypersensitive 

reaction when infiltrated into tobacco plant, absence of a 

cytochrome c oxidase and inability to utilise arginine, were 

retained for further characterisation. 

Characterisation by Polymerase Chain Reaction (PCR). All PCR 

experiments were carried out on an Eppendorf Mastercycler® 

Gradient using 20 ng of total DNA per reaction. The final reaction 

volume was 30 μl including 10 μM of each primers and 1 unit of 

i‐Taq from INtRON Biotechnology Inc. The primers and the 

programs were those published earlier (e.g. 2). For each 

experiment, a negative control, in which the DNA solution was 

replaced by water, and a positive control, in which the DNA was 

that of a strain we knew would give a positive reaction, were 

used. Of the 15 strains analysed, five gave a positive reaction 

with primers specific to strains of genomospecies 1, which is 

represented by P. syringae pv. syringae. None gave a positive 

response with primers specific for strains of genomospecies 2, 

which is represented by P. syringae pv. phaseolicola and P. 

syringae pv morsprunorum. None gave a positive response when 

PCR protocols specific for P. syringae pv. papulans, P. syringae pv 

tagetis, P. syringae pv helianthi or P. syringae pv actinidiae were 

used. 

water cycle, as proposed by Morris et al. (3). In this scenario, rain 

and melt water containing cells of P. syringae feed streams and 

rivers that bring those cells of P. syringae in contact with wild 

and cultivated plants. The subsequent multiplication of these 

bacteria as pathogens or epiphytes provides a huge inoculum, 

part of which might form aerosols that can be taken up by 

clouds. The ability of some of these bacteria to induce ice 

nucleation might help the formation of rain and/or snow and 

explain the presence of these bacteria in rain and snow. 

Although strains of P. syringae have been found in a river and a 

stream fed by melt water, to complete the cycle we need to 

demonstrate that those same strains are also found on or in 

plants as epiphytes or as pathogens. The characterisation of the 

strains of P. syringae isolated from New Zealand waterways 

would allow this demonstration. The characterisation is 

continuing, with more strains being analysed including strains 

being isolated from different waterways, and with more 

techniques being utilised including molecular techniques 

different from PCR. 


We thank The New Zealand Institute for Plant and Food 

Research Limited for their support. 

REFERENCES 

1. Gardan L, Shafik H, Belouin S, Broch R, Grimont F, Grimont PDA 

1999. DNA relatedness among the pathovars of Pseudomonas 

syringae and description of Pseudomonas tremae sp. nov. and 

Pseudomonas cannabina sp. nov. (ex Sutic and Dowson 1959). 

International Journal of Systematic Bacteriology. 49: 469–478. 

2. Kerkoud M, Manceau C, Paulin J‐P 2002. Rapid diagnosis of 

Pseudomonas syringae pv. papulans, the causal agent of blister 

spot of apple, by polymerase chain reaction using specifically 

designed hrpL gene primer Phytopathology 92: 1077–1083. 

3. Morris CE, Sands DC, Vinatzer BA, Glaux C, Guilbaud C, Buffiere A, 

Yan S, Dominguez H Thompson BM (2008) The life history of the 

plant pathogen Pseudomonas syringae is linked to the water cycle. 

The International Society for Microbial Ecology Journal 1, 1–14. 

4. Vanneste JL, Cornish DA, Yu J, Boyd RJ, Morris CE (2008) Isolation of 

copper and streptomycin resistant phytopathogenic Pseudomonas 

syringae from lakes and rivers in the Central North Island of New 

Zealand. New Zealand Plant Protection 61, 80–85. 


DISCUSSION 

Strains of P. syringae were isolated from two different water 

systems: the Waikato River, a complex system which includes 

lakes and goes through some cultivated and non cultivated 

lands, and the Whakapapanui Stream, which is fed by melt water 

from Mount Ruapehu and does not cross cultivated lands. These 

results and similar ones presented earlier (3) support the 

hypothesis that the life history of P. syringae is linked to the 


Session 5C—Chemical control 

INTRODUCTION 

Evaluation of fungicides to manage brassica stem canker 

B.H. Hall, L. Deland{ XE "Deland, L." }, B. Rawnsley, T. Barlow, C. Hitch and T.J. Wicks 

South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001, South Australia 

Leptosphaeria maculans and Rhizoctonia solani AG 2.1, 2.2 and 4 

are the dominant soil borne fungal pathogens causing Brassica 

stem canker (1). Brassica stem canker causes stem rot, resulting 

in plant collapse before harvest or stem breakage during 

harvest. Greenhouse trials were undertaken to evaluate preplanting 

and post‐planting fungicide drenches for the control of 

R. solani AG 2.1, 2.2 and 4 and L. maculans. 


R. solani. Coco peat potting mix was inoculated with either AG 

2.1, 2.2 or 4 by mixing in a 1L slurry of 12 macerated plates of 5– 

7 day old cultures grown on potato dextrose agar (PDA). The 

inoculated mix was placed into MK12 pots and incubated in the 

greenhouse at 22°C for 7 days to allow the Rhizoctonia to 

establish in the soil. 

Six‐week‐old susceptible cauliflower speedlings (cv. Chaser) (2) 

were immersed in a fungicide mix (Table 1) for 5 mins to ensure 

the fungicide had permeated the soil and root matrix before 

planting into the inoculated soil mix. Ten replicate plants were 

used per treatment, with a water drench used as the control 

treatment. 

Plants were maintained in a greenhouse at 22°C and assessed 

weekly for stem canker using a disease severity rating scale of 0– 

100 where; 0 = healthy, 20 = superficial staining, 40 = canker 

girdling ½ stem, 60 = canker girdling full stem, 80 = severe canker 

(wilt) and 100 = plant death. The presence of R. solani in the pots 

was confirmed 4–6 weeks after planting by baiting with 

toothpicks, whereby toothpicks were placed in the pots for 24 

hrs, washed and incubated on PDA (3). 

L. maculans. Four‐‐week‐old cauliflower seedlings cv. Chaser 

were planted into MK12 pots with coco peat. Six replicate plants 

were treated with 30 ml each of fungicide drench (Table 2) 

applied to the soil surface either two days before or two days 

after mycelial plug inoculation (2). Plants were maintained and 

assessed similarly to the R. solani trial. 


R. solani. All controls were infected with R. solani, AG 2.1 being 

the most virulent and AG 2.2 the least virulent, with 100% and 

70% of untreated plants infected respectively. None of the 

fungicides effectively controlled the disease; however Amistar, 

Cabrio, Maxim, Sumisclex and Jockey did reduce the severity 

(Table 1). The different AG groups responded differently to the 

fungicides, for example Rizolex at 0.4ml/L did not suppress AG 

2.1 or 4, but was effective against AG 2.2. R. solani was detected 

in soil from all treatments (data not presented). 

L. maculans. The disease developed slowly, with symptoms not 

showing on many plants until 10 weeks after inoculation. All 

control plants were infected, and none of the treatments were 

effective when applied after inoculation (Table 2). Maxim, Cabrio 

and Rovral provided some suppression of disease when applied 

before inoculation, and complete control was achieved with a 

pre‐ plant drench of the higher rate of Amistar. 

Table 1. Mean per cent severity of stem canker symptoms on plants 8 

weeks after being drenched with a fungicide prior to planting into R. 

solani inoculated soil. 

Treatment Rate /L AG2.1 AG2.2 AG4 

Untreated 74 24 46 

Sumisclex 500 0.75ml 18 12 18 

Rizolex liquid 0.2ml 78 14 42 

Rizolex liquid 0.4ml 62 2 82 

Jockey 1ml 10 6 26 

Terrachlor 2g 52 16 24 

Rovral Aquaflo 0.5ml 36 6 36 

Rovral Aquaflo 1ml 30 6 34 

Amistar 0.5ml 20 4 10 

Amistar 1ml 16 10 14 

Cabrio 0.4ml 16 12 22 

Maxim 0.4ml 16 6 10 

L.S.D (P=0.05) 14.5 12.7 17.0 

Table 2. Per cent incidence (inc) and severity (sev) of stem canker 

symptoms on plants drenched with fungicides and inoculated with L. 

maculans before or after treatment. 

Pre inoc. 

Post inoc. drench 

drench 

Treatment Rate /L Inc Sev Inc Sev 

Untreated 100 70 100 27 

Sumisclex 500 0.75ml 100 40 100 67 

Rizolex liquid 0.2ml 67 17 83 27 

Rizolex liquid 0.4ml 83 30 100 27 

Jockey 1ml 83 27 100 24 

Terrachlor 2g 100 20 100 30 

Rovral Aquaflo 0.5ml 83 17 100 44 

Rovral Aquaflo 1ml 17 3 100 23 

Amistar 0.5ml 50 14 67 24 

Amistar 1ml 0 0 67 20 

Cabrio 0.4ml 33 7 100 27 

Maxim 0.4ml 33 7 67 20 

LSD (P=0.05) ‐ 16.2 ‐ 16.5 

CONCLUSION 

No fungicide treatments were effective in controlling stem 

canker; however suppression was achieved with a pre planting 

drench of either Amistar, Cabrio or Maxim. 


This project was facilitated by HAL in partnership with AUSVEG 

and was funded by the National Vegetable Levy. The Australian 

Government provides matched funding for all HAL’s R&D 

activities. 

REFERENCES 

1. Hitch C.J. et al (2006). Identifying the cause of brassica stem 

canker. 4th Australasian Soilborne Diseases Symposium, NZ, 2006. 

2. Hall, B. et al (2009). Varietal resistance of cauliflower cultivars to 

soilborne diseases Rhizoctonia solani and Leptosphaeria maculans. 

5th Australasian Soilborne Diseases Symposium, NSW, 2009. 

3. Paulitz TC & Schroeder KL (2005) A new method for the 

Quantification of Rhizoctonia solani and R. oryzae from soil. Plant 

Disease 89, 767–772. 


Evaluation of spray programs for powdery mildew management in greenhouse 

cucumbers 

INTRODUCTION 

K.L Ferguson{ XE "Ferguson, K.L." }, B.H. Hall and T.J. Wicks 

South Australian Research and Development Institute, GPO Box 397, Adelaide SA 5001 

Powdery mildew (Podosphaera xanthii) is a serious disease of 

greenhouse cucumbers worldwide causing defoliation and 

premature senescence of crops. The disease is mainly managed 

with fungicides and management is becoming increasingly 

difficult due to fungicide resistance and the lack of registered 

products for greenhouse use. Trials were conducted to examine 

spray intervals for conventional fungicides and to determine 

whether ‘soft’ products could be effectively incorporated into 

spray programs for powdery mildew. 


Spray program trials were conducted on cucumber plants in a 

research greenhouse. In the first trial various fungicide programs 

were compared at spray intervals of 7 or 14 days (Table 1). The 

second evaluated programs incorporating ‘soft’ products that 

were effective in preliminary screening trials (Table 2). Two week 

old seedlings were exposed to infected plants (Day 0) and 

exposure continued for the entire trial. Sprays commenced at 

day 14, with 10 plants per treatment. Severity of powdery 

mildew was assessed on leaves on day 0 and then every 7 days 

on sprayed leaves. Relative Area Under Disease Progression 

Curves (RAUDPC) (1) for each spray program were analysed with 

ANOVA (Statistix 8). 


All 7 day interval programs reduced the severity of powdery 

mildew significantly more than the 14 day programs. Although 

the program with Bayfidan ® and Cabrio ® at 14 day intervals had 

significantly more disease than the 7 day programs, the disease 

level may still be commercially acceptable (Figure 1; Table 1). 

Table 2. Spray schedules and Relative Area Under Disease Progress 

Curves (RAUDPC) for trial examining ‘soft’ products in conventional spray 

programs. 

Day 14 Day 28 Day 42 Day 56 RAUDPC 

A R A R 4.26 a 

M M Bi Bi 5.15 ab 

E A E A 6.57 ab 

M M B B 6.92 b 

B A B A 7.39 bc 

B R B R 9.74 c 

Untreated control 

21.98 d 

A=Amistar ® 250SC (250g/L azoxystrobin) 0.8mL/L; M=Morestan ® (250g/kg 

oxythioquinox) 0.4g/L; B=Bayfidan ® 250EC (250g/L triadimenol) 0.4mL/L; 

Bi=BioCover ® (840g/L petroleum oil) 10mL/L; E=Ecocarb ® (940g/kg potassium 

bicarbonate) 4g/L +Synertrol ® HortiOil (905g/L emulsifiable botanical oil) 2.5mL/L; 

R=Rezist ® 1.5mL/L+Sett Enhanced 2mL/L ® . Means with the same letter are not 

significantly different (P

Session 5C—Chemical control 

The incidence of copper tolerant bacteria In Australian pome and stone fruit orchards 

INTRODUCTION 

S.C. Gouk{ XE "Gouk, S.C." }. A , E. Mace B and EA. Byrne B 

A Department of Primary Industries, Private Bag 15, Ferntree Gully Business Centre, 3156, Victoria 

B Department of Primary Industries, Private Bag 1, Ferguson Road, Tatura, 3616, Victoria 

Australian pome and stone fruit production relies heavily on 

copper‐based fungicides for control of bacterial diseases 

including bacterial blast and bacterial canker (Pseudomonas 

syringae). Copper fungicides have had a long history of use for 

control of fungal diseases and general clean up during the 

dormant period. The impact of their long term application on 

development of copper tolerant bacterial populations in fruit 

orchard is not known. The authors had initiated collection and 

screening of copper tolerant bacteria from Australian pome and 

stonefruit fruit orchards since 2007. This study presents an 

analysis of the copper tolerant (CuT) bacterial populations 

detected in the 2008–2009 growing season. 


Pome and stone fruit blossoms were collected during the spring 

of 2008, from major fruit growing regions in Victoria, New South 

Wales, Queensland, Tasmania and South Australia. Up to four 

samples consisting of ten blossoms, one from each tree, were 

collected from monitored orchard block. Each sample was 

washed in 5 ml sterile distilled water and a 0.1 ml aliquot was 

spread on Pseudomonas Fluorescent Agar (PFA, Difco). Pure 

cultures were obtained by repeated streaking and dilution 

plating. The purified bacteria were characterised based on 

cultural and biochemical properties: namely, production of 

fluorescent pigments, hypersensitivity reaction on tobacco, and 

oxidase, levan and arginine reactions (1,2). Whilst additional 

tests are being conducted to further identify the bacteria, for the 

purpose of this report, they were categorised as fluorescent 

Pseudomonas spp., yellow bacteria, and non‐fluorescent, nonyellow 

(NFY) bacteria. 

The sensitivity of bacteria to copper ions was tested using a ten 

fold dilution of a slightly turbid bacterial suspension, yielding 

10 6 –10 8 colonly forming units, determined by dilution plating on 

PFA. Four 10 ul drops of each bacterial suspension were added 

to casitone‐yeast‐extract medium (3) amended with 0, 0.16, 

0.32, 0.48 and 0.64 millimolar (mM) of copper sulphate (Cu). 

Formation of bacterial colony was assessed after incubation at 

27±1°C for 3 days. 

RESULTS 

A total of 315 isolates comprising 155, 77 and 83 Pseudomonas, 

spp., yellow bacteria, and NFY bacteria respectively were tested 

for sensitivity to Cu ions (Table 1). 

Table 1. The incidence of copper tolerant bacteria in pome and stone 

fruit orchards in the 2008–2009 season. 

Pseudomonas 

spp. Yellow bacteria NFY bacteria 

Source Tot CuT Tot CuT Tot CuT 

Apple and pear 68 44 36 5 51 16 

Stone fruit 87 65 41 6 32 17 

Total 155 106 77 11 83 33 

NFY—Non‐fluorescent, non‐yellow bacteria. 

Tot—Total number of bacterial isolates tested. 

CuT—Number of copper tolerant bacterial isolates. 

DISCUSSION 

The findings indicate detection of CuT bacteria in pome and 

stone fruit orchards for the first time in Australia. The detection 

of high proportions of CuT bacteria suggests the potential risk of 

selection pressure associated with application of copper sprays. 

The implication of this finding on the effectiveness of copperbased 

sprays, which is the only chemical treatment available for 

the control of bacterial diseases, needs further research. Further 

evaluation of the impact of copper sprays on CuT bacterial 

populations is required to determine the continued efficacy of 

copper‐based bactericides. 


Funding from DPI, Victoria; Horticulture Australia Limited, Apple 

and Pear Australia Limited, Canned Fruit Industry Council of 

Australia and Fruit Grower Victoria. Collaborators: A. Steinhauser 

(FGT, Tasmania), S. Hetherington, A. Moorey (DPI NSW), P. 

James (PIRSA, SA), L. Haselgrove (QDPI, Queensland). 

REFERENCES 

1. Lelliot RA, Billing E, Hayward, AC (1966) A determinative scheme 

for the fluorescent plant pathogenic pseudomonads. J. Applied 

Bacteriol. 29, 470–489. 

2. Schaad NW (2001) Initial identification of common bacteria. In 

Laboratory guide for identification of plant pathogenic bacteria. 

(Eds NW Schaad, JB Jones, W Chun) pp. 1–16. (APS Press: 

Minnesota) pp. 373. 

3. Andersen GL et al. (1991) Occurrence and properties of copper 

tolerant strains of Pseudomonas syringae isolated from fruit trees 

in California. Phytopathology 81, 648–656. 

The number of isolates that were able to form confluent colony 

at 0.32 mM Cu (CuT), the threshold concentration for tolerance 

to copper ions (4), are presented in Table 1. 

Overall, 47.6% of the isolates tested were CuT. Twenty‐seven 

CuT isolates were potentially plant pathogenic based on their 

ability to induce hypersensitivity (HR+) response in tobacco. Of 

155 isolates from apple and pear hosts, 40.0% were CuT, but 

only 10 isolates i.e. 6.5%, were both CuT and HR+. Six 

Pseudomonas spp. from pome fruit were CuT and HR+, but 

fourteen CuT and HR+ isolates were obtained from stone fruit 

hosts. Whilst more than half (68.4%) of the Pseudomonas spp. 

from both pome and stone fruits were CuT, only 14.3 and 39.8% 

of yellow and NFY bacteria respectively were CuT. 


Lessons from the tropics—the unfolding mystery of vascular‐streak dieback of cocoa, 

the importance of genetic diversity, horizontal resistance, and the plight of farmers 

P.J. Keane{ XE "Keane, P.J." } 

Department of Botany, La Trobe University, Bundoora Victoria 3086, Australia 

Cocoa in Papua New Guinea and South‐East Asia has been 

devastated by a mysterious dieback disease at least since the 

rapid expansion of planting in the 1950s. Investigations into the 

nature of this disease, its control and the ongoing mystery 

surrounding it will be described as an example of unusual 

biology likely to be common in the relatively unexplored biology 

of the wet tropics. The incredible genetic diversity of plant 

communities and its importance especially in the wet tropics will 

be introduced in relation to disease control in food crops and 

selection of resistance to vascular‐streak dieback of cocoa. The 

nature of the durable resistance of cocoa to vascular‐streak 

dieback will be discussed as a tribute to J.E. van der Plank. 

Recent changes in the nature of the disease found during a 

current ACIAR project in Sulawesi will be described as an 

example of the uncertainty of human knowledge in the face of 

ever‐changing biology. Finally, the plight of cocoa farmers facing 

serious pest and disease problems in the region will be discussed 

as an example of the poor situation of farmers throughout the 

world. 

McAlpine lecture 



Translating research into the field: how it started, how it is practised and how we 

carry out grape powdery mildew research 

Robert Seem{ XE "Seem, R." } 

Department of Plant Pathology and Plant‐Microbe Biology, Cornell University, Geneva, New York 14456 USA 

INTRODUCTION 

To understand research translation, it is helpful to understand 

our past efforts to extend knowledge, especially agricultural 

knowledge, to those who need and benefit from that 

information. The traditional term to define this process is 

Extension. Extension as it exists today in the United States has a 

rich history of nearly 150 years. We will examine the 

development of the Cooperative Extension Service in the US, 

especially at the time (mid 19th century) when educational and 

research institutions were evolving dramatically (1). In that era 

of change, colleges began to be more egalitarian and outward 

looking (extension). Extension has survived and grown over the 

years, but some of the mission fervour had faded. A renewed 

commitment to extension is now embodied within the latest 

buzzword of the 21st century: engagement. We will examine 

how extension and engagement influence research using the 

example of grapevine powdery mildew. We will consider what 

drives the process and how we can sustain it. Some final 

reflections look towards the future and thoughts on the value of 

translating research to the field. 

EXTENSION’S CREATION AND TRANSITION TO ENGAGEMENT 

The Genesis of Extension It was during the American Civil War 

that an innovative approach was taken to permit a broadened 

reach of higher education. The Morrill Act of 1862 established a 

federal partnership with states to establish centres of learning 

for agriculture and the mechanic arts. The act provided tracts of 

federal land for states to use or sell in order to creat “landgrant” 

colleges. Shortly thereafter (1865) Cornell University was 

established as New York State’s land‐grant college. Almost thirty 

years later (1894) Cornell’s first professor of horticulture, Liberty 

Hyde Bailey, implemented the nation’s first extension program, 

“a plain, earnest, and continuous effort to meet the needs of the 

people on their own farms and in the localities.” 

Extension in the 21st Century Fast forward to 2009, and the 

modern Extension Service remains one of the very unique 

features of American agriculture. However, it has moved beyond 

farmers and addresses many aspects of rural and urban life. In 

an analysis of the future of the land‐grant universities, the 

Kellogg Commission exhorted these institutions to become 

“engaged universities” (2). By engagement they refer to 

institutions that have redesigned their teaching, research, and 

extension and service functions to become even more 

sympathetically and productively involved with their 

communities, however community may be defined.” 

MEETING THE CHALLENGE 

So how does this new engagement play out for a university 

researcher who has no official extension responsibility? For 

those of us who carry out mission‐oriented research we are 

always asking two questions: What are the challenges facing the 

industry? How does my research address those challenges? In 

the context of plant pathology, our first goal is to carry out good 

science; but our science is always focused on solving problems as 

we expand our knowledge. 

GRAPEVINE POWDERY MILDEW CHALLENGES WE HAVE 

ADDRESSED 

Over the past 30 years with the assistance of colleagues and 

students we have examined, and in some cases, redefined the 

role and impact of Erysiphe necator on grape, always driven by 

industry needs (e.g., 3‐5): 

• The importance of early‐season disease management 

• The role of cleistothecia in epidemics 

• Environment, ascospore release, and infection 

• Early season disease spread within vineyards 

• Effect of cold nights on mildew development 

• Ontogenic resistance in grape berries 

• Heterogeneity of berry development and susceptibility 

• Diffuse mildew infection on berries and wine quality 

• Signals that turn sporulation on and off 

• Biological control of powdery mildew by Tydeid mites 

CONCLUSIONS 

Our research on the biology and epidemiology of grape powdery 

mildew has had a major impact on grape production in New York 

and has influenced research and extension programs throughout 

the US and beyond. The program is not substantially different 

from many other mission‐oriented research programs, but for 

those who seek to translate research to the field, this is what we 

have learned: 

• Be grounded – understand and appreciate agriculture 

• Observe; look at the big picture, but mind the little stuff 

• Know your patients and your pathogens 

• Become engaged; know your stakeholders and deal with 

them as peers 

• Write proposals that are clear succinct, and interesting 

• Collaborate, locally and professionally 

• Train the next generation; get them excited about 

translational research 

• Have fun while doing all this! 


For their vital collaborations, I thank David Gadoury and the labs 

of Wayne Wilcox, Greg Loeb, Thomas Henick‐Kling, Lance Cadle‐ 

Davidson, and Ian Dry. 

REFERENCES 

1. Boyer, EL (1990) Scholarship reconsidered: priorities of the 

professoriate. (Carnegie Foundation for the Advancement of 

Teaching: Princeton, NJ) 147pp. 

2. Kellogg Commission on the Future of State and Land‐Grant 

Universities (1999) Returning to our roots: The engaged institution, 

Report 3. (National Association of State Universities and Land‐ 

Grant Colleges: Washington DC) 57 pp. 

3. English‐Loeb, G, Norton, AP, Gadoury, D, Seem, RC, and Wilcox, WF 

(2007) Biological control of grape powdery mildew using 

mycophagous mites. Plant Dis. 91, 421‐429. 

4. Gadoury, DM, Seem, RC, Ficke, A, and Wilcox, WF (2003) Ontogenic 

resistance to powdery mildew in grape berries. Phytopathology 93, 

547‐555. 

5. Gadoury, DM, Seem, RC, Wilcox, WF, Henick‐Kling, T, Conterno, L, 

Day, A, and Ficke, A (2007) Effects of diffuse colonization of grape 

berries by Uncinula necator on bunch rots, berry microflora, and 

juice and wine quality. Phytopathology 97, 1356‐1365. 


Stem rust race Ug99: international perspectives and implications for Australia 

INTRODUCTION 

R.F. Park B , H.S. Bariana B and C.R. Wellings{ XE "Wellings, C.R." } A,B 

The University of Sydney, Plant Breeding Institute, PMB 11, Camden, 2570, NSW 

B seconded to The University of Sydney, Plant Breeding Institute, PMB 11, Camden, NSW 2570 

Stem rust of wheat, caused by Puccinia graminis f. sp. tritici 

(Pgt), is one of the most feared plant diseases. It was particularly 

problematic in early efforts to grow wheat in Australia, being 

described by McAlpine (1) as “positively injurious”. Reports of 

losses in Australia include £400,000 in 1903, £2 million in 1916, 

£7 million in 1947, and $200 to 300 million in 1973 (2). 

Concerted efforts to control the disease with genetic resistance 

began with the release of cultivar Eureka in 1938, and have led 

to a decline in the incidence of the disease and in the frequency 

of epidemics. 

The detection of stem rust race “Ug99” in Uganda in 1999 has 

had significant implications for the control of stem rust. 

Referring to “Ug99”, Nobel Laureate Dr Norman Borlaug, stated 

“The prospect of a stem‐rust epidemic in wheat in Africa, Asia, 

and the Americas is real and must be stopped before it causes 

untold damage and human suffering” 

(http://www.sciencenews.org/articles/20050924/food.asp). 

PATHOGENIC VARIABILITY IN AUSTRALIA 

Annual pathogenicity surveys of Pgt conducted at the University 

of Sydney since 1919 have provided a sound basis for rust 

resistance breeding efforts. These surveys have revealed 3 

incursions of 4 exotic Pgt isolates, all of which had significant 

impacts on wheat production, highlighting the importance of 

current exotic threats such as Pgt race “Ug99”. The surveys have 

also shown clear evidence of the importance of pathogen 

aggressiveness, of single step mutation and of somatic 

hybridisation in overall pathogen population structure (2). 

STEM RUST RACE Ug99 

Since its first detection in Uganda in 1999, “Ug99” has been 

detected in Kenya, Ethiopia, Sudan and Yemen, and in 2007 was 

detected in Iran (3). It carries virulence matching many 

resistance genes in hexaploid wheat: genes rendered ineffective 

are Sr5, Sr6, Sr7b, Sr8a, Sr8b, Sr9a, Sr9b, Sr9d, Sr9e, Sr9g, Sr11, 

Sr15, Sr17, Sr21, Sr30, Sr31, and Sr38; those that remain 

effective are: Sr7a, Sr13, Sr22, Sr24, Sr25, Sr26, Sr27, Sr28, Sr29, 

Sr32, Sr33, Sr35, Sr36, Sr37, Sr39, Sr40 and Sr44. Of particular 

concern is virulence for gene Sr31, one of the most widely 

deployed stem rust resistance genes, which remained effective 

until the detection of “Ug99”. Since its first detection, two 

presumed mutational derivatives with virulence for Sr24 (4) and 

for Sr36 (5) have been detected in Kenya (4), and a race with 

identical virulence but lacking virulence for Sr31 has been 

detected in South Africa (6). 

“Ug99” has had a large impact on a wide range of international 

wheat germplasm. In response, the Borlaug Global Rust Initiative 

(BGRI) was launched in Kenya in 2005 and acknowledged the 

threat of “Ug99” to stable wheat production in eastern Africa, 

and also recognised the threat posed to many other parts of the 

world. More recently, an international project, “Durable Rust 

Resistance in Wheat” was funded by the Bill and Melinda Gates 

Foundation and is managed by Cornell University. This project 

has a range of activities that include pre‐breeding, rust pathogen 

surveillance and cultivar deployment. 

IMPLICATIONS FOR AUSTRALIA 

The Australian Cereal Rust Control Program (ACRCP) provides 

support to all groups engaged in cereal breeding in Australia, 

and undertakes research on the pathology and genetics of rust 

diseases. This strategy has led to a robust understanding of the 

resistance genes deployed in Australia, and a resulting ability to 

predict response of Australian germplasm to new rust races such 

as “Ug99”. These predictions have been refined by field testing 

germplasm in Kenya with the assistance of the Kenyan 

Agricultural Research Institute from 2005–07. Because Sr31 has 

not been used widely in Australia, the greatest impact of “Ug99” 

on germplasm to date has been due to virulence for Sr30, 

combined virulence for Sr38 with other genes, and more 

recently, virulence for Sr24 and Sr36. While virulences for Sr30, 

Sr36 and Sr38 have been detected in Australia, virulence for Sr24 

has not. The genes Sr2, Sr12, Sr13, Sr22 and Sr26, effective 

against “Ug99” and derivatives, are important contributors to 

the resistance present in current germplasm. 

CONCLUDING COMMENTS 

Although “Ug99” may never reach our shores, it must be 

regarded as a serious exotic rust threat. Whilst acknowledging 

this, it is equally important not to forget other exotic rust 

threats, including races of endemic cereal rust pathogens, plus 

the cereal rust diseases that do not occur here (stripe rust of 

barley, Puccinia striiformis f. sp. hordei; leaf rust of durum 

wheat, Puccinia sp. Group II Type A; crown rust of barley, P. 

coronata var. hordei. 


The Australian Cereal Rust Control Program is supported 

financially by the Grains Research and Development 

Corporation, Australia. 

REFERENCES 

1. McAlpine D (1906) ‘The Rusts of Australia. Their Structure, Nature, 

and Classification’. (Department of Agriculture, Victoria: 

Melbourne). 

2. Park RF (2007) Stem rust of wheat in Australia. Australian Journal of 

Agricultural Research 58, 558–566. 

3. Narari K, Mafi M, Yayhaoui A, Singh RP, Park RF (2009). Detection 

of wheat stem rust (Puccinia graminis f. sp. tritici) race TTKS (Ug99) 

in Iran. Plant Disease 93, 317. 

4. Jin Y, Szabo LJ, Pretorius ZA, et al. (2008). Detection of virulence to 

resistance gene Sr24 within race TTKS of Puccinia graminis f. sp. 

tritici. Plant Disease 92, 923–926. 

5. Jin Y, Szabo LJ, Rouse MN et al. (2009) Detection of virulence to 

resistance gene Sr36 within the TTKS race lineage of Puccinia 

graminis f. sp. tritici. Plant Disease 93, 367–370. 

6. Visser B, Herselman L, Pretorius ZA (2009) Genetic comparison of 

Ug99 with selected South African races of Puccinia graminis f. sp. 

tritici. Molecular Plant Pathology 10, 213–222. 

Session 6A—Cereal pathology 1 



Mitigating crop losses due to stripe rust in Australia: integrating pathogen population 

dynamics with research and extension programs 

INTRODUCTION 

C.R. Wellings{ XE "Wellings, C.R." } A,B and K.R. Kandel B 

A NSW Department Primary Industries, seconded to 

B The University of Sydney, Plant Breeding Institute, PMB 11, Camden, NSW 2570 

Wheat stripe rust (caused by Puccinia striiformis f. sp. tritici, Pst) 

was first recorded in Australia in 1979 and became endemic to 

the eastern Australian wheat zone causing serious losses in the 

mid eighties (1). Concerted pathology and breeding R&D 

combined with industry adoption of resistant varieties resulted 

in minimal losses for nearly 20 years. The first report of stripe 

rust in Western Australia in 2002 was the result of a foreign 

pathotype incursion (2). This aggressive pathotype widened its 

distribution in following years to encompass the entire 

Australian wheat production zone, and caused serious losses 

including increased annual fungicide expenditure ranging from 

$AUD40–90million (1). 

The stripe epidemic in eastern Australia in 2008 was the most 

intensive in the 30 year history of the disease in Australia. The 

dynamics of host resistance and pathogen variability gave rise to 

a situation that required a close connection between extension 

and research staff in order to maximise the available resources 

of host resistance and fungicide availability. This paper presents 

details of the epidemic development and the interplay of variety 

resistance and pathogen population dynamics during the 2008 

season. 


Rust samples collected and forwarded to PBI by co‐operators 

(advisors, farmers, researchers) were assessed for pathotype 

determination using described methods (3). Results were 

immediately reported to co‐operators by email. The relationship 

between pathotype and the resistance genes present in 

commercial wheats provided a basis for predicting expected 

disease response. 


Samples received from various regions of Australia are illustrated 

in Figure 1. The epidemic began early from presumed green 

bridge survival sites, developed slowly in winter, and became 

explosive in spring; the epidemic was largely confined to NSW 

and Queensland. 

Sample Number 

120 

100 

80 

60 

40 

20 

Queensland 

n NSW 

s NSW 

Victoria 

South Australia 

Western Australia 

Table 1. Features and frequency of the four Pst pathotypes detected in 

Australia in 2008. (R=resistant; S=susceptible) 

Resistance Gene (Yr) 

First 2008 Response 

Pathotype 

Report n=830 17 J 27 

‘WA’ 2002 20% R R R 

‘WA Yr17’ 2006 12% S R R 

‘Jackie’ 2007 55% R S R 

‘Jackie Yr27’ 2008

INTRODUCTION 

Impact of sowing date on crown rot losses 

S. Simpfendorfer{ XE "Simpfendorfer, S." } 

NSW Department of Primary Industries, 4 Marsden Park Rd, Tamworth, 2340, NSW 

Crown rot caused by the fungus Fusarium pseudograminearum 

(Fp) is a major constraint to winter cereal production in the 

northern cropping region especially under no‐till farming 

systems (3). Yield loss from crown rot interacts heavily with 

moisture stress during grain‐fill. One way to manipulate this 

interaction is through sowing time. Only two studies have ever 

examined this interaction under natural field infections which 

both found that earlier sowing increased the incidence of crown 

rot (1,2). An issue with these previous studies is that they are 

unable to differentiate seasonal interactions from the direct 

crown rot effects. An inoculated versus uninoculated 

experimental design, as suggested in (2), was adopted in this 

study to allow the direct effects of crown rot to be determined 

on yield and quality across three sowing dates. 


Three bread wheat varieties (EGA Gregory, Strzelecki and EGA 

Wylie) were used with the first two being longer season and 

rated as being more susceptible to crown rot and EGA Wylie a 

main season variety which has the best resistance rating. Plots of 

each variety were either uninoculated or inoculated with 

sterilised durum grain colonised by Fp at a rate of 2g/m of row. 

Plots of each treatment were then sown on three different dates 

at Tamworth in 2008 being: 1st sowing = 21st May, 2nd sowing = 

10th June and 3rd sowing = 27th June. There were four 

replicates of each treatment which were blocked for sowing time 

with treatments randomised within each block. Hand samples 

were removed from each plot at physiological maturity to obtain 

pathology measures while yield and quality were obtained from 

samples collected using a small plot harvester. 

RESULTS 

Good rainfall occurred at Tamworth late in the season during 

grain‐fill which prevented the formation of whiteheads in all 

treatments. There was no significant variety x inoculum or 

variety x sowing time x inoculum effect on yield given this good 

finish to the season. Sowing time had a significant impact on 

final grain yield in all three varieties with the average percentage 

yield reduction between the 1st and 2nd sowing for the three 

varieties being ‐9% and between the 1st and 3rd sowing ‐22.6%. 

Crown rot had less of an impact on yield at each sowing date 

causing ‐4.1% yield loss at 1st sowing, ‐3.4% 2nd sowing and ‐ 

6.7% at 3rd sowing date. 

Percentage screenings were also significantly affected by sowing 

time (1st to 2nd sowing date +1.0%; 1st to 3rd sowing date 

+3.5%). Crown rot also had a direct effect of increasing 

screenings at each sowing date with a trend towards increased 

negative impacts with delayed sowing (1st +0.7%, 2nd +1.5% and 

3rd +1.7%). 

There was no difference between the three varieties in the levels 

of infection initiated by Fp at any sowing date i.e. longer season 

varieties did not have greater numbers of plants infected 

irrespective of sowing time. In plots where no additional Fp 

inoculum was added (background infections) there was no 

difference in the percentage of plants infected at harvest 

between the three sowing times. When Fp inoculum was added, 

all sowing times resulted in around 80% of plants or greater 

being infected at harvest with the 2nd sowing time being 

significantly higher at 94% than the other two sowing times. 

However, with both inoculum levels it was obvious that early 

sowing did not result in increased numbers of infected plants at 

harvest. 

Although early or delayed sowing time did not impact on the 

percentage of plants ultimately infected by Fp, it did appear to 

influence disease expression as measured by the extent of basal 

browning (i.e. crown rot severity). Delaying sowing time 

significantly increased disease severity across the three sowing 

dates at both inoculum levels. 

DISCUSSION 

Sowing time and hence length of exposure to infection over the 

season did not result in different levels of plants being infected 

by Fp at harvest. The 2008 season was very conducive to 

infection with good soil moisture for much of the year. Certainly 

longer season varieties and earlier sowing did not increase 

susceptibility to infection. 

Earlier sowing increased yield and reduced screenings 

irrespective of crown rot infection. The actual % yield loss to 

crown rot did not vary greatly between sowing times with each 

of the varieties. There was an indication that crown rot resulted 

in increased screenings with later sowings. The 2008 season was 

not overly conducive to yield and quality loss from crown rot but 

differences were still evident. It would be interesting to repeat 

this experiment in a season with a tougher finish. In theory, 

bringing grain‐fill forward even 1–2 weeks may have a 

considerable impact on disease expression by limiting moisture 

and evaporative stress. 

The major effect on yield and quality comes from the sowing 

time itself. Later sowing decreases yield potential and grain size 

and increases screenings. Adding crown rot into the picture on 

top of this further exacerbates these losses thus increasing the 

probability of downgrading. The % yield and quality losses 

attributable to crown rot were pretty consistent across the three 

sowing dates. If anything they got slightly worse with the later 

sowings. Hence, sowing earlier in the window, if soil moisture 

allows, maximises the genetic yield potential, grain size and 

limits screenings in a variety. This provides buffering from any 

detrimental effect that crown rot infection may then have. 


Partial funding for this research was provided by the Grains 

Research and Development Corporation. 

REFERENCES 

1. Purss GS (1971) Effect of sowing time on the incidence of crown rot 

(Gibberella zeae) in wheat. Australian Journal of Experimental 

Agriculture and Animal Husbandry 11, 85–89. 

2. Klein TA, Burgess LW, Ellison FW (1989) The incidence of crown rot 

in wheat, barley and triticale when sown on two dates. Australian 

Journal of Experimental Agriculture 29, 559–563. 

3. Burgess LW, Backhouse D, Summerell BA, Swan LJ (2001) Crown rot 

of wheat. In: Fusarium. (Ed BA Summerell, JF Leslie, D Backhouse, 

WL Bryden, LW Burgess) APS Press. pp 271–294. 




Symptom development and pathogen spread in wheat genotypes with varying levels 

of crown rot resistance 

C.D. Malligan{ XE "Malligan, C.D." } A,B , M.W. Sutherland A and G.B. Wildermuth C 

A 

University of Southern Queensland, West St, Toowoomba, 4350, QLD 

B Department of Employment, Economic Development and Innovation, Queensland Primary Industries and Fisheries, Leslie Research 

Centre, Toowoomba, 4350, QLD 

C Retired from Department of Employment, Economic Development and Innovation, Queensland Primary Industries and Fisheries, Leslie 

Research Centre, Toowoomba, 4350, QLD 

INTRODUCTION 

Crown rot, caused by Fusarium pseudograminearum (Fpg), is an 

important soilborne disease of winter cereals. Complete 

resistance has yet to be reported in any wheat genotypes and 

hence is an ongoing issue for Australian wheat growers. In order 

to understand the nature of the partial resistance identified to 

crown rot we have examined the patterns of disease and 

pathogen spread in both susceptible and partially resistant 

tissues. Field trials were designed to study disease symptom 

development and localisation of Fpg hyphae in the bread wheat 

varieties Puseas, Vasco and Sunco, and the line 2–49. 


Inoculated field trials were conducted, using a randomised block 

design. Inoculum was placed in a band lying above the seed at 

sowing. Five plants from three replicates were harvested at 

approximately fortnightly intervals throughout the growing 

season. Leaf sheaths and internodes of the 1st 5 tillers were 

rated for disease using a scale from 0 to 4 as described in 

Wildermuth & McNamara (1), where 0 = no lesions evident and 

4 = >75% of tissue lesioned. Following disease rating, each tissue 

piece from two replicates was surface sterilised and plated out 

on Czapek Dox agar. Plates were checked daily for 5 days after 

plating. Sites of colony emergence were marked with ink on the 

abaxial plate surface. 

Disease rating data were analysed untransformed and the 

isolation counts were square‐root transformed prior to analysis. 

Restricted Maximum Likelihood (REML) Variance Components 

Analysis was used to determine significance of the fixed factors 

harvest, genotype, tiller and the corresponding two and three 

way interactions. To determine where individual means were 

significantly different 95% confidence intervals of error were 

calculated for each analysed plant part. 


Differences in moisture conditions between the two field trials 

resulted in differences in overall plant development, extent of 

Fpg colonisation and symptom expression. The results of the 

second trial conducted under higher moisture conditions will be 

presented here. 

Disease symptoms developed and Fpg was isolated from plant 

parts of all tillers of all genotypes. Statistically significant 

differences between genotypes were not expressed in the 

disease rating or isolation of Fpg from leaf sheath tissue in field 

trials even at the seedling stage (data not shown). Significant 

differences were seen between partially resistant and 

susceptible wheat genotypes in both disease rating and 

isolations from internode tissues and this could be detected 

soon after stem extension commenced (Figures 1 and 2). 

for rating field material for crown rot screening. At later harvests 

differences between genotypes were clearly expressed in higher 

internodes and at maturity lesions had developed as high as the 

2nd internode in 2–49, 4th in Sunco, and the 5th internode in 

Puseas and Vasco. At maturity Fpg was consistently recovered 

from the 4th internode in 2–49 and the 5th in all other tested 

genotypes, indicating a delay in symptom expression in the 

infected 2–49 tissues. 

Mean Disease Rating 

4 

3.5 

3 

2.5 

2 

1.5 

1 

0.5 

0 

Mean Disease Rating of Internode 1 

(Tillers combined) +/- 95% confidence interval of error 

Booting Anthesis Milk 

Development 

Dough 

Development 

Puseas 

Vasco 

Sunco 2-49 

Ripening 

Figure 1. Mean disease rating of internode 1 at 13 (booting) to 22 weeks 

after planting (WAP) (ripening). n = 75 tillers 

Mean Number of Isolations 

3.00 

2.50 

2.00 

1.50 

1.00 

0.50 

0.00 

Square Root of Isolations from Internode 1 

(Tillers combined) +/- 95% confidence interval of error 

Booting Anthesis Milk 

Development 

Dough 

Development 

Puseas 

Vasco 

Sunco 2-49 

Ripening 

Figure 2. Mean isolations from internode 1 at 13 (booting) to 22 WAP 

(ripening). n = 50 tillers 

CONCLUSIONS 

Resistance was expressed as a slowing down of colonisation of 

plant parts in 2–49 and to a lesser extent in Sunco when 

compared to the susceptible genotype Puseas. Both colonisation 

and disease symptoms are initially slowed in young tissues of 

partially resistant genotypes however at later harvest times 

these same tissues may be as infected and symptomatic as the 

tissues of susceptible genotypes. 


Financial support provided by GRDC PhD scholarship to CDP. 

Large differences in symptom expression were seen between 

genotypes in internode 1 around anthesis but not at maturity. 

This is an important observation as maturity is a favoured time 

REFERENCES 

1. Wildermuth, G. B. and McNamara, R. B. (1994). Testing wheat 

seedlings for resistance to crown rot caused by Fusarium 

graminearum Group 1. Plant Disease 78: 949–953. 


Development of an eradication strategy for exotic grapevine pathogens 

M.R. Sosnowski{ XE "Sosnowski, M.R." } A,D , R.W. Emmett B,D , W.F. Wilcox C,D and T.J. Wicks A,D 

A South Australian Research and Development Institute, GPO Box 397, Adelaide, South Australia 5001 

B Department of Primary Industries Victoria, PO Box 905, Mildura, Victoria 3502 

C Department of Plant Pathology, Cornell University, New York State Agricultural Experiment Station, PO Box 462 Geneva, NY 14456 USA 

D Cooperative Research Centre for National Plant Biosecurity, LPO Box 5012, Bruce ACT 2617 

INTRODUCTION 

Eradication of exotic grapevine diseases can incur significant 

costs to growers and the industry using current strategies which 

include complete removal of affected and suspected vines. 

Alternative strategies need to be developed which optimise 

efficiency of the eradication process and minimise the economic 

cost of returning the crop to its previous quality and production 

levels (1). The endemic disease of grapevine, black spot (Elsinoe 

ampelina), was used as a model to develop a drastic pruning 

eradication strategy for the exotic disease black rot (Guignardia 

bidwellii). These pathogens have similar biology and 

epidemiology and as surface pathogens, inhabit fruit, leaves and 

shoots of grapevines producing similar looking lesions on these 

parts of the vine (2, 3). 


In 2006, a trial was established in the Sunraysia district of 

Victoria to develop and assess a drastic pruning protocol. Using a 

randomised block design, the trial comprised four table grape 

cultivars (Red Globe, Christmas Rose, Blush Seedless and Fantasy 

Seedless) as blocks. Plots consisted of three vines with standard 

two‐bud spur pruning. Vines in each plot were either drastically 

pruned (as described below) or left as controls. Spacing between 

plots within rows was at least 7.3 m and between rows was 10.5 

m. 

Vines were inoculated in spring 2007 by spraying a suspension of 

E. ampelina conidia on new shoots with 2–4 unfolded leaves. 

Inoculations were conducted at three different times to cater for 

differences in phenology between the cultivars. Shoots were 

covered with polyethylene bags overnight to provide high 

humidity to promote spore germination and infection. 

emerging leaves on potted grapevines (cv. Thompson Seedless). 

The leaves were incubated overnight as described above. The 

vines were assessed for symptoms 12 days later. 

RESULTS 

Assessment of the vines in December 2007 showed that 5–12 

inoculated shoots on each vine had black spot leaf lesions and 

stem cankers. This indicated that the vines had sufficient 

infection to simulate an exotic pathogen incursion for 

eradication. 

In December 2008, following the eradication, symptoms were 

recorded on all control vines and on 4 of 36 treated vines. On 

treated vines, each symptomatic shoot grew from the trunk 

within 20 cm of the ground. The bioassay indicated that 

symptoms were most likely caused by inoculum produced from 

vine debris remaining on the vineyard floor directly beneath low 

shoots. 

Assessment of the sentinel vines revealed that there was no 

spread of disease between plots or from external sources. 

DISCUSSION 

As a result of the assessment following eradication, the protocol 

has been modified to include removal of lower shoots when 

regrowth occurs on vine trunks and the use of straw mulch on 

the vineyard floor. The revised protocol will be applied in the 

second year of the eradication trial in Australia and the 

assessment in December 2009 will determine if the eradication 

was successful. Validation of the protocol for eradicating black 

rot has been initiated in an infected vineyard in New York USA, 

where the disease is endemic. 

Session 6B—Quarantine and exotic pathogens 

In July 2008, vines were drastically pruned as follows. Vines were 

cut at the crown using a chainsaw and excised material from 

above the crown was removed and placed in an excavated area 

about 25 m from the trial plots. The vineyard floor around the 

treated vines was raked and the debris was placed in the 

excavated area to be burnt and buried. Soil between vines was 

disc cultivated to bury any remaining debris. Trunks of the 

treated vines were drenched with lime sulphur using a back pack 

sprayer. 

Canopy misters were used in the spring as new shoots emerged 

to provide conditions conducive for disease development. Vines 

were assessed for recurrence of symptoms in December 2008. 

Healthy sentinel vines in pots were placed strategically within 

and around the trial site during spring and early summer to 

detect any movement of the pathogen between plots or from 

external sources. After periods of 2–3 weeks, the potted vines 

were placed in a glasshouse, drip irrigated, incubated for 4 

weeks at 22–28°C and inspected for symptoms. 

A bioassay was conducted to determine if vine debris in the soil 

below vines was a source of inoculum for emerging shoots. Soil 

from the base of treated trunks was collected and organic debris 

was separated using a sieve. The debris was soaked in water 

overnight and the water was decanted and sprayed over 

This research has potential to save the Australian wine industry 

over $18 million in lost production and vineyard reestablishment 

if there is an exotic disease incursion (R. Mcleod, 

unpublished data). 


We would like to thank K. Clarke (DPI Vic), A. Loschiavo and D. 

Sosnowski (SARDI) for technical assistance and the CRC for 

National Plant Biosecurity for funding this research. 

REFERENCES 

1. Sosnowski MR, Fletcher JD, Daly AM, Rodoni BC and Viljanen‐ 

Rollinson SLH (2009) Techniques for the treatment, removal and 

disposal of host material during programmes for plant pathogen 

eradication. Plant Pathology Early view online DOI: 10.1111/j.1365‐ 

3059.2009.02042.x. 

2. Magarey RD, Coffey BE and Emmett RW (1993) Anthracnose of 

grapevines, a review. Plant Protection Quarterly 8, 106–110. 

3. Wilcox W (2003) Grapes: Black rot (Guignardia bidwelli (Ellis) Viala 

and Ravaz.). Cornell Cooperative Extension Disease Identification 

Sheet No. 102GFSG‐D4, Cornell University. 



Green grassy shoot disease of sugarcane, a major disease in Nghe An Province, 

Vietnam 

INTRODUCTION 

R.C. Magarey{ XE "Magarey, R.C." } A , L.W. Burgess B , P.J. Nielsen C and Ngo Van Tu C 

A BSES Limited, PO Box 566, Tully, 4854, Queensland 

B Faculty of Agriculture, Food and Natural Resources, University of Sydney, 2006, New South Wales 

C NAT&L Sugar Factory, Quy Hop, Nghe An Province, Vietnam 

Sugarcane is a major crop in many South East Asian countries 

and provides an important cash crop as a rotation in a farming 

system often consisting of crops such as rice, corn, peanuts and 

watermelon. In contrast to first world countries, cropping areas 

in Vietnam are small with up to 24,000 farmers supplying 

sugarcane from 1ha plots to the local factory. This compares to 

around 250 farmers supplying each Australian sugar factory. In 

the mid‐1990s, a new sugarcane disease called green grassy 

shoot disease (GGSD) was identified in Thailand. Characterised 

by the production of many small grassy tillers, and caused by a 

phytoplasma, the disease had severe consequences on crop 

yields. Several other diseases in neighbouring countries are also 

caused by phytoplasmas; these include white leaf disease (WLD) 

and grassy shoot disease (GSD). In 2006, symptoms of GGSD 

were identified in the NAT&L factory area, Quy Hop, Nghe An 

Province, Vietnam. This paper briefly describes GGSD symptoms 

and the current epidemic occurring in Vietnam. 

GGSD 

Symptoms. The disease is characterised by the production of 

many small green grassy tillers. These first appear at the base of 

mature sugarcane stools late in the cropping period; in this crop, 

yields are not unduly affected. Being a semi‐perennial crop, 

second and third annual harvests (first and second ratoon crops) 

are made from the same planting. The following ratoon crops 

arising from an infested crop suffer very serious yield effects. 

Healthy ratoon shoots are replaced by profuse green, grassy 

shoots that lead to complete crop failure. Harvest yields often 

progress from 80 tonnes biomass per ha in a largely disease‐free 

plant crop to 15 tonnes / ha in the first ratoon crop; second 

ratoon crops in susceptible cultivars often fail altogether. In 

contrast to GSD and WLD, there is no chlorosis in leaves of GGSD 

affected sugarcane. 

Transmission. As a vegetatively propagated crop, infected 

planting material leads to diseased crops; the supply of diseasefree 

seed‐cane is essential for limiting disease spread. There are 

no recorded vectors for GGSD but circumstantial evidence, such 

as speed of spread, suggests a vector is likely to be associated 

with disease transmission. 

Control. The most important control measures for GGSD are the 

termination of heavily diseased crops, the planting of new crops 

with disease‐free planting material and the choice of the most 

resistant cultivars—though there are few resistant cultivars 

currently available in Vietnam. Further importation of 

germplasm into Vietnam is needed to select suitably‐resistant 

cultivars. Research has shown that immersion of infested 

planting material in water maintained at 50C for 3 hours (HWT) 

leads to the elimination of the disease in >85% of the axillary 

buds. The selection of the cleanest planting material for HWT 

provides the best opportunity for producing disease‐free nursery 

cane. 

NAT&L sugar factory, Nghe An Province. The disease has been 

widely detected in the two most widely planted cultivars MY55‐ 

14 and ROC 10; ROC 10 is more susceptible than MY55‐14. The 

disease quickly expanded beyond the initial finding with severe 

GGSD observed in >6,000ha of crops in early 2009; lighter 

infection has been widely observed across the sugar factory 

area. The sugar factory has pro‐actively addressed the problem 

with incentives paid to farmers to eliminate badly diseased 

crops. Concurrently an intense extension program has been run 

by the factory in the local communes; over 175 commune 

meetings were staged from January to May 2009. In late Aprilearly 

May 2009, there has been an expanded program, with 

further funding, focused on the elimination of infested crops in 

an attempt to further reduce disease spread. 

DISCUSSION 

The extent of the disease in the Quy Hop sugar factory area, the 

speed of spread and the effect on yield all suggest that GGSD is a 

very significant threat to sugarcane crop production in Vietnam. 

Not enough is known about the disease, including the nature of 

possible vectors, the resistance of cultivars to the disease, and 

potential replacement canes, and the distribution of the disease 

in Vietnam. There is a suspicion that GGSD also occurs in other 

Provinces of Vietnam, but at lower severity levels. Further 

research is needed, not only with GGSD but also to develop 

reliable diagnostic tools for GGSD, GSD and WLD. Findings of 

white leaves associated with diseased cane crops suggest that 

GSD and / or WLD may also be present in Vietnam. It is 

important that the status of the various pathogens is known to 

ensure appropriate control measures are applied. 

Figure 1. Symptoms of GGSD in sugarcane crop (cultivar MY55‐14) in 

Nghe An Province, Vietnam. Note the small green grassy tillers in the 

midst of normal ratoon shoots. 

Causal agent. Research undertaken in Thailand suggests that a 

phytoplasma is the causal agent of GGSD. 


We acknowledge the assistance provided by NAT&L factory staff 

in gathering information on this disease. 


Molecular detection of Mycosphaerella fijiensis in the leaf trash of ‘Cavendish’ banana 

S.G. Casonato{ XE "Casonato, S.G." } A , J. Henderson B and R.A. Fullerton A 

A The New Zealand Institute for Plant and Food Research Limited, Private Bag 92169, Auckland Mail Centre 1142, New Zealand 

B Tree Pathology Centre, 80 Meiers Road, Indooroopilly, Queensland, 4068, Australia 

INTRODUCTION 

Black Sigatoka (black leaf streak) caused by, Mycosphaerella 

fijiensis Morelet (anamorph Paracercospora fijiensis (Morelet) 

Deighton), the most destructive foliar pathogen of bananas 

globally. The disease is present in commercial plantations in 

Africa, Asia and Central and South America, where extensive 

fungicide applications are required for its control. The potential 

for M. fijiensis to be carried into countries free of the disease in 

leaf trash carried in commercial consignments is unknown. This 

study was undertaken to determine whether M. fijiensis could 

be detected in leaf trash in cartons of bananas imported from 

the Philippines to New Zealand. 


Samples of leaf tissue and banana skin were collected from 

cartons of a commercial consignment of bananas imported to 

New Zealand from the Philippines in December 2005. The 

samples were stored at ‐20ºC until assayed in July 2006. 

DNA extraction. DNA was extracted from 11 of the samples 

supplied (Table 1) using a QIAGEN DNeasy ® Plant Mini Kit. 

Insufficient sample of S40 (particulate leaf material) was present 

for extraction. Samples of M. fijiensis (748 ex banana leaf, 

Tongatapu, Tonga) and M. musicola (yellow Sigatoka) (Mf589 

[Cultures are held in the culture collection maintained by Dr R.A. 

Fullerton at Plant and Food Research, Mt Albert Research Centre, 

Auckland.] ex banana leaf South Johnston, Queensland) were 

used as control samples and had DNA extracted from mycelium 

growing on a potato dextrose agar plate. DNA was quantified 

using a NanoDrop spectrophotometer. DNA extracts were kept 

at ‐20°C. 

of known identity (Mf 748). This was shown to be 0.243 fg/µL (1 

fg = 10 ‐15 g) of pure M. fijiensis DNA. When assaying the 

extractions from leaf trash, a PCR product of approximately 1050 

bp indicated a positive amplification of M. fijiensis (Figure 1). 

Where a positive result was achieved, the PCR reaction was 

repeated a minimum of three times. A control of healthy, 

uninfected banana leaf was also included in reactions. 

Sequencing. Direct sequencing was carried out to confirm the 

identity of the amplified products. PCR products were purified 

using a QIAGEN MinElute PCR Purification Kit. The PCR product 

was fluorescently labelled using a BigDye ® Terminator v3.1 Cycle 

Sequencing Kit (Applied Biosystems, Foster City, USA). Each 10 

µL reaction contained approximately 25 ng/µL of PCR product, 2 

µM primer (ITS‐1 or ITS‐4), 2 µL terminator‐ready reaction mix 

and the volume made up with sterile Milli‐Q water. Sequences 

obtained were compared with those in the database GenBank ® 

using the Basic Local Alignment Search Tool (BLAST), BLASTN. 


Four of the 11 tissue samples consistently yielded a PCR product 

using M. fijiensis specific primers MFFor and R635‐mod (Figure 

1). They were: S2 (floral), S31 (leaf material), S36 (particulate 

trash) and S56 (stem or petiole). Sequenced products were 

homologous (at least 99%) with M. fijiensis sequences lodged in 

GenBank. This study has shown that M. fijiensis was present in 

fragments of leaf trash found in cartons of banana fruit imported 

into New Zealand from the Philippines. The viability of the 

organism within the sample cannot be ascertained from these 

tests nor can the quantity of M. fijiensis be verified using these 

techniques. 


Table 1. List of banana leaf, floral and trash samples from which DNA 

was extracted. DNA was also extracted from Mycosphaerella fijiensis and 

M. musicola cultures. 

Sample 

S2 

S7 

S31 

S32 

S36 

S39 

S56 

S113 

S155 

S348 

S351 

Mf 748 

Mf 589 

Banana leaf 

Type 

Floral 

Edge of leaf? 

Leaf material 

Leaf material 

Particulate trash? 

Leaf material 

Stem/petiole on fruit 

Fruit spots under trash 

Particulate trash 

Unknown 

Unknown 

Mycosphaerella fijiensis culture Fullerton 

Mycosphaerella musicola culture Fullerton 

Healthy glasshouse grown plant in NZ 

PCR protocol. Samples were initially amplified using primers 

MF137 and R635 (1). These primers were found to be not 

specific for M. fijiensis and alternative primers were sought, 

MFFor and R635‐mod (Henderson et al. unpublished). These 

primers are designed to amplify part of the internal transcribed 

spacer (ITS) regions between the 18S and the 28S rDNA subunits 

of M. fijiensis. Prior to amplifying the extracted DNA, the 

minimum detection limit of M. fijiensis for the PCR protocol 

being used was determined using DNA extracted from a culture 

—A—B—C—D—E—F—G—H—I—J—K—L—M—N—O—P—Q 

Figure 1. Amplified products of Mycosphaerella fijiensis using primers 

MFFor and R635‐mod. Reaction used 5 µL DNA per reaction. Lane A:100 

bp ladder; B:Banana leaf; C:S2: D:S7; E:S31; F:S32; G:S39; H:S36; I:S56; 

J:S113; K:S155; L:S348; M:S351; N:Mf589 yellow sigatoka; O:Mf748 black 

sigatoka; P:blank (negative control); Q:100 bp ladder. Double‐ended 

arrow indicates product of approximately 1050 bp. Deteriorating DNA 

lessened the band brightness for some sampels. Note: gel has been cut. 

REFERENCES 

1. Johanson, A. and Jeger, MJ. 1993. Use of PCR for detection of 

Mycosphaerella fijiensis and M. musicola, the causal agents of 

Sigatoka leaf spots in banana and plantain. Mycological Research 

97, 670–674. 



INTRODUCTION 

Optimising responses to incursions of exotic plant pathogens 

Biological, spatial and economic data, linked through modelling, 

can assist in optimising responses to incursions of exotic plant 

pathogens. The approach allows predictions of the behaviour of 

linked biological and agronomic systems within defined bounds 

despite many uncertainties involved in individual parameters. 

Uncertainties are to be expected because each incursion of an 

exotic pest into a new environment is a novel situation for which 

there may be no precedents. The biological and agronomic 

parameters having the greatest impact can be identified, and the 

response designed to optimise the benefit:cost ratio. 

The value of this approach is shown in examples of two relatively 

recent incursions into Australia by exotic pathogenic nematodes; 

(a) Bursaphelenchus hunanensis, a relative of the Pine Wilt 

Nematode (1), (b) Potato Cyst Nematode (PCN) (2). 


The model initially simulated possible scenarios for the arrival, 

establishment, and expansion of the geographic range of a pest 

in the absence of biosecurity measures. The effects of various 

measures were then added and the results compared with the 

first run. 

The model was a stochastic simulation model using random 

number generators to simulate chance or random events. 

Probability distributions were used as parameters within an 

abstract model rather than point estimates, and a Monte Carlo 

algorithm used to sample from each of these distributions (3). 

Many parameters were used to estimate the ecological 

processes of establishment, spread, population growth and crop 

damage, together with their economic consequences in terms of 

crop yields, testing for disease, and control measures. Each 

parameter was given one of a number of statistical distributions 

with a defined mean or modal value, depending on the 

distribution chosen. In each of the 5,000 iterations of the model, 

one value was randomly sampled across the range of each 

distribution. The model used Markov chains to estimate 

transitional probabilities between time periods of 1 year. The 

model was run over 20 years and used a standard discount rate 

of 8% (a margin of 3% on top of a real risk free rate of 5%). 

RESULTS 

Impacts of both pests studied were large over the time period 

considered. Under most possible scenarios, annual impact rises 

steeply initially, followed by slower growth, before eventually 

declining (Fig. 1). Raw crop losses in the field were only a small 

proportion of the aggregate impact. Parameters had different 

effects and time courses on the aggregate impact of the pests. 

Potential rate of geographic expansion of the pest was 

important, but the cost of testing for the pest during its 

expansion was also important. This cost occurs soon after 

invasion; it can be largely independent of the actual expansion 

rate or range, but is affected by the accuracy and efficiency of 

the test. Efficacy of testing affects the impact of a pest on other 

crops occurring in the region. Cost of mitigation of the pest may 

be large, and the failure rate of control is an important cost. 

M. Hodda{ XE "Hodda, M." } and D.C. Cook 

CSIRO Entomology, GPO Box 1700, Canberra, 2601, ACT 

highly significant. With increasing distances from production to 

market, the chances of barriers to trade arising or loss of 

markets following arrival of a pest are increased. Disinfestation 

and certification costs were substantial in the long term. 

DISCUSSION 

Rapid initial rise in impact of pests makes early detection and 

action desirable, even when there is great uncertainty over the 

future behaviour of the pest. The substantial impact beyond lost 

crop production means that eradication or other control 

measures are often the best option. The problem is that cost of 

this strategy precedes any benefits. Benefits of control programs 

may be wider than the direct crop losses, so wider contributions 

to costs may be justified. 

The predicted decline in annual impacts may be largely related 

to discount rates and this requires further investigation since the 

real costs of many forms of pest control, eg chemicals, are 

increasing, along with environmental, social and regulatory 

costs. 

Expected impact (million $) 

40 

35 

30 

25 

20 

15 

10 

5 

0 

0 2 4 6 8 10 12 14 16 18 20 

Time (years) 

Figure 1. Simulated impact of PCN in Australia. 

mean 

standard error 

95% confidence limit 

REFERENCES 

1. Hodda M, Smith DI, Smith IW, Nambiar L, Pascoe I (2008) Incursion 

management in the face of multiple uncertainties: a case study of 

an unidentified nematode associated with dying pines near 

Melbourne, Australia. In ‘Pine Wilt Disease—a threat to forest 

ecosystems’. (Eds P Viera, Mota M) pp. () 

2. Hodda M, Cook DC (in press) Economic impact from unrestricted 

spread of Potato Cyst Nematodes in Australia. Phytopathology 33, 

3. Cook DC, Thomas MB, Cunningham SA, Anderson, DL and DeBarro 

PJ 2007. Predicting the economic impact of an invasive species on 

an ecosystem service. Ecol Appl 17: 1832–1840 

Impacts related to trade in the crop, both in terms of quantity 

and value are highly uncertain, but under most scenarios are 


The influence of soil biotic factors on the ecology of Trichoderma biological control 

agents 

INTRODUCTION 

A. Stewart{ XE "Stewart, A." }, Y.W. Workneh and K.L. McLean 

Bio‐Protection Research Centre, PO Box 84, Lincoln University, Canterbury 7647, NZ 

The influence of environmental factors such as pH, moisture, 

temperature and other abiotic factors such as fertiliser and 

pesticide application on the establishment, proliferation and 

persistence of biocontrol agents in the field has been intensively 

investigated (1). However, there is little understanding of the 

nature of biotic influences which are likely to play an equally 

important role in determining the nature of the biocontrol 

outcome. This paper reports on a preliminary study that 

examines the effect of common soil microbes on two biocontrol 

agents, Trichoderma atroviride LU132 active against onion white 

rot and Trichoderma hamatum LU593 active against Sclerotinia 

lettuce rot (2). 


Soil microbes. Forty‐eight microbes representing 11 fungal 

genera (Acremonium, Alternaria, Aspergillus, Beauveria, 

Chaetomium, Cladosporium, Fusarium, Metarhizium, 

Paecilomyces, Penicilllium, Verticillium), seven bacterial genera 

(Agrobacterium, Azotobacter, Bacillus, Burkholderia, 

Flavobacterium Paenibacillus) and four actinomycete genera 

(Actinomyces, Arthrobacter, Rhodococcus, Streptomyces) were 

obtained from NZ culture collections (Lincoln University, 

Landcare Research, AgResearch). 

Dual culture assays. Test microbes were inoculated 3d prior to 

or simultaneously with the Trichoderma on 9 or 15cm diameter 

PDA plates. An inoculum plug of the test microbe was placed 

3cm apart from the Trichoderma in the centre of the plate. 

Colony interactions were monitored every 24h until Trichoderma 

colony growth stopped or was constrained by the edge of the 

plate. Trichoderma colony area (mm 2 ) was measured and 

percentage inhibition compared to the Trichoderma control 

calculated. 

Soil pot assays. Inocula of six test microbes were produced on 

rice grains and incorporated into Templeton silt loam soil in pots 

to give 10 6 cfu/g soil. Trichoderma was applied to the soil (10 6 

cfu/g soil) as a granular formulation (Agrimm Technologies Ltd). 

Pots were incubated at constant temperature and moisture for 

30d. At weekly intervals, soil samples were taken from three 

random spots in each pot and Trichoderma population counts 

(cfu/g soil) determined using soil dilution plating on Trichoderma 

selective medium. 

Statistical analyses. Data was analysed using one‐way ANOVA 

and treatment means compared using Fishers LSD. 

RESULTS 

Dual culture assays. Co‐culture on PDA revealed six fungi and 

one bacterium that significantly inhibited Trichoderma colony 

growth (Table 1). Greatest inhibition (>85%) occurred with 

Aspergillus niger and Paecilomyces lilacinus for T. atroviride and 

T. hamatum, respectively. In general, T. hamatum was less 

sensitive than T. atroviride to the test microbes, in particular to 

C. globosum. 

Soil pot assays. T. atroviride populations were significantly 

reduced in soil treated with Alternaria, Aspergillus, Metarhizium, 

Paecilomyces and Daldinia (Fig. 1) T. hamatum was less sensitive 

to the test microbes but the trend was similar (data not shown). 

Table 1. Percentage inhibition of Trichoderma colony growth after 10d 

dual culture with test microbes 

Test microbes T. atroviride T. hamatum 

Alt. alternata 94.7 a* 72.8 c 

P. lilacinus 84.6 b 85.1 a 

Asp. niger 96.5 a 82.2 ab 

C. globosum 87.2 b 44.5 d 

M. anisopliae 82.5 b 74.2 bc 

D. eschscholzii 56.4 c 51.2 d 

Agrobacterium sp 67.1 c 31.3 e 

* Values within columns followed by the same letter are not significantly different. 

CFU/gram soil 

1.40E+05 

1.20E+05 

1.00E+05 

8.00E+04 

6.00E+04 

4.00E+04 

2.00E+04 

0.00E+00 

A. alternata 

A. niger 

C. globosum 

M. anisopliae 

P. lilacinus 

D. eschscholzii 

Agrobacterium 

Control 

Figure 1. T. atroviride population (cfu/g soil) after 30d in soil treated with 

different test microbes. 

DISCUSSION 

Six fungi and one bacterium significantly inhibited Trichoderma 

colony growth on agar plates with differential sensitivity 

observed between the two Trichoderma strains. Preliminary 

studies suggest the inhibition is due to the production of 

antifungal metabolites by the test microbes. The high inhibition 

observed in culture was not reproduced in the soil assay where 

five of the seven test microbes reduced Trichoderma populations 

but only by ten‐fold. Since test microbe populations in the field 

are likely to be lower than those used here, the results likely 

overestimate the potential negative impact on Trichoderma 

biocontrol agents applied to soil. However, further work 

examining the effect of the test microbes in different soil types is 

needed since metabolite production by the test microbes may 

be influenced by soil abiotic factors. 


Funding for this project was provided by the NZ Tertiary 

Education Commission. 

REFERENCES 

1. Kredics L, Antal Z, Manczinger L, Szekeres A, Kevei F, Nagy E (2003) 

Influence of environmental parameters on Trichoderma strains 

with biocontrol potential. Food Tech. and Biotechnol. 41, 37–42. 

2. Stewart A, McLean K L (2004) Optimising Trichoderma bioinoculants 

for integrated control of soilborne disease. Proc 3rd 

Australasian Soilborne Diseases Symposium 55–56. 

Session 6C—Alternatives to chemical control 



Understanding Trichoderma bio‐inoculants in the root system of Pinus radiata 

P. Hohmann{ XE "Hohmann, P." } A , E.E. Jones B , R. Hill A , A. Stewart A 

A Bio‐Protection Research Centre, PO Box 84, Lincoln University, Lincoln 7647, New Zealand 

B Department of Ecology, Faculty of Agriculture and Life Sciences, PO Box 84, Lincoln University, Lincoln 7647, New Zealand 

INTRODUCTION 

The genus Trichoderma are beneficial soil‐borne fungi and a well 

known source of biological control agent active against a wide 

range of crop diseases, including those of pine trees (1). Several 

isolates of Trichoderma have been shown to improve 

establishment and reduce pathogen infection of Pinus radiata in 

the nursery and in forestry plantations (2). Three isolates of 

different Trichoderma species were selected for this study. T. 

hamatum (LU592) and T. harzianum (LU686), known to stimulate 

growth and improve establishment of P. radiata seedlings, and T. 

atroviride (LU132) which had no stimulatory activity. To enable 

more predictable and effective use of Trichoderma bioinoculants, 

their establishment and population dynamics was 

determined. In addition, the effect of each isolate on P. radiata 

seedling vitality and growth was assessed. 


Each Trichoderma isolate was applied either as a seed coat 

formulation (4 x 10 5 spores/seed; SC) or a spore‐suspension (5 x 

10 6 spores/pot; SA) sprayed directly after sowing the P. radiata 

seeds. P. radiata seeds were grown in root‐pruning containers 

for 7 months under conditions reflecting those used in the 

commercial PF Olsen nursery. Health and growth assessments 

included mortality rate, shoot height and shoot and root dry 

weight measurements. During the 7 month trial period, 

Trichoderma populations were enumerated in the bulk potting 

mix, rhizosphere, rhizoplane and endorhizosphere subsystems 

by dilution plating. At the 20 week assessment, recovered 

Trichoderma colonies were identified using morphological and 

molecular techniques to differentiate between introduced and 

indigenous species. A large‐scale experiment was set up at the 

PF Olsen nursery under commercial conditions to verify the 

results for LU592. 

RESULTS 

T. hamatum LU592 performed the best out of the three 

introduced isolates. Seedling mortality rate was reduced from 

5.2% for the control to 0.2% for LU592 and 0.4% for T. 

harzianum LU686 SC. LU592 and LU686 SC also increased shoot 

height by 17% and 11%, respectively. Results also indicated that 

T. atroviride LU132 increased the root/shoot ratio. 

Trichoderma populations of all SA treatments were significantly 

higher in the rhizosphere (by 2.1 to 3.3 times) compared with 

the control. Applied Trichoderma spp. could be differentiated 

from indigenous isolates by colony morphology and confirmed 

by molecular sequencing. Introduced Trichoderma isolates could 

be detected even though overall Trichoderma populations did 

not reveal significant differences to the control. In the 

rhizosphere, introduced isolates established with levels of ~20% 

for LU132 SA and LU592 SC. T. harzianum LU686 was not 

recovered from the rhizosphere after 20 weeks. T. hamatum 

LU592, when spray applied, was the only isolate clearly 

dominating all four subsystems bulk potting mix, rhizosphere, 

rhizoplane and endorhizosphere. 

Table 1. Increase (%) in P. radiata seedling growth parameters by T. 

hamatum LU592 compared with the control. All values significant at P > 

0.05 from the control. 

Growth factor Seed coat Spray Suspension 

Shoot height 7.4 9.5 

Dry weights ‐ roots 17 21 

‐ shoots 23 24 

Stem diameter 9.0 9.4 

number root tips 11 n.s. 

n.s. = not significant 

DISCUSSION 

Both T. hamatum LU592 and T. harzianum LU686 increased the 

growth of P. radiata seedlings, with the subsequent large‐scale 

experiment confirming the growth promotion effects of LU592. 

The spray application performed slightly better than the seed 

coat application. This reduction in seedling morality and increase 

in seedling growth represents a substantial economic benefit to 

the industry. 

The spray application method clearly promoted the 

establishment of the introduced isolates in the root system of P. 

radiata. T. harzianum LU686 was found to be an early 

rhizosphere coloniser (declining after 12 weeks). Strong 

rhizosphere competence was identified for T. hamatum LU592. 

The ability of Trichoderma, LU592 in particular, to establish in 

the rhizosphere and penetrate the roots is a crucial indicator of 

beneficial activity (1). 

LU592, being the most effective isolate at colonising all P. 

radiata root subsystems, was selected for more detailed 

ecological studies using a genetically marked strain. Future 

experiments will focus on the use of a fluorescently marked 

isolate of LU592 to verify rhizosphere competence, examine 

spatio‐temporal distribution within the rhizosphere and 

determine endophytic activity including interactions with 

ectomycorrhizae. 


This study is part of the Ecosystem Bioprotection program 

LINX0304 funded by the NZ Foundation for Research Science and 

Technology (FRST). We would like to thank PF Olsen for nursery 

access. 

REFERENCES 

1. Harman, G.E., Howell, C.R., Viterbo, A., Chet, I. & Lorito, M. (2004). 

Trichoderma species—Opportunistic, avirulent plant symbionts. 

Nature Reviews Microbiology. 2(1): 43–56. 

2. Hood, I.A., Hill, R.A., Horner, I.J. (2006). Armillaria Root Disease in 

New Zealand Forests. A Review. Review document written for the 

Forest Biosecurity Research Council. 

T. hamatum LU592 as a seed coat and spray application 

significantly increased shoot height, shoot and root dry weight 

and stem diameter compared with the control in the large‐scale 

experiment (Table 1). 


A bioassay to screen Trichoderma isolates for their ability to promote root growth in 

willow 

INTRODUCTION 

M. Braithwaite{ XE "Braithwaite, M." }, R. Minchin, R.A. Hill, and A. Stewart 

Bio‐Protection Research Centre, PO Box 84, Lincoln University, Lincoln 7647, New Zealand 

Trichoderma species have been shown to increase the biomass 

of both root and shoots of a range of plants including willow (1). 

These positive benefits of biocontrol agents have been 

attributed to antibiotic production, parasitism or competition of 

pathogenic fungi, activation of the host defence response, and 

possibly the direct stimulation of plant growth. 

Cuttings of some plant species such as Pinus radiata are slow 

and difficult to root resulting in poor plant establishment. The 

Bio‐Protection Research Centre culture collection has a large 

number of Trichoderma isolates and a bioassay to rapidly screen 

a selection of these isolates for their ability to promote root 

growth and establishment of cuttings was investigated. Willow 

was chosen as a model system because of its ease and speed to 

produce roots, enabling rapid screening of potential isolates. 

This paper describes the development of this assay. 


Dormant cuttings of Salix x matsudana willow, approximately 

300 mm in length, were collected in July and August. Cuttings 

were given a two hour soak in tap water prior to storage in 

plastic bags at 4°C until required for treatment and planting. 

Representative isolates (65 in total) from a range of Trichoderma 

species from the Biocontrol Microbial Culture Collection (Bio‐ 

Protection Research Centre, Lincoln) were grown on PDA (pH 

4.0) to produce inoculum (conidia). Conidia were harvested in 

reverse osmosis water, filtered through Mira cloth (22–25µm) 

and added to 0.5% methyl cellulose to produce an inoculum 

concentration of 1 x 10 6 mL ‐1 . 

The trial was separated into four experiments set up on different 

days. Each experiment included three control/standard 

treatments (methyl cellulose (0.5%), fulvic acid (0.3%) and 

Thiram (12 g L ‐1 )). Willow cuttings were dipped in each 

treatment (Trichoderma spore suspensions, controls) for 10 

minutes, except Thiram (4 minutes as per manufacturer’s 

recommendation). Treated cuttings were planted into individual 

planter bags (special Long PB ¾, 64 x 64 x 300 mm) filled with a 

pine bark, sand, pumice mix (50, 30, 20% respectively). The trial 

was laid out in a stratified random block design consisting of 4 

blocks and 40 replicates per treatment. Plants were assessed for 

root development 35 days post planting with the following 

measurements recorded; cutting girth, cutting length, number of 

root initials and number of shoots. Statistical analysis was by 

ANOVA and included a range of parameters including root dry 

weight, root dry weight per unit volume cutting and root dry 

weight per root initial. 

RESULTS/DISCUSSION 

This bioassay proved successful for screening a large number of 

Trichoderma isolates for their ability to promote root growth on 

willow. In general, the majority of isolates had no effect on root 

promotion compared to the methyl cellulose control. A small 

number of isolates reduced root growth. However, three of the 

65 Trichoderma isolates screened significantly promoted root 

growth (up to 40% more total root dry weight) compared to the 

methyl cellulose control. These isolates performed well when 

other parameters were examined with increased root:shoot 

ratio and root weight per root initial. Figure 1 presents example 

data from experiment one demonstrating the ability of 

Trichoderma isolate T6 to increase all measured parameters. 

Root dry wt (g) 

Root wt / root initial (g) 

Root : shoot 

0.80 

0.60 

0.40 

0.20 

0.00 

0.04 

0.03 

0.02 

0.01 

0.00 

1.00 

0.80 

0.60 

0.40 

0.20 

0.00 

Total root dry weight 

Root weight / root initial 

Root : shoot 

T 1 T 2 T 3 T 4 T 5 T 6 Methyl Fulvic Thiram 

cellulose acid 

* 

* * 

Figure 1. The effects of six Trichoderma isolates (T1‐T6) on root 

weight/root initial, root/shoot ratio, and total root dry weight in willow 

compared to the control treatments methyl cellulose, fulvic acid, and 

Thiram for experiment 1. 5% LSD bars are shown (* indicates treatments 

significantly better than the methyl cellulose control). 

These three isolates plus others which showed potential for 

promoting root growth will be further evaluated in additional 

experiments on other plant host cutting/seedling systems. 


We wish to thank Candice Barclay, Bronwyn Braithwaite, 

Prashant Kumar Chohan, Emily Duerr, Stuart Larsen, Kirstin 

McLean, Mana Ohkura, for their technical assistance. 

REFERENCES 

1. Adams P, De‐Leij AM, Lynch JM (2007) Trichoderma harzianum Rifai 

1295–22 mediates growth promotion of crack willow (Salix fragisis) 

saplings in both clean and metal‐contaminated soil. Microbial 

Ecology 54, 306–313. 

* 

* 




Biofumigation for reducing Cylindrocarpon spp. in New Zealand vineyard and nursery 

soils 

C.M. Bleach{ XE "Bleach, C.M." }, E.E. Jones and M.V. Jaspers 

A 

Ecology Department, Faculty of Agriculture and Life Sciences, Lincoln University, PO Box 84, Lincoln 7647, New Zealand 

INTRODUCTION 

The soil‐borne disease, Cylindrocarpon black foot disease (BF), is 

reported as the cause of decline of young grapevines in new and 

replanted vineyards world‐wide. Cylindrocarpon destructans, 

C. liriodendri and C. macrodidymum have been found to be 

equally associated with this disease in New Zealand vineyards 

and nurseries. 

Brassica species contain significant quantities of the 

thioglucoside compounds known as glucosinolates (GSLs). When 

GSLs are hydrolysed by the myrosinase enzyme present in 

Brassica tissue, volatile isothiocyanates (ITCs) are produced [1]. 

ITCs are known to have broad biocidal activity in the suppression 

of pathogenic fungal species, nematodes, weeds, and certain 

insect species [2]. The principal suppressive effect of brassica 

amendments on soil‐borne diseases occurs at flowering, 

immediately after their maceration and incorporation into soil 

[3]. ITCs are also exuded from the roots of brassicas throughout 

their growth. The efficacy of Brassica spp. for control of 

Cylindrocarpon spp. in grapevines was tested in field 

experiments. 


A preliminary experiment used crops of mustard (Brassica 

juncea), rape (B. napus) and oats (Avena sativa). They were 

grown for 5 weeks in an infested site, where young vines 

previously grown had been infected with the above 

Cylindrocarpon spp. The brassica crops were cultivated into the 

soil and the area covered with polythene. After 2 weeks, callused 

rootstock cuttings (varieties 101–14 and 5C) were planted in the 

treated soil in a randomised split plot design (5 plots per 

treatment) according to standard nursery practices. The plants 

were grown for 9 months, harvested and infection assessed by 

isolation onto potato dextrose agar. Cylindrocarpon spp. were 

identified morphologically after 7–10 days incubation at 20ºC. 

The second experiment used 3 mustard treatments (Trt 1–3) 

• Trt 1. Mustard meal cultivated into the soil. 

• Trt 2. Grown once to flowering with cultivation. 

• Trt 3. Grown twice to flowering with cultivation each time. 

When Trt 3 was flowering (4 weeks), the entire field was 

inoculated with Cylindrocarpon spp. grown on wheat grains (3 

isolates of each species) and 2 days later the mustard plants 

were cultivated into the soil and the area covered with 

polythene. After 3 days the polythene was removed and mustard 

seed was sown for Trt 2 and Trt 3 and grown to flowering. At this 

time, the mustard meal (Trt 1) was broadcast and all 3 

treatments were incorporated into the soil. The area was 

covered with polythene for 2 days then callused cuttings of 

rootstocks 101–14 and 5C (20 per plot) were planted in a 

randomised split plot design (5 plots per treatment). The plants 

were grown for 10 months then infection assessed as above. 

Analysis of data was with a general linear model appropriate to 

the split‐plot randomised block design. 

RESULTS 

In the preliminary experiment (Fig 1a), although not significant 

(P=0.137), disease incidence (DI) was reduced by the mustard 

treatment in rootstocks 101–14 and 5C (11 and 43%, 

respectively). DI was decreased in rootstock 5C by the oats 

treatment but increased in 101–14 and increased in both 

rootstocks by the rape treatment. The mustard treatment was 

further tested in a second experiment (Fig 1b). Again, treatment 

effects were not significant for DI (P=0.359), which was reduced 

by Trt 1 and 3 in both rootstocks and in 5C by Trt 2. Overall, DI 

was reduced by the mustard treatments in rootstock 5C by more 

than 41% and in experiment two DI was reduced by Trt 1 and Trt 

3 in rootstock 101–14 by 30 and 18%, respectively. 

Mean disease incidence 

6 

5 

4 

3 

2 

1 

0 

Figure 1. Mean Cylindrocarpon incidence in grapevine varieties 101–14 

and 5C after cultivation of (a) brassica and oat crops and (b) mustard as 

crops and mustard meal. 

DISCUSSION 

The results indicate that biofumigation with mustard was 

effective for reducing infection by Cylindrocarpon spp. 

particularly in rootstock 5C, but less so in 101–14, which is more 

susceptible to BF disease. Overall, treatments 1 and 3 were able 

to reduce disease incidence by 36 and 27%, respectively. Despite 

the lack of statistical significance (which may be due to high 

variability), these findings suggest that mustard treatments may 

be a highly effective method for the control of BF disease. 

Biofumigation may well be a natural, effective, and economical 

way to eliminate pests and diseases in vineyard and nursery 

soils, to improve soil structure and soil organic matter, and to 

increase soil microbial activity. A key to improving the efficacy of 

biofumigation in the field lies in the development of application 

technologies that macerate and incorporate the biofumigant 

evenly in soils, in addition to incorporating it under optimal 

edaphic conditions for release of ITCs [3]. 


New Zealand Winegrowers, Corbans Viticulture and Technology 

NZ (TIF) for assistance and financial support. 

REFERENCES 

5C 

101-14 

Control 

Mustard 

Oats 

(a) 

Rape 

Treatment 

Control 

Mustard meal 

Mustard flower 1 

Mustard flower 2 

1. Kirkegaard, J.A. and M. Sarwar, Biofumigation potential of brassicas 

Plant and Soil. 1998. 201(Number 1): p. 71–89. 

2. Brown, P.D. and M.J. Morra, Control of soil‐borne plant pests using 

glucosinolate‐containing plants. Advances in Agronomy. 1997. 

61(167–231). 

3. Mattner, S.W., et al., Factors that impact on the ability of 

biofumigants to suppress fungal pathogens and weeds of 

strawberry. Crop Protection, 2008. 27(8): p. 1165–1173. 

 

(b) 

6 

5 

4 

3 

2 

1 


Crown rot of winter cereals: integrating molecular studies and germplasm 

improvement 

Mark W. Sutherland{ XE "Sutherland, M.W." } A , W.D. Bovill A,D , F.S. Eberhard A , A. Lehmensiek A , D. Herde B and S. Simpfendorfer C 

A Centre for Systems Biology, Faculty of Sciences, University of Southern Queensland, Toowoomba, QLD 4350 

B DEEDI, Primary Industries and Fisheries, Leslie Research Centre, Toowoomba, QLD 4350 

C NSW Department of Primary Industries, Marsden Park Road, Tamworth, NSW 2340 

D Current address: School of Food, Agriculture and Wine, University of Adelaide, Waite Campus, PMB1, Glen Osmond, SA 5064 

INTRODUCTION 

Crown rot of winter cereals is a major constraint on grain 

production across most growing regions in Australia, particularly 

where stubble retention is practiced to maintain soil structure 

and retain soil water. The predominant cause of this disease is 

infection with Fusarium pseudograminearum (Fpg), although in 

some southern areas Fusarium culmorum infections are also 

significant. These Fusarium species are able to grow 

saprophytically on stubble remnants over the summer and 

provide inoculum for crop infection in the following season. 

Losses due to crown rot are highest in seasons featuring a dry 

finish in which maturing plants experience water stress, with 

symptoms including basal stem browning and white heads 

bearing no grain. 

Control of this disease is challenging and is currently based on 

management practices centred on crop rotation strategies. At 

present, there are no resistant commercial varieties of bread 

wheat, durum or barley available for deployment. Durum wheats 

are particularly susceptible. 

We are currently undertaking a long‐term collaborative research 

program which aims to: 

• characterise known resistance sources 

• develop molecular markers for quantitative trait loci (QTL) 

to assist selection in breeding programs 

• transfer QTL for resistance from hexaploid (bread) to 

tetraploid (durum) wheats 

• pyramid resistance in bread wheats 

• understand the fundamental biology of this host/pathogen 

interaction. 

Central to the task is an integration of laboratory and field‐based 

investigations to ensure outcomes that not only advance our 

knowledge but also reduce yield losses and increase 

management options for primary producers. 

Here we report on recent successes in pyramiding sources of 

partial resistance and discuss progress in transferring resistance 

from hexaploid sources into a durum background. 

METHODOLOGY 

Two doubled haploid wheat populations produced from crosses 

of partially resistant parents, Sunco/2‐49 and 2‐49/W21MMT70 

were evaluated for resistance to crown rot using a standard 

seedling pot test inoculated with a mixture of aggressive Fpg 

isolates(1). Based on genetic maps constructed from SSR and 

DArT markers, QTL for resistance were then identified. 


To date, a wide selection of resistance sources have been 

partially characterised and quantitative trait loci (QTL) identified 

(2, 3, 4). Inoculated seedling and field trials indicate overlapping 

sets of loci that contribute at these different stages of 

development. These partial sources of resistance contain largely 

different sets of QTL which suggest that improved resistance 

may be obtained by gene pyramiding. Results from QTL analysis 

of the Sunco/2‐49 and 2‐49/W21MMT70 populations following 

seedling trials indicate that the more resistant lines inherited the 

major QTL from each parent and that a number of lines in the 2‐ 

49/W21MMT70 population expressed significantly higher 

resistance than either of the parents. Hence pyramiding of 

independent resistance sources can produce significant 

improvements in the resistance of derived progeny towards 

crown rot. 

Marker analysis of hexaploid x tetraploid crosses shows that the 

bread wheat markers were readily transferred to the progeny. 

Furthermore even after several generations these markers 

remained linked to the resistance character and were 

independent of remnant D genome material. Crosses of durum 

wheats with the hexaploid resistance sources significantly 

reduced the disease severity in derived materials, demonstrating 

the potential of this approach for improving the resistance of 

durums to crown rot. 


We acknowledge the contributions of Dr Graham Wildermuth 

and Dr Ray Hare to this work. This work was funded by the 

Grains Research and Development Corporation (GRDC). 

REFERENCES 

1 Wildermuth GB, McNamara RB (1994) Testing wheat seedlings for 

resistance to crown rot caused by Fusarium graminearum Group 1. 

Plant Disease 78: 949–953. 

2 Collard BCY, Grams RA, Bovill WD, Percy CD, Jolley R, Lehmensiek A, 

Wildermuth GB, Sutherland MW (2005) Development of molecular 

markers for crown rot resistance in wheat: mapping of QTLs for 

seedling resistance in a 2‐49 x Janz population. Plant Breeding 124: 

1–6. 

3 Collard BCY, Jolley R, Bovill WD, Grams RA, Wildermuth GB, 

Sutherland MW (2006) Confirmation of QTL mapping and marker 

validation for partial seedling resistance to crown rot in wheat line 

‘2‐49’. Aust J Agric Res 57: 967–973. 

4 Bovill WD, Ma W, Ritter K, Collard BCY, Davis M, Wildermuth GB, 

Sutherland MW (2006) Identification of novel QTL for resistance to 

crown rot in the doubled haploid wheat population ‘W21MMT70’ x 

‘Mendos’. Plant Breeding 125: 538–543. 


Crosses between hexaploid wheat lines with partial resistance 

and a range of durum lines were obtained from Dr Ray Hare, 

NSW DPI. These materials were field grown near Tamworth NSW 

in Fpg infected plots through to the F7 generation and assessed 

for crown rot susceptibility each season. 



INTRODUCTION 

Infection of wheat tissues by Fusarium pseudograminearum 

N.L. Knight{ XE "Knight, N.L." } A , A. Lehmensiek A , D.J Herde B , M.W. Sutherland A 

A Centre for Systems Biology, Faculty of Sciences, University of Southern Queensland, Toowoomba, 4350, QLD 

B DEEDI, Primary Industries and Fisheries, Leslie Research Centre, Toowoomba, 4350, QLD 

Crown rot of wheat, caused by Fusarium pseudograminearum 

(Fp), is a serious disease threat across the Australian wheat belt. 

Currently control of this disease relies on farming practices (e.g. 

crop rotation) and planting of less susceptible cultivars. Partial 

resistance has been identified in a small number of wheat lines, 

such as 2–49 and Sunco, but the mechanisms of resistance 

shown by these lines have not been identified. 


A strong relationship was observed between visual rating scores 

of wheat leaf sheaths and the normalised Fp DNA (Fig. 1). This 

demonstrates that the degree of visual discolouration of wheat 

leaf sheaths correlates with the quantity of Fp mycelium present 

in the tissue, validating visual rating systems of basal 

discolouration (2,3) as a relative estimation of tissue infection 

levels across a seedling trial. 

Partial resistance can be expressed in either the seedling or adult 

stage, depending on the genotype, with the majority of current 

screening methods being based on seedling scoring. Extensive 

seedling trial comparisons between susceptible and partially 

resistant host genotypes suggest a significantly slower spread of 

the fungus in the younger tissues of resistant individuals (1). 

The current project aims to assess growth of Fp during crown rot 

development across partially resistant and susceptible wheat 

lines in order to determine key elements in the progress of 

disease and when resistance mechanisms are induced. Current 

disease rating systems for seedlings rely heavily on browning of 

leaf sheaths and tiller bases (2). Our current investigations are 

centred on the relationship between the expression of these 

visible disease symptoms and the extent of fungal infection. 

These studies are also comparing the progress of fungal spread 

in both susceptible and partially resistant wheats. The increase 

in fungal load in each inoculated host genotype has been 

measured using a quantitative real time multiplex polymerase 

chain reaction (PCR) assay, allowing simultaneous detection of 

both pathogen and host DNA. Microscopy of infected wheat 

tissues is also in progress. 


Inoculation. Two week old seedlings were inoculated using a 10 6 

conidia per mL suspension (3). Seedling tissues (particularly leaf 

sheaths) were harvested at different time points after infection, 

with four host genotypes being compared (Table 1). 

Table 1. Genotypes tested and their resistance rating from field trials. 

DNA Extraction and Multiplex Quantitative PCR. DNA was 

extracted using the DNeasy Minikit (Qiagen). Primers and probes 

were designed from Genbank sequences with Primer3 software 

using the translation elongation factor (TEF)‐α sequence of Fp 

and the TEF‐G sequence of wheat. PCR results were normalised 

by expressing Fp DNA content relative to the host DNA. 

Normalised 

(Pathogen/Host DNA) 

0.05 

0.04 

0.03 

0.02 

0.01 

0 

LS1 

LS2 

LS3 

R 2 = 0.78 

0 1 2 3 4 

Visual Rating (1-4) 

Figure 1. Comparison of levels of normalised Fp DNA and visual rating 

scores of leaf sheaths (LS) 1, 2 and 3 of the four host genotypes at 7 days 


Observation of Fp growth at increasing periods after inoculation 

has revealed significant differences in growth of Fp in seedlings 

of the four standard genotypes. 

Microscopic assessment of Fp growth has observed intra‐ and 

inter‐cellular growth associated with the leaf sheath epidermis, 

including trichomes and stomata. Current investigations are 

examining growth of mycelium in vascular tissues of expanded 

tillers. 

REFERENCES 

1. Percy C (2009) Crown rot (Fusarium pseudograminearum) symptom 

development and pathogen spread in wheat genotypes with 

varying disease resistance. PhD Thesis, University of Southern 

Queensland. 

2. Wildermuth GB, McNamara RB (1994) Testing wheat seedlings for 


Plant Disease, 78, 949–953. 

3. Mitter V, Zhang MC, Liu CJ, Ghosh R, Ghosh M, Chakraborty S 

(2006) A high‐throughput glasshouse bioassay to detect crown rot 

resistance in wheat germplasm. Plant Pathology, 55, 433–441. 

4. Hückelhoven R, Kogel KH (1998) Tissue‐specific superoxide 

generation at interaction sites in resistant and susceptible nearisogenic 

barley lines attacked by the powdery mildew fungus 

(Erysiphe graminis f. sp. hordei). Molecular Plant Microbe 

Interactions, 11, 292–300. 

Microscopy. Fixation and clearing of tissues was performed as 

described in (4). Differential staining used safranin and 

solophenyl flavine dyes. Viewing of tissue was performed using a 

fluorescence microscope (Nikon Eclipse) under the UV‐2A filter. 


Monitoring sensitivity to strobilurin fungicides in Blumeria graminis on wheat and 

barley in Canterbury, New Zealand 

INTRODUCTION 

S.L.H. Viljanen‐Rollinson{ XE "Viljanen‐Rollinson, S.L.H." } A , M.V. Marroni A , R.C. Butler A and G. Stammler B 

A New Zealand Institute for Plant and Food Research Limited, Private Bag 4704, Christchurch, New Zealand 

B BASF Aktiengesellschaft, APR/FB‐LI470, D‐67117, Limburgerhof, Germany 

Strobilurin fungicides (Quinone ‘outside’ Inhibitors (QoI)) act at 

the Qo binding site of the cytochrome bc1 complex in target 

fungi (1). Because QoIs have a specific, single‐site mode of 

action, there is a greater risk of developing resistance to these 

types of fungicides than to multi‐site inhibitor fungicides. QoIs 

were first commercialised in 1996 and have since been widely 

used overseas and in New Zealand to control various plant 

diseases. QoI‐resistance occurred in Europe in 1998. QoI 

resistance has been encountered in 29 different pathogens to 

date (2). In most cases, QoI resistance is conferred by a single 

point mutation in the cytochrome b gene at the amino acid 

codon 143, causing glycine to be replaced with alanine (G143A). 

Sensitivity to QoIs in the pathogens causing powdery mildew of 

wheat (Blumeria graminis f. sp. tritici) and barley (B. graminis f. 

sp. hordei) was investigated in Canterbury, New Zealand cereal 

crops during two growing seasons (2004–05 and 2005–06). 


Three different surveys (spring 2004, autumn 2005 and spring 

2005) were carried out using two methods of spore collection. In 

the first method, isolates of powdery mildew were collected 

from infected plants, bulked up in a glasshouse and tested on 

detached leaves of barley and wheat either treated with 

kresoxim‐methyl or left untreated. Numbers of colonies formed 

on the leaves were counted. In the second method young trap 

seedlings of wheat (cv. Kotare) or barley (cv. Cask), either 

treated with kresoxim‐methyl or left untreated, were exposed to 

the air spora at a specific location for 5–7 days, then placed in a 

glasshouse until lesions appeared. At each site, 15 untreated and 

15 treated pots, with 10 plants per pot, were used. Lesions on 

untreated and treated leaves were counted, and colonies that 

grew on treated leaves were kept in isolation chambers for 

further analysis on detached leaves. There were a total of 33 

wheat and 28 barley sites over the two seasons. Data (only 

spring 2005 results shown) were analysed using a log‐linear 

model for count data with GenStat. 

Fifteen isolates of B. graminis f.sp. tritici collected from wheat 

plants at six sites and 12 isolates of B. graminis f.sp. hordei 

collected from barley plants at six sites in the three surveys were 

tested for presence of mutation G143A. These isolates had 

shown increased resistance to QoIs in the lab tests. DNA was 

extracted from the lesions and the cytochrome b ‐gene was 

amplified with PCR. For qualitative analysis the product was 

digested with restriction enzyme Sat1 to detect the presence of 

the gene G143A for resistance and for quantitative analysis the 

PCR‐product was analysed using pyrosequencing. 

RESULTS 

Spring 2004. Trap plant studies indicated that in nine out of ten 

sampled locations, wheat powdery mildew colonies were able to 

grow on fungicide‐treated plants. The results for barley powdery 

mildew showed that in seven out of nine locations, barley 

powdery mildew colonies were able to grow on fungicidetreated 

plants. No resistance was detected in any of the isolates 

collected from infected plants in the field. 

Autumn 2005. Survey results indicated no resistance to wheat 

powdery mildew, but resistant barley powdery mildew isolates 

were found at all five sites where trap plants were placed, and 

four out of six sites where isolates were collected from infected 

plants in the field. 

Spring 2005. Trap plant results indicated that resistant wheat 

powdery mildew isolates were found in seven out of eight trap 

plant sites although in one of these six sites, only one colony was 

found on all of the 150 plants. One isolate from these sites was 

found to contain the gene G143A. Barley trap plant results 

indicated that resistant powdery mildew colonies were found in 

all seven sites. Two isolates from these sites were found to 

contain the gene G143A. 

The mean number of colonies per leaf was greater (P < 0.05) on 

unsprayed plants than on sprayed plants at all sites except at 

one wheat site. At this site, the mean number of colonies was 

significantly greater (P = 0.007) on the fungicide‐treated leaves 

than on the untreated leaves. For wheat, mean numbers of 

colonies per leaf on unsprayed plants varied from below 1 to 

27.5. For barley, mean numbers of colonies per leaf varied from 

below 1 to more than ten per leaf. 

Four of the 15 B. graminis f. sp. tritici isolates and all 12 B. 

graminis f. sp. hordei isolates contained the gene G143A as 

indicated by PCR. 

DISCUSSION 

These results confirm that populations of B. graminis resistant to 

QoI fungicides are affecting wheat and barley crops in 

Canterbury. Isolates carrying the gene G143A express high 

(complete) resistance. As a consequence, continued applications 

of solo QoIs over time are very likely to result in severe loss in 

disease control. Further surveys of resistance to these fungicides 

have not been carried out since spring 2005. These should be 

carried out as soon as possible to monitor the situation so that 

growers can adopt appropriate fungicide resistance 

management strategies. 


We thank Foundation for Arable Research for funding, and 

participating growers and Mr Grant Hagerty for assistance in 

these studies. 

REFERENCES 

1. Holomon D (2007) Are some diseases unlikely to develop QoI 

resistance? Pest Management Science 63, 217–218. 

2. Fungicide Resistance Action Committee (FRAC), Pathogens with 

field resistance towards QoI fungicides (Status Dec 2008), 

http://www.frac.info/ 




INTRODUCTION 

Cross inoculation of crown rot and Fusarium head blight isolates of wheat 

P.A.B. Davies{ XE "Davies, P.A.B." } A , L.W. Burgess B , R. Trethowan A , R. Tokachichu A , D. Guest B 

A 

Plant Breeding Institute, University of Sydney, PMB 11, Camden, NSW, 2750 

B 

Faculty of Agriculture, Food and Natural Resources, University of Sydney, NSW, 2006 

Fusarium head blight (FHB) and crown rot (CR) of wheat are two 

cereal diseases caused by Fusarium pathogens in Australia. Both 

Fusarium graminearum and F. pseudograminearum have been 

responsible for FHB epidemics (1, 2), while F. 

pseudograminearum is most commonly associated with CR. 

Recently, reports of F. graminearum causing CR have emerged 

from glasshouse seedling tests (3). 

Crown rot and FHB are linked through aetiology, pathogen 

biology and epidemiology. The presence of perithecia on stubble 

could potentially allow the infection of wheat seedlings following 

ascospore release. Similarly, lodging of crops during heavy rain 

would allow wheat heads to come in close proximity of wheat 

crowns or residue with sporodochia of F. pseudograminearum, 

allowing FHB infection through splashed macroconidia (1). This 

does suggest however that there is no pressure for pathogenic 

specialisation as an individual isolate must retain pathogenicity 

for both crown and head infections. 


Results of the CR assay display a significant affect of genotype 

for both F. graminearum and F. pseudograminearum (P

Twenty years of quarantine plant disease surveillance on the island of New Guinea: 

key discoveries for Australia and PNG 

R.I. Davis{ XE "Davis, R.I." } A , P. Kokoa B 

A Northern Australia Quarantine Strategy (NAQS), Australian Quarantine and Inspection Service (AQIS), PO Box 96, Cairns International 

Airport, Cairns 4870, Queensland 

B National Agricultural Quarantine and Inspection Authority (NAQIA), PO Box 741, Port Moresby, NCD, Papua New Guinea 

INTRODUCTION 

The island of New Guinea lies just 5 km from Australia’s northern 

border and has a history of plant pest incursions, presumably 

from the west. Since 1989, quarantine plant pathologists from 

Papua New Guinea (PNG) and the Australian Quarantine and 

Inspection Service (AQIS) have conducted regular joint surveys in 

PNG’s border regions. Since the mid 1990s, this search for exotic 

pathogens became annual. Less frequently over this period, 

Australian teams have also worked with Indonesian counterparts 

in the Indonesian province of Papua, which occupies the eastern 

half of the New Guinea land mass. 


Herbarium specimens and other kinds of plant tissue samples 

are collected, rendered quarantine secure, and returned under 

permit to various laboratories in Australia, PNG, and occasionally 

elsewhere, for diagnostic testing. 

RESULTS 

Major detections of quarantine significance are listed in Table 1. 

These are backed up by a list of finds of other important crop 

pathogens published in the last decade including first records on 

the island of New Guinea of Banana streak GF virus, Banana 

streak Mys virus, and Banana streak OL virus; first records in 

PNG of Citrus tristeza virus, Papaya ringspot virus –type W, 

Watermelon mosaic virus, and Zucchini yellow mosaic virus; first 

valid laboratory confirmation of Fiji disease virus, in sugarcane; 

and unpublished first records of Cucumber mosaic virus and teak 

rust caused by Olivea tectonae (P. Kokoa, NAQIA unpublished 

data, 2008). 

DISCUSSION 

These collaborative surveys have provided a rich source of 

quarantine incursion information for both Australia and PNG. 

Critical initial detections of major pathogen threats to 

horticultural, field and ornamental commodities of importance 

to both countries have been made (Table 1). Moreover, the 

ongoing and regular nature of this work in PNG facilitated close 

monitoring of spread, following incursion, of fusarium wilt of 

banana and huanglongbing (HLB) of citrus. Whilst later finds of 

Foc VCG0126 were quite distant from the original one, HLB has 

been effectively contained since its discovery in 2002. 

These surveys have also yielded critical information on the 

distribution of certain diseases endemic in PNG, but still of 

extreme quarantine concern to Australia. These include citrus 

canker, caused by Xanthomonas citri subsp. citri, and black 

Sigatoka disease of banana caused by Mycosphaerella fijiensis. 

Although citrus canker is widespread in the border regions, it is 

patchy in distribution: detected only in well separated larger 

communities. Black Sigatoka, in contrast, is ubiquitous, and over 

100 samples have been collected. 

In addition, certain key pathogens of regional quarantine 

concern, because of their recent history of spread in south east 

Asia, have not been detected on any AQIS surveys on the island 

of New Guinea. These include Banana bunchy top virus, cause of 

bunchy top disease of banana, and Cavendish competent strains 

of Guignardia musae, cause of freckle disease of banana. No 

convincing symptoms of bunchy top disease have ever been 

seen and all samples so far tested by enzyme linked 

immunosorbent assay were negative. Over 50 G. musae or 

Phyllosticta musarum (anamorph) herbarium specimens have 

been collected. However, all were from cooking bananas (ABB 

genome) or plantains (AAB genome). In the case of many of 

these collections, uninfected Cavendish sub group bananas were 

growing adjacent or nearby. 

The results summarised here underline the critical importance, 

to Australia and PNG, of effective quarantine vigilance. This can 

only be achieved with an ongoing program of regular 

surveillance. 


Table 1. Highlights of general disease surveys on the island of New Guinea, 1989–2009 

Year Location A Host Pathogen Key discovery Published B 

1993 Papua, 

Indonesia 

Musa sp. 

Fusarium oxysporum f.sp. 

cubense (Foc) ‐VCG0126 

First record of fusarium wilt of banana on the 

island of New Guinea 

APP, 25 

1996 SP, PNG Musa sp. Foc –VCG 0126 First record of fusarium wilt of banana in PNG APP, 25 

1997 Papua, 

Indonesia 

1999 Papua, 

Indonesia 

1999 Papua, 

Indonesia 

1999 Papua, 

Indonesia 

1999 Papua, 

Indonesia 

Musa spp. Foc –VCG 01213/16 First record of ‘tropical race 4’ of Foc on the 


Musa sp. Blood disease bacterium First record of blood disease of banana on the 


Citrus spp. 

‘Candidatus Liberibacter 

asiaticus’ 

First record of huanglongbing (greening disease) 

on the island of New Guinea 

Oryza sativa Rice tungro bacilliform virus First record of rice tungro disease on the island 

of New Guinea 

Arachis hypogea 

Bean common mosaic virus, 

peanut stripe strain 

Confirmation of widespread occurrence of 

peanut stripe disease in Papua 

APP, 29 

APP, 29 

APP, 29 

APP, 29 

APP, 31 

2002 SP, PNG Citrus spp. ‘Ca. L. asiaticus’ First record of HLB in PNG APP, 33 

2006 SP, PNG Heliconia sp. Puccinia heliconiae First record in PNG APDN, 3 

A SP: MP: Morobe Province, Sandaun Province, WP: Western Province 

B APP: Australasian Plant pathology, APDN: Australasian Plant Disease Notes, volume number is listed. 



The importance of reporting suspect exotic or emergency plant pests to your State 

Department of Primary Industry 

INTRODUCTION 

S.A. Peterson{ XE "Peterson, S.A." } A , and F.J. Macbeth B 

A 

Plant Health Australia, 5/4 Phipps Close, Deakin, 2600, ACT 

B 

Australian Government Department of Agriculture, Fisheries and Forestry, GPO Box 858, Canberra, 2601, ACT 

The Emergency Plant Pest Response Deed (EPPRD) (1) is a formal 

legally binding agreement between Plant Health Australia (PHA), 

the Australian Government, all State and Territory Governments 

and plant industry signatories covering the management and 

funding of eradication responses to Emergency Plant Pest (EPP) 

Incidents. Plant Health Australia is the Custodian of the EPPRD 

and it became operative on October 26, 2005. 

The EPPRD replaces previous informal arrangements and 

provides a formal role for industry to participate and assume a 

greater responsibility in decision making in relation to EPP 

responses. 

DISCUSSION 

The EPPRD only operates for the eradication of EPPs. There are 

four criteria in the EPPRD for the definition of an EPP and the 

Pest only has to satisfy one of these to be considered an EPP. 

Briefly, these are: 

1. A new pest to Australia 

2. A different variation or strain of established pest 

3. A previously unknown pest 

4. A confined or contained pest 

The formal definitions can be found in Clause 1.1 Definitions of 

the EPPRD. There is a list of EPPs that have already met one of 

the definitions and have been Categorised in Schedule 13 of the 

EPPRD. 

For an eradication response to be agreed it must be both 

technically feasible and cost beneficial to eradicate the pest. As 

such, early reporting of suspect emergency plant pests is a 

critical step in the process. The longer it takes for a suspected 

EPP to be reported, the more time the pest has to become 

established and more wide spread. This increases the costs of 

containment, control and eradication measures, reduces the 

technical feasibility and therefore reduces the likelihood of 

success of eradication. Figure 1 demonstrates the differences in 

probability of successful eradication compared to time from 

detection to reporting. 

Government Signatories to the EPPRD undertake to provide 

formal notification within 24 hours of becoming aware of an 

incident and take all reasonable steps to ensure that persons 

within their jurisdiction are aware they need to advise that 

government within 24 hours of becoming aware of an incident 

so that the formal notification can be made. It is important that 

diagnosticians and researchers understand their responsibility, 

not only a moral obligation to protect Australian agriculture and 

horticulture but this legal obligation that now exists for 

jurisdictions and their personnel. Personnel of government 

agricultural agencies need to report a ‘reasonably held suspicion’ 

of an exotic pest to their jurisdiction’s Chief Plant Health 

Manager directly or via the Exotic Plant Pest Hotline (1800 084 

881). 

It is also important for the integrity of the EPPRD that all Parties 

(government and industry) understand their rights and 

responsibilities and adhere to them. If Parties do not adhere, as 

closely as possible, to their responsibilities under the EPPRD, the 

work done to improve collaboration and trust between all 

Parties is eroded. 

Many significant plant pests are cryptic and not readily visible. 

Red Imported Fire Ant is estimated to have been present for as 

many as five years before detection, likewise European House 

Borer may have been present for as long as 50 years before 

detection. 

Both of these pests would have cost considerable less to 

eradicate if they had been detected and reported within the first 

few generations. 

Not only does the EPPRD provide an obligation to report a 

‘reasonably held suspicion’ but there is the potential for cost 

sharing of actions taken to be rejected if it is deemed that there 

has been a failure to report in a timely manner. 


The authors would like to thank Dr Peter Caley of the Bureau of 

Rural Sciences, Department of Agriculture, Fisheries and Forestry 

for his assistance with generating the graphical data. 

REFERENCES 

1. Plant Health Australia (2005) Government and Plant Industry Cost 

Sharing Deed in respect of Emergency Plant Pest Responses (Plant 

Health Australia; Canberra) 

Figure 1. Probability of successful eradication compared to reporting 

time lag following identification. 


The use of sentinel plantings in forest biosecurity; results from mixed eucalypt species 

trails in South‐East Asia and Australia 

INTRODUCTION 

T.I. Burgess{ XE "Burgess, T.I." } A , B. Dell A , G.E.StJ. Hardy A , P. Thu B 

A School of Biological Sciences and Biotechnology, Murdoch University, Murdoch, 6150, Australia 

B Forest Science Institute of Vietnam, Hanoi, Vietnam 

Many diseases of Eucalyptus species have emerged as pathogens 

in exotic plantations. Guava rust (Puccinia psidii), cryphonectria 

canker (Crysoporthe cubensis) coniotherium canker 

(Colletogloeopsis zuluensis) and Kirramyces leaf blight 

(Kirramyces destructans) are all serious pathogens that have not 

been found in native forests or in plantations in Australia 

(Burgess & Wingfield 2002; Cortinas et al. 2006; Glen et al. 2007; 

Wingfield et al. 2001). The susceptibility to these pathogens of 

Eucalyptus spp. commonly used in exotic plantations is known; 

however the susceptibility of many Eucalyptus spp. found only in 

natural ecosystems in Australia is unknown. There are two main 

uses of sentinel plantations. Firstly, tree species known to be 

susceptible to different pathogens can be planted within the 

natural environment to try and trap pathogens from their 

surroundings. In Australia, taxa trials planted in different 

environments act as sentinel plantings. By surveying these taxa 

trials we have collected and described a number of new eucalypt 

pathogens and reported the presence in Australia of Kirramyces 

destructans. The second use for sentinel planting is where many 

tree species are planted in a region known to harbour certain 

pathogens. In this manner the susceptibility of the different tree 

species can be determined. 


Taxa trials and adjoining natural vegetations have been surveyed 

in tropical and sub‐tropical Australia. This involves collection of 

diseased leaf and canker material, isolating the fungus using 

standard techniques and identification of the fungi using classic 

taxonomy and molecular phylogeny 

We have established sentinel trials of 25 eucalypt species in 

Vietnam, China and Thailand in regions known to harbour 

Kirramyces destructans and Colletogloeopsis zuluensis. To date 

only the trial in Vietnam has been surveyed for impact of leaf 

pathogens and insects. In addition, trees have been inoculated 

with Colletogloeposis zuluensis and lesion formation and lesion 

length measured. A matching trial has also been planted in 

northern Australia. 

not previously known to be affected. The trials in China and 

Thailand will be assessed in July 2009 prior and results available 

prior to the APPS conference in October 

Figure 1. (A) Leptocybe damage on young petioles, (B) Quambalaria spp. 

forming white spots on leaves 

These sentinel trials, established in Asia, will provide valuable 

information on the susceptibility to some of the keystone 

tropical Eucalyptus spp. to various exotic pathogens. 


The work was supported by an ARC Discovery project 

DP0664334. We thank Great Southern Limited for provided land 

and maintaining trial on the Tiwi Islands. 

REFERENCES 

1. Burgess TI, Wingfield MJ, 2002. Impact of fungi in natural forest 

ecosystems; A focus on Eucalyptus. In: K Sivasithamparam, KW 

Dixon, RL Barrett (eds), Microorganisms in Plant Conservation and 

Biodiversity, Kluwer Academic Publishers, Dordrecht. pp. 285–306. 

2. Cortinas M‐N, Burgess TI, Dell B, Xu D, Wingfield MJ, Wingfield BD, 

2006. First record of Colletogloeopsis zuluense comb. nov., causing 

a stem canker of Eucalyptus spp. in China. Mycological Research. 

110: 229–236. 

3. Glen M, Alfenas AC, Zauza EAV, Wingfield MJ, Mohammed C, 2007. 

Puccinia psidii: a threat to the Australian environment and 

economy‐a review. Australasian Plant Pathology. 36: 1–16. 

4. Wingfield MJ, Slippers B, Roux J, Wingfield BD, 2001. Worldwide 

movement of exotic forest fungi especially in the tropics and 

Southern Hemisphere. Bioscience. 51: 134–140. 



We have focused our sampling in northern Australia on fungi 

causing disease; on leaves the Mycosphaerellaceae 

predominated, especially Kirramyces species, the dominant 

pathogens in cankers belong to the Botryosphaeriaceae. Many of 

the species found have been described on eucalypts either in 

Australia, but often elsewhere where eucalypts are grown. 

Several new fungal species have been described. In the trial in 

Northern Australia only eucalypt species already known to be 

susceptible to K. destructans developed Kirramyces leaf Blight. 

The other 20 eucalypt species did not develop symptoms 

The trials in Vietnam have been monitored with the main finding 

being an expansion of the host range of the gall wasp Leptocybe 

invasa and the leaf pathogen Quambalaria eucalypti and the 

discovery of a new Quambalaria sp (Figure 1). The greatest 

lesion length after inoculation with Colletogloeopsis zuluensis 

was observed for Eucalyptus saligna and E. pellita, two species 



Methyl bromide alternatives for quarantine and pre‐shipment and other purposes— 

future perspectives 

J.E. Oliver{ XE "Oliver, J.E." } 

A Office of the Chief Plant Protection Officer, Plant Division, Biosecurity Services Group, GPO Box 858, Canberra, 2601, ACT 

INTRODUCTION 

The switch to methyl bromide alternatives for fumigation 

purposes has largely hinged on the ozone depleting status of this 

chemical. 

This paper explores the major plant and plant product 

commodities treated with methyl bromide for quarantine and 

pre‐shipment use on an Australian and international basis. 

The underlying domestic and international policy context, 

technical, regulatory, legislative, market access and trade and 

environmental factors, are all key drivers or impediments to 

adoption of alternatives. 

Yet there is no ‘silver bullet’ to replace methyl bromide 

treatment, or is there? Or is a paradigm shift required with how 

quarantine risk is assessed or when, how or if treatments are 

applied? 

Some of the key alternatives for plant and plant product 

commodities are identified, as are the underlying issues that 

determine the adoption or otherwise of alternatives. 


The Plant Health Committee consisting of plant protection 

officers from the Australian government and state biosecurity 

agencies commissioned an investigation of what methyl bromide 

alternative treatments were available for quarantine and preshipment 

and other plant uses. Specifically, what alternatives 

were under research, under registration and or in use in 

Australia and/or in use and/or registered internationally. 

To ensure data accessibility and an ongoing commitment to 

evaluating alternatives, an information system, the Methyl 

Bromide Alternatives Information System was created. 

International Plant Protection Convention standards for 

commodity classification and acceptance of a new phytosanitary 

treatment were adopted to ensure that the dataset would meet 

national and international requirements. 

of alternatives. Adoption by a country of alternatives is also 

dependent on quarantine services approving a treatment for 

use, and for trade using the alternatives being acceptable to 

both importing and exporting countries. 

The Methyl Bromide Alternatives Information System was 

designed to capture these factors and to provide a transparent 

and internationally acceptable repository for data on 

alternatives. 

The Methyl Bromide Alternatives Information System has over 

150 registered users and contains over 480 records. Initially 

registration was limited to within Australia. Since December 

2008 membership has been expanded to international 

subscribers through the IPPC network and by inviting further 

data input from the Quads countries—United States, Canada and 

New Zealand. 

Alternatives will be discussed using a case study of Australia’s 

highest volume uses for QPS and the pros and cons of 

alternatives that have been identified. 

Pests of quarantine concern where no efficacious alternatives 

have been identified, or for which there are no approved 

Australian quarantine treatments other than methyl bromide 

will also be discussed. 

The presentation will include a live demonstration of MBAIS and 

conference delegates will be encouraged to become registered 

users and data contributors to the system. 

REFERENCES 

1. Methyl Bromide Alternatives Information System 

www.daff.gov.au/mbais 

Whilst collating data on alternatives, a series of themes 

emerged. Through this process the major drivers and 

impediments to adopting alternatives were identified. 


The efficacy of alternative chemical or non‐chemical methods of 

fumigation was found not to be the primary driver for the switch 

to a methyl bromide alternative. 

Instead the underlying context of consumer demand for 

chemical free alternative treatments, occupational and 

environmental health concerns, more intense scrutiny for 

chemical registration and the European Union’s decision to 

deregister methyl bromide from March 2010 were the most 

significant contributing factors for adopting methyl bromide 

alternatives. 

The time between research and commercialisation of 

alternatives, the requirements for registration and variance in 

data protection laws contributed to different countries adoption 


Fruit extracts of Azadirachta indica induces systemic acquired resistance in tomato 

against Pseudomonas syringae pv tomato 

INTRODUCTION 

V. Bhuvaneswari, Parul Tyagi, Sandeep Soni, Satyakam Pugla and P.K. Paul{ XE "Paul, P.K." } 

Amity Institute of Biotechnology, Amity University, Express Highway, Sector ‐125, Noida, Uttar Pradesh ‐201303, India 

Last couple of decades has witnessed a spurt in use of plant 

extracts as biocontrol agents for controlling a wide range of crop 

pathogens. However mechanism of action of such extracts has 

not been well understood. 


In the present study 6 week old plants of two cultivars of tomato 

i.e. wild and a F1 hybrid were treated with aqueous fruit extracts 

of A.indica (neem). The treated plants were inoculated with 

spores of Ps Syringae either 24 hrs prior to or after neem 

treatment. Leaf samples were collected from inoculated noninoculated 

treated and control plants at intervals of 24 hours for 

6 days, for estimating the activity of phenylalanine ammonia 

lyase, tyrosine ammonia lyase, polyphenol oxidase and contents 

of total phenol, mRNA and proteins. Disease intensity was 

recorded after 3rd and 10th week of inoculation. Neem treated 

and control plants were also treated with inhibitors of 

transcription and translation. 



Wild cultivar after treatment has substantially lower infection 

after neem treatment as compared to F 1 hybrid and controls. In 

both cultivars there was a sharp increase in activity of PAL, TAL, 

PPO and concentration of total phenols. Treated plants had new 

mRNA and high concentration of some proteins. Treatment with 

inhibitors of transcription resulted in absence of new mRNA and 

reduced concentration of some proteins. Translational inhibitors 

inhibited the increase in concentration of proteins. SDS‐PAGE 

analysis had revealed increased concentration of PAL, TAL, PPO. 

Disease incidence of neem treated plants after 10 weeks of 

inoculation was substantially less than control. Results reveal 

that neem extracts control pathogen on tomato through 

induction of SAR. SAR induction is a function of plant genome as 

evidenced from difference in results of wild and F1 hybrids. 



Fungal foliar endophytes induce systemic protection in cacao seedlings against 


INTRODUCTION 

C. Blomley{ XE "Blomley, C." } A , E.C.Y. Liew B and D.I. Guest A 

A Faculty of Agriculture Food and Natural Resources, The University of Sydney, 2006, NSW 

B Royal Botanic Gardens Trust, The Royal Botanic Gardens, Sydney, NSW, 2000 

The fungal endophytes of cacao (Theobroma cacao) comprise a 

diverse assemblage including pathogens and saprophytes. The 

interaction between these endophytes and their host is not yet 

understood, although some fungal endophytes may protect their 

host against pathogens 1 . 

Black pod, caused Phytophthora spp. is responsible for losses to 

global cocoa production of around 20‐30% annually 2 . In Papua 

New Guinea, the main methods of controlling black pod caused 

by P. palmivora are to use resistant cultivars and cultural 

practices, as fungicides have limited efficacy and are generally 

not cost‐effective for small‐holder farmers. Biological control of 

cocoa diseases using endophytic fungi may provide another tool 

in the Integrated Pest and Disease Management toolbox. The 

purpose of this study was to identify common fungal endophytes 

present in Australia and Papua New Guinea capable of reducing 

disease severity of disease caused by P. palmivora. Such 

knowledge is an essential first step in the development of a 

biological control agent and will help to solve unanswered 

questions regarding the ecological role of fungal foliar 

endophytes. 


Endophytes were sampled from leaves and pods of cacao 

growing in five locations in Australia and Papua New Guinea. 

Common endophyte taxa were screened for the ability to reduce 

the growth of P. palmivora in vitro via dual culture and precolonised 

plate assays. The same endophyte taxa were tested for 

the ability to reduce severity of foliar disease caused by 

P. palmivora. Cacao seeds were germinated and either exposed 

to ambient endophyte spores in the glasshouse or were kept 

endophyte free by raising seedlings in sterile soil in a clean room. 

Two leaves on each seedling were infected with a 5.6 x 10 6 

propagules/ml suspension of a single endophyte taxon or of all 

taxa combined. Endophyte infection was tested 17 days later by 

harvesting one leaf from each seedling, surface sterilising leaf 

fragments and then plating them onto growth media. 18 days 

after endophyte inoculation, one endophyte infected and one 

endophyte free leaf on each seedling was inoculated with 

P. palmivora by applying a 30µl drop of zoospore suspension 

(400,000 zoospores /ml) to the leaf midvein which had been 

pierced with a sterile hypodermic needles. Control seedlings 

were mock inoculated with sterile water. Ten seedling replicates 

were prepared for each treatment and control. Disease severity 

was measured five days later as the length of the necrotic lesion 

along the mid vein. 

inoculation of one cacao leaf on a seedling with either 

Phomopsis or Diplodia resulted in uninoculated leaves on the 

same plant being less susceptible to disease compared to 

completely endophyte free seedlings. In contrast, addition of 

endophyte inoculum to seedlings that had already been infected 

with ambient endophytes in the glasshouse did not result in a 

reduction in disease severity caused by P. palmivora. 

DISCUSSION 

Results from these experiments demonstrate that common, noncoevolved 

endophyte taxa can increase the resistance of their 

host plants to pathogens. In some cases, endophyte mediated 

protection is systemic and therefore likely to be due to induction 

of a non‐specific defence response in the host. Harnessing this 

apparently beneficial interaction between endophytes and their 

host to manage plant disease may not be easily achievable as 

our results show that addition of more endophytes to already 

infected seedlings did not decrease disease severity. However, 

these results suggest that fungal foliar endophytes have a 

protective interaction with their host in a broader ecological 

sense. 

REFERENCES 

1. Arnold AE, Mejia LC, Kyllo D, Rojas WI, Maynard Z, Robbins N, Herre 

EA (2003) Fungal endophytes limit pathogen damage in a tropical 

tree. Proc. Nat. Acad. Sci. 100, 15649‐15654 

2. Guest DI (2007) Black Pod: Diverse pathogens with a global impact 

on cocoa yield. Phytopathology 97, 1650‐1653 

RESULTS 

Five of the common endophyte taxa tested inhibited the growth 

of P. palmivora when co‐cultured on corn meal agar compared 

to P. palmivora grown alone. Subsequent experiments showed 

that one Xylaria morphotype inhibited the growth of 

P. palmivora via antibiosis whilst the other endophytes were 

inhibitory via competition for resources. Two endophyte taxa 

that were inhibitory in vitro, as well as three other common 

endophyte taxa reduced disease severity in seedlings that had 

been grown in an endophyte free environment. Additionally, 


Effectiveness of the rust Puccinia myrsiphylli in reducing populations of the invasive 

plant bridal creeper in Australia 

INTRODUCTION 

Bridal creeper (Asparagus asparagoides) is a dense scrambling 

vine that smothers large areas of vegetation and threatens 

native biodiversity in Australia (1). In winter rainfall areas, it 

begins to grow in late summer – early autumn, produces fruit in 

mid to late spring and above‐ground foliage naturally senesces 

at the beginning of summer. Bridal creeper has been the target 

of a biological control program since the 1990s. Three agents of 

South African origin have since been released: the leafhopper 

Zygina sp. in 1999, the rust fungus Puccinia myrsiphylli in 2000 

and the leaf beetle Crioceris sp. in 2002 (2). Both the leafhopper 

and rust fungus have established widely on bridal creeper 

populations across temperate Australia. The rust fungus 

however, is the most effective agent, probably due to its major 

indirect impact on the plant’s below‐ground biomass (3). 

We report on results from two different approaches used to 

measure the effectiveness of P. myrsiphylli in reducing 

populations of bridal creeper across Australia. 


Before and after release comparisons. One to three years 

before releasing the rust, support structures (or trellises—2 m in 

height and 90 cm wide) were set up at the edge of 3 m 2 plots 

(three to four plots per site) in bridal creeper infestations at 15 

sites across southern Australia. Growth and reproductive 

parameters of bridal creeper in a 1 m 2 quadrat within each plot 

and climbing on the trellis were recorded in mid‐spring each year 

for up to 8 years after the release. Incidence of the rust was also 

measured annually. This long‐term experiment was performed in 

partnership with a range of collaborators across Australia. 

Fungicide exclusion experiments. Permanent 1 m 2 quadrats (10 

per site) with a central 100 cm long stake were set up in bridal 

creeper infestations at three sites in NSW and three sites in WA, 

where the rust fungus was the dominant agent. Sites in WA were 

managed by CSIRO Entomology staff based in Perth. Half of the 

quadrats at each site were maintained rust‐free using monthly 

fungicide applications during the growing season for 4 years. The 

remaining quadrats were sprayed with water only. Percentage 

cover of bridal creeper and other plant species within quadrats, 

as well as other bridal creeper growth and reproductive 

parameters, and disease incidence and severity were measured 

each year. 

L. Morin{ XE "Morin, L." } and A.M. Reid 

CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia 

rust‐infected quadrats, bridal creeper was replaced by both 

native and exotic species, although other weeds were more 

prevalent at disturbed sites. 

Foliage dry weight (g) or 

seedling or shoot number / m 2 

[ln(y+1)] 

5 

4 

3 

2 

1 

0 

Figure 1. Changes in bridal creeper growth parameters in permanent 1 

m 2 

quadrat established at 15 sites across southern Australia and 

monitored 1–2 year before and up to 8 years after the release of P. 

myrsiphylli. 

DISCUSSION 

Before 

release 

These studies demonstrate that P. myrsiphylli has major negative 

impacts on bridal creeper populations, although some sites may 

need to be carefully managed to facilitate native species 

recovery. For example, only a few plant species were present in 

rust‐infected quadrats by the end of the 4‐year fungicide 

exclusion experiment. More than four consecutive seasons of 

severe rust epidemics on bridal creeper may thus be required to 

sufficiently reduce populations and trigger major recruitment by 

other plants. 


3-year period immediately 

after release 

Monitoring period 

Late after 

release 

Foliage 

Seedlings 

Shoots 

We gratefully acknowledge the contribution to these 

experiments of our collaborators from The Departments of 

Primary Industries in NSW and Victoria, The Department of 

Water, Land and Biodiversity Conservation in South Australia 

and CSIRO Entomology based in Canberra and Perth. We also 

wish to thank Bob Forrester of CSIRO Entomology for his 

assistance with statistical analyses. This work was supported by 

CSIRO, Weeds CRC, the Australian Government (NHT & 

Defeating the Weed Menace initiative) and the respective 

organisation of our collaborators. 

147.4 

53.6 

19.1 

6.4 

1.7 

0 

Back-transformed scale 


RESULTS 

Before and after release comparisons. After the release of the 

rust, bridal creeper seedling and shoot numbers and aboveground 

biomass in the permanent 1 m 2 quadrats steadily 

declined at all sites (Fig. 1). In contrast, the impact of the rust on 

bridal creeper climbing onto trellises varied considerably 

between sites. 

Fungicide exclusion experiments. Bridal creeper cover, aboveground 

biomass, and shoot, fruit and seedling numbers were 

substantially lower in rust‐infected compared to rust‐free 

quadrats across all sites over the years. The cover of bare ground 

and leaf litter was consistently higher in rust‐infected quadrats 

than in rust‐free quadrats. When other plants did establish in 

REFERENCES 

1. Morin L, Batchelor KL, Scott JK (2006) The biology of Australian 

weeds. Asparagus asparagoides (L.) Druce. Plant Protection 

Quarterly 21, 46–62. 

2. Morin L, Neave M, Batchelor KL, Reid A (2006) Biological control: a 

promising tool for managing bridal creeper in Australia. Plant 

Protection Quarterly 21, 69–77. 

3. Morin L, Reid AM, Willis AJ (2006) Impact of the rust fungus 

Puccinia myrsiphylli on the below‐ground biomass of bridal 

creeper. In ‘Proceeding of 15th Australian Weeds Conference’ (Eds 

C Preston, JH Watts, ND Crossman) p 608. (Weed Management 

Society of South Australia). 



Evaluation of essential oils and other plant extracts for control of soilborne pathogens 

of vegetable crops 

INTRODUCTION 

C.A. Scoble{ XE "Scoble, C.A." } A,B , E.C. Donald A , K.M. Plummer B and I.J. Porter A 

A Department of Primary Industries, 621 Burwood Hwy, Knoxfield, Victoria, 3180 

B Botany Department, La Trobe University, Bundoora, Victoria, 3086 

Soilborne plant pathogens including Pythium spp, Fusarium spp, 

and Rhizoctonia spp, can cause important diseases such as root 

rot and damping off, resulting in heavy crop losses in vegetables 

farms. Control of these diseases is problematic because these 

pathogens have a wide host range and survive in soil as 

oospores, chlamydospores and melanised hyphae, respectively, 

for long periods. Compounds derived from plant extracts have 

been proposed as potential control treatments for soilborne 

pathogens due to their antimicrobial activity in laboratory 

studies (1). For instance, essential oils can contain phenolic and 

terpenoid compounds which have antimicrobial properties (2). 

The antimicrobial activity of thyme oil has been shown to cause 

hyphal collapse by membrane disruption (1). In Australia, very 

few studies have investigated the effects of antimicrobial volatile 

compounds in essential oils on survival of soilborne pathogens. 

Our work is therefore investigating the antimicrobial activity of 

compounds derived from a range of essential oils and other 

plant extracts against key soilborne pathogens isolated from 

vegetable crops. Preliminary results from in vitro experiments 

are reported here. 


A series of in vitro experiments were conducted to investigate 

the effects of plant extracts on mycelial growth of soilborne 

pathogen isolates. Treatments tested included the active 

constituents (eugenol, thymol, carvacrol and geraniol) of some 

essential oils as well as 14 essential oils (thyme, clove bud, 

peppermint, geranium, eucalyptus, tea tree, origanum, 

rosemary, orange sweet, cardamon, sweet fennel, pine, black 

pepper and basil). The pathogenic isolates tested included 

Pythium sulcatum, P. aphanidermatum, P. irregulare, Fusarium 

oxysporum and a Rhizoctonia sp. Solutions of the actives and the 

oils were added to sterile suitable selective media at 

concentrations of 500, 1000, and 2500 ppm. A 5 mm mycelial 

plug was then plated onto the amended media. Plates with 

Pythium were incubated at 20ºC and those with Fusarium and 

Rhizoctonia at room temperature. Mycelial growth, expressed as 

colony diameter, was measured until mycelium in unamended 

plates reached the edge of the plate. After this, plugs that did 

not grow were transferred to fresh unamended media to 

determine whether the treatments were fungistatic or 

fungicidal. Examples of results are given for some of the isolates 

tested to illustrate the suppressive and biocidal effects of some 

of the oil treatments tested. 

RESULTS 

All concentrations of the four plant actives significantly (p

Use of grid weather forecast data to predict rice blast development in Korea 

Wee Soo Kang 1 , Kyu Rang Kim 2 , and Eun Woo Park{ XE "Park, E.W." } 1 

1 Department of Agricultural Biotechnology, Seoul National University, Seoul 151‐921, Korea 

2 Applied Meteorological Research Lab., National Institute of Meteorological Research, Korea Meteorological Administration, Seoul 

156‐720, Korea 


Timely warnings on plant disease development are useful 

information for farmers to determine when to spray fungicides 

to control plant diseases. Real‐time weather data monitored by 

automated weather stations are often used to generate disease 

forecast information. However, when observed weather data are 

used, the time window for effective fungicide sprays after the 

disease warnings could be too short and farmers may fail to 

control the disease in time even though accurate disease 

forecast is available. In order to minimise the time limitations 

associated with real‐time disease forecasting, the weather 

forecast data need to be used for disease forecasting. At every 

3 hours, the Korea Meteorological Administration (KMA) 

releases 48‐hour weather forecasts at 3‐hour intervals on air 

temperature, relative humidity, and probability of precipitation 

and at 12‐hour intervals on precipitation based on the outputs 

from numerical weather prediction models. The spatial 

resolution of weather forecasts is 5 km. Using the grid weather 

forecasts, rice blast disease forecasting was conducted. The grid 

forecast data at 3 hour intervals are interpolated to produce 

hourly data. Hourly wetness period was estimated from a simple 

relative humidity model and a CART model using temperature, 

relative humidity, precipitation, and wind speed. Based on the 

hourly weather data, daily risk levels of rice blast infection were 

determined at the spatial resolution of 5 km in the map image. 

The results suggested that estimation of hourly leaf wetness 

needs to be improved to enhance the accuracy in forecasting 

infection periods. 


Session 8A—Future directions 

Investigating the impact of climate change on plant diseases 

J.E. Luck{ XE "Luck, J.E." } A , J.P. Aurambout B , S. Chakraborty C , K.J. Finlay A , W. Griffiths D , G.J. Hollaway D G. O’Leary D , A. Freeman D , K. 

Powell E , R. Norton F , D. Kriticos G and P. Trebicki D 

A 

Biosciences Research Division, Department of Primary Industries, Knoxfield, Private Bag 15, Ferntree Gully DC, 3156, Victoria 

B Future Farming Systems Research, Department of Primary Industries, Parkville, PO Box 4166, Parkville, 3030, Victoria 

C CSIRO Plant Industries, 306 Carmody Rd, St Lucia, 4067, Queensland 

D Biosciences Research Division, Department of Primary Industries, Horsham, Private Bag 260 Horsham, 3401, Victoria 

E Biosciences Research Division, Department of Primary Industries, Rutherglen, RMB 1145 Chiltern Valley Road, Rutherglen, 3685, Victoria 

F The University of Melbourne, Private Bag 260, Horsham, 3401, Victoria 

G CSIRO Entomology, Black Mountain, 2601 ACT 

INTRODUCTION 

Climate change is recognised as a major threat to agricultural 

systems and will likely alter the risks associated with the 

biosecurity and market access of its agricultural products (1). The 

potential effects on pest and disease threats to these changing 

systems are not well understood. Specifically, there is a critical 

lack of empirical data on how increasing atmospheric carbon 

dioxide (CO 2 ) will impact on pest and pathogen populations and 

crop production. Our approach to investigate the impact of 

climate change on disease threats is two‐fold. We developed 

models to analyse vector‐borne diseases of a number of 

endemic and exotic diseases and their hosts. Further, we have 

embarked upon a real time field study of the effects of elevated 

(e)CO 2 on pathogens of wheat, using the Free‐Air CO 2 

Enrichment (FACE). 

METHODS 

Modelling. We used a bioclimatic model (CLIMEX) to investigate 

the potential distribution of citrus canker (Xanthomonas citri pv 

citri). A second modelling approach (using STELLA) combined 

dynamic sub‐models of host‐plant physiology, vector population 

growth and climatic data to investigate the effect of climate 

change on the exotic Asiatic citrus psyllid (Diaphorina citri) which 

vectors the citrus disease huanglongbing (citrus greening). This 

approach was also used to develop an integrative model for the 

bird cherry‐oat aphid (Rhopalosiphum padi) under increasing 

temperatures which vectors Barley yellow dwarf virus in wheat. 

FACE. Three wheat pathogens were targeted to examine the 

influence of CO 2 on their biology and interaction with their host, 

Puccinia striiformis (wheat stripe rust), Fusarium 

pseudograminearum (crown rot) and Barley yellow dwarf virus 

(BYDV). Wheat stripe rust severity, latent period, fecundity and 

host resistance was assessed under ambient and 550ppm CO 2 . 

Crown rot severity on Tamaroi (very susceptible variety) and 2– 

49 (a partially resistant breeding line variety) were also assessed. 

The RPV strain of BYDV was isolated and maintained in oat and 

perennial ryegrass by serial aphid transfer using R.padi and 

transmitted to wheat growing under eCO 2 . DNA analysis of soil 

from ambient (aCO 2 ) and eCO 2 plots for soil‐borne pathogen 

detection was also completed. 

RESULTS 

Modelling. CLIMEX results revealed that the predicted citrus 

canker distribution would shift to southern coastal and inland 

regions under increasing temperatures, based on its current 

climatic range overseas. The STELLA model indicated earlier, 

shorter development times and a population shift southwards 

for the potentially invasive Asiatic citrus psyllid (Diaphorina citri), 

under increasing temperatures. However, an overall decrease in 

psyllid numbers is predicted due to reduce availability of new 

growth flushes on which the psyllid feeds and reproduces (2). 

FACE. There was no significant effect of eCO 2 on stripe rust 

progress, latent period, fecundity and disease resistance but a 

significant increase in the severity of crown rot symptoms and 

fungal biomass under eCO 2 . The methodology for analysing 

BYDV movement in wheat under eCO 2 has been established. In 

2007, visual scoring of BYDV symptom expression between eCO 2 

and aCO 2 treatments showed no significant difference. The 2008 

BYDV inoculation results are being analysed. 

DISCUSSION 

Modelling tools are available to predict geographic ranges of 

plants and their pests and pathogens but often do not take into 

consideration the specific biology of the organisms and hostpathogen/pest 

interactions. The value of this approach is 

confirmed by the Asiatic citrus psyllid model which would have 

only predicted shorter development times and an increase risk 

of potential distribution based on climatic data alone. Such 

improved models could be incorporated into plant disease 

management plans and contingency planning. The predictive 

power of the models will be increased with real‐time data 

generated by the FACE experiments. Limited chamber and field 

studies have shown an increase in aggressiveness of some fungal 

pathogens and enhanced host susceptibility (3,4) which was 

supported an increase severity of crown rot symptoms and 

fungal biomass under eCO 2 . For wheat stripe rust, cultivar 

resistance and seasonal rainfall have more significant effects on 

disease progress than increased atmospheric (550ppm) CO 2 . 

Further analysis is required to make an assessment of eCO 2 

effects on BYDV titre and movement in wheat and aphid 

vectoring capacity. 

REFERENCES 

1. Aurambout J‐P, Finlay KJ, Luck JE, Beattie, GAC (2009) A concept 

model to estimate the potential distribution of the Asiatic citrus 

psyllid (Diaphorina citri Kuwayama) in Australia under climate 

change—a means for assessing biosecurity risk. Ecological 

Modelling. In press. 

2. Aurambout J‐P, Constable F, Finlay KJ, Luck JE Sposito V (2006) The 

impacts of climate change on plant biosecurity. Primary Industries 

Research Victoria, Melbourne, 42pp. 

3. Chakraborty S, Datta S (2003) How will plant pathogens adapt to 

host plant resistance at elevated CO 2 under a changing climate? 

New Phytologist 159, 733–742. 

4. Karnosky DF, Percy KE, Xiang B, Callan B, Noormets A, Mankovska 

B, Hopkin A, Sober J, Jones W, Dickson RE, Isebrands JG (2002) 

Interacting elevated CO 2 and tropospheric O 3 predisposes aspen 

(Populus tremuloides Michx.) to infection by rust (Melampsora 

medusae f. sp. tremuloidae). Global Change Biology 8, 329–338 


Impact of climate change in relation to blackleg on oilseed rape and blackspot on field 

pea in Western Australia 

M.U. Salam{ XE "Salam, M.U." } A , W.J. MacLeod A , M.J. Barbetti A,B , R. Khangura A , J. Galloway A , M. Amjad A , M. Seymour A , K.P. Salam A , T. 

Maling A , I. Foster A , D. Bowran A 

A Department of Agriculture and Food, Western Australia, Locked bag 4, Bentley Delivery Centre, WA 6983, Australia 

B School of Plant Biology, The University of Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia 

INTRODUCTION 

Worldwide, including Western Australia (WA), blackleg and 

blackspot are the most important diseases affecting production 

of oilseed rape (or canola) and field pea, respectively. 

Synchronisation of ascospore release with the seedling stage 

often results in particularly severe canker formation and 

correspondingly major yield losses for oilseed rape. Therefore, 

delay in onset of release of ascospores until the susceptible 

seedling stage has passed could be beneficial to oilseed rape. In 

contrast, field pea crops are susceptible to blackspot throughout 

all growth stages, therefore, it is recommended that growers 

delay crop establishment to avoid the peak of release of 

ascospores. In order to estimate the impacts of climate change 

on the severity of these diseases, it is important to identify the 

potential shifts in the pattern(s) of ascospore release for these 

diseases under the anticipated future climate conditions. 

slightly favour canker formation in oilseed rape (data not 

shown), with the potential for ideal conditions for canker 

formation becoming more frequent. 

On the contrary, the peak of the release of blackspot ascospores 

is predicted to be about four weeks earlier than under current 

climatic conditions; relative to break of the season, the release 

of blackspot ascospores will take place in about five weeks 

earlier (Fig. 1). That scenario would be highly beneficial to field 

pea growers, allowing earlier sowing dates to reap the greater 

agronomic yield potentials while being exposed to relatively low 

blackspot disease pressure. 


METHODS 

The ‘Blackleg Sporacle’ model was used to determine the timing 

of onset of release of blackleg ascospores and the ‘Blackspot 

Manager’ model was used to estimate the peak of release of 

blackspot ascospores in eight locations across the grain‐belt of 

WA, viz., Badgingarra, Corrigin, Dalwallinu, Esperance, Lake 

Grace, Merredin, Wagin, and Wandering. The models were run 

with statistically downscaled CSIRO Mk3 GCM simulation 

weather data based on the IPCC SRES A2 emission scenario 

(2036–2060) (1). This future scenario was compared with 

recorded climate data for the period of 1976–2004 inclusive. 

Table 1. Predicted timing of onset of blackleg ascospore release under 

current and future climates. DOY denotes day of the year (as of Julian 

day, 1 being 1 January and 366 being 31 December). 

Location 

Onset of ascospore release 

Current 

(DOY) 

Future 

(DOY) 

Badgingarra 170 181 11 

Corrigin 168 179 11 

Dalwallinu 183 196 13 

Esperance 104 116 12 

Lake Grace 163 177 14 

Merredin 177 191 14 

Wagin 150 168 18 

Wandering 149 164 15 

Average 158 172 13 

RESULTS AND CONCLUSIONS 

Difference 

(day) 

Model runs with these climate scenarios show that, on average, 

the onset of release of blackleg ascospores is likely to be delayed 

by about two weeks (Table 1). Whereas, the opening seasonal 

rains (also known as ‘break of the season’) were delayed by 

about one week (data not shown). Hence, the onset of blackleg 

ascospores, relative to the break of the season, will occur only 

one week later than currently. Therefore, the risk of 

synchronisation of major blackleg ascospore showers with 

seedling establishment appears to be similar under future 

climates. The predicted future increase in temperature may 

Figure 1. Predicted temporal pattern of blackspot ascospore release 

under current and future climate Esperance and Dalwallinu regions of 

Western Australia. 


We thank the Australian Grains Research and Development 

Corporation (GRDC) and the Department of Agriculture and Food 

Western Australia for supporting this research. 

REFERENCES 

1. Gordon, H.B., Rotstayn, L.D., McGregor, J.L., Dix, M.R., Kowalczyk, 

E.A., O’Farrell, S.P., Waterman, L.J., Hirst, A.C., Wilson, S.G., Collier, 

M.A., Watterson, I.G. & Elliott, T.I., (2002) The CSIRO Mk3 Climate 

System Model. Technical Paper No. 60. CSIRO Atmospheric 

Research: Aspendale, Victoria, Australia 130 pp. 



Approaches to training in plant pathology capacity building projects in developing 

countries 

L.W. Burgess{ XE "Burgess, L.W." } A , J.L. Walsh B , H.T. Phan C and E.C.Y. Liew D 

A University of Sydney, A05 McMillan Building, Sydney, 2006, NSW 

B Plant Protection Centre, PO Box 811, Vientiane, Lao PDR 

C National Institute of Medicinal Materials, 3B Quang Trung, Hanoi, Vietnam 

D Botanic Gardens Trust, Mrs Macquaries Road, Sydney, 2000, NSW 

Plant diseases continue to be an impediment to the socioeconomic 

progress of developing countries. The ability of plant 

pathologists in these countries to accurately diagnose and 

provide advice on integrated disease management is often 

limited by an overall low level of training and lack of diagnostic 

specialists in country. Laboratory facilities are frequently 

inadequate and ongoing access to consumable laboratory 

materials and maintenance of equipment is difficult due to 

limited financial resources. 

Australia is an active donor to agricultural capacity building 

projects in many developing countries through government 

agencies and other funding bodies. Because capacity building 

projects focus on sustainable development through skills 

transfer, training of counterparts in developing countries is an 

inherent component of any capacity building project. Here we 

outline what we consider to be the three most important 

elements of training where many capacity building projects can 

fail: ‘English in Context’ training, suitability of Australian 

postgraduate courses and extended periods of in‐country 

training. Our recommendations are based on our experience 

working on plant pathology capacity building projects in 

Vietnam, Indonesia, Laos, China and Tunisia over the past 15 

years. 

‘English in Context’ training. Language can be a barrier to 

effective training for counterparts from non‐English speaking 

countries. A level of sufficiency in technical English used in plant 

pathology is required in order for counterparts to communicate 

with Australian mentors and interpret for international visitors, 

access internet resources and seek information from literature 

and disease compendia. ‘English in Context’ refers to the use of 

English as a second language in the workplace. We recommend 

that all capacity building projects in non‐English speaking 

countries include an intensive ‘English in Context’ training 

component at the outset with ongoing training provided through 

the life of the project. This approach has been used to great 

effect in Vietnam (1). 

In‐country training. For a more complete understanding of plant 

diseases, it is important for counterparts to follow the full 

diagnostic process from field surveys, through isolation and 

identification of a pathogen, followed by pathogenicity testing to 

complete Koch’s postulates. This requires the availability of the 

facilitator or mentor to be in‐country for extended periods of 

time. Although this is often difficult, it can be more cost effective 

than holding short workshops in Australia and can potentially 

reach more counterparts. The presence of a mentor or facilitator 

in country allows real‐life examples currently affecting farmers 

to be used in training programs. It also forces an 

acknowledgement of local diseases, agronomic practices and 

laboratory conditions by the facilitator. We also recommend a 

focus on interactive teaching, encouraging student participation. 

This approach facilitates ‘learning by doing’. 

The Australian Youth Ambassador for Development (AYAD) 

program is an ideal program for placing skilled young Australians 

in developing countries for up to 12 months. We encourage 

project leaders to consider including an AYAD in their project 

plan and for plant pathology graduates to seek such 

assignments. 


We gratefully acknowledge funding from the Australian Centre 

for International Agricultural Research and the ATSE Crawford 

Fund as well as the contribution of our many colleagues with 

whom we have collaborated over the last 15 years, both in 

Australia and in developing countries. 

REFERENCES 

1. Burgess, LW, Burgess, JS (2009) Capacity building in plant 

pathology: Soil‐borne diseases in Vietnam, 1993–2009. Australasian 

Plant Pathology: In press. 

Suitability of Australian postgraduate courses. Many 

counterparts aim to obtain scholarships to undertake 

postgraduate training in Australia in association with capacity 

building projects. Modern Australian plant pathology courses are 

becoming increasingly focused on molecular biology, with a 

decline in classical diagnostic training. However, in developing 

countries the greatest need is for field and laboratory training in 

basic plant pathology skills. Providing students from developing 

countries with advanced training in molecular techniques is 

illogical and ill conceived. Identification of a pathogen to species 

level or below is often not necessary for effective integrated 

disease management practices to be implemented. Supervisors 

need to consider the suitability of coursework undertaken by 

students more carefully as well as their ability to continue 

mentoring the student on their return. 


Increasing global regulations on fumigants stimulates new era for plant protection 

and biosecurity 

INTRODUCTION 

I. Porter{ XE "Porter, I." } A , S. Mattner A , J. Edwards A and P. Fraser B 

A Department of Primary Industries, Knoxfield Centre, PMB 15, Ferntree Gully Delivery Centre, 3156, Vic 

B CSIRO Marine and Atmospheric Research, Aspendale, 3195,Vic 

Restrictions on fumigant chemicals due to environmental 

concerns (eg. Montreal Protocol) and tropospheric pollution (eg. 

new volatile organic compound regulations) has caused a surge 

in new strategies to control soilborne pathogens, but are 

sustainable practices being adopted? Since the early 1990’s 

when methyl bromide (MB) was shown to be responsible for 

ozone layer degradation, a massive global research effort has 

been undertaken to find alternative disinfestation strategies. It 

was anticipated that growers would readily adopt practices which 

conserved biodiversity and the principles of biological equilibrium. In 

reality this has not happened because pathologists have not yet 

developed a sufficient understanding of the relationships between 

soil biology and plant yield or the mechanisms of disease 

suppression in the absence of synthetic chemicals. 

After MB phase out, many sectors still use other fumigant 

chemicals (Fig 1), as other technologies have not always 

provided the same advantages afforded by soil fumigation, (i.e. a 

high level of pest and disease control with low risk, and good 

quality and high yielding crops). However, a bigger set of factors 

is now influencing crop production and crop protection; climate 

change, user and bystander safety, increasing prices of water, oil 

and inorganic fertilisers and concern over soil health is finally 

being recognised. This is causing a shift in grower approaches to 

soilborne disease control in crop protection. 

% Response relative to MBr-Pic (67:33) 

120 

100 

80 

60 

40 

20 

92.3893 

95.78335 0 

TC35MNa 

PicFosDev 

MB67 

MI60 

TC35EC 

Strawberry Estimates with LSIs by Chemical Applied 

(Treatments with greater than five observations) 

MB50 

TC35 

PicEC 

TC35ECMNa 

PicECMNaFos 

Pic 

PicMNa 

8 6 123 18 51 24 63 28 21 9 62 13 13 13 10 14 30 2 3 17 77 87 

MB30 

Figure 1. The efficacy relative to MB/Pic (67:33) of a large number of 

crop protection practices on yield of strawberry plants in a metaanalysis 

of over 100 international studies (1). Elipse ‐ MB/Pic standard 

Also, whilst new strategies are being developed for sustainable 

control of soilborne pathogens very little attention is being given 

to products or strategies which eradicate soilborne pathogens 

and protect industries from incursions from exotic pathogens. In 

fact, there is a poor knowledge on the ability of any strategies to 

effectively eradicate soilborne microorganisms. Techniques, such 

as solarisation and steaming whilst effective on a limited scale 

are not totally effective in the field, biofumigants decrease risk 

but do not eradicate propagules and chemical fumigants do not 

guarantee total eradication. Development of soilless systems 

which exclude soilborne pathogens are a key future practice to 

eliminate disease, and use of grafting and resistant varieties can 

reduce effects of disease (Table 1). 

PicECMNa 

SolFert 

Treatment Group and Number of Trials 

MNaSol 

Daz 

BioFum 

Compost 

Sol 

MNa 

NoTr 

Table 1. Some of the future technologies that will be relied upon to 

replace control of soilborne plant pathogens by chemical fumigants C: ‐ 

commodity treatments 

Present Disinfestants 

Telone C35 EC 

Chloropicrin EC 

Methyl iodide 

Dimethyl disulphide 

Solarisation 

Streaming 

C:Sulphuryl fluoride 

IPM Strategies to replace disinfestants 

Grafting and plant resistance 

Biorationals (AG3, Voom) 

Biofumigants 

Endophytes? 

Biocontrols? 

Strategic pesticides and herbicides 

Soilless systems: Substrates and hydroponics 

C: phosphine/CO 2 MB Recapture and recycling 

IMPACT OF FUMIGANT USE FOR BIOSECURITY 

Fumigation of imported and exported commodities is a key 

activity for quarantine and preshipment especially to satisfy 

phytosanitary requirements of the importing country. MB is the 

key fumigant used for QPS and is presently exempt from phase 

out under the rules of the Montreal Protocol, although the 

European Community has decided to phase out all uses by 

March 2010. Although MB is predominantly used to eradicate 

insect pests from commodities, it may not have any significant 

control of fungal pathogens, however this is not clearly 

understood. A key alternative for QPS commodity treatments, 

sulphuryl fluoride, also has concerns for use as it has a very high 

global warming potential (GWP ~ 4000). Therefore the key to 

successful QPS treatments for Australia would be to maintain a 

systems approach which only allows imports from regions where 

the diseases (eg. Phytophthora ramorum, Guava rust, etc.) are 

not known to occur. 

The Australian and international scientific community require 

answers to some key questions to minimise the impact of 

changes to availability of fumigants. For instance, in the future, 

will we have strategies to eradicate soilborne pathogens in the 

event of an incursion? Is it worth the investment to try to 

eradicate a soilborne organism? Why is MB being retained for 

use in nursery industries worldwide where high health is 

paramount, when its fungicidal properties may be insufficient? 

Has Australia identified the major exotic soilborne (and airborne) 

pathogen risks? Is Australia really prepared to cope with an 

outbreak of a serious exotic soilborne pathogen? 

This paper will further discuss some of the future challenges 

facing industries when considering adoption of new 

bioprotection, biosecurity or crop management practices. 

REFERENCES 

1. Porter IJ, Trinder L, Partington D (2006) Validating the performance 

of alternatives to methyl bromide for preplant fumigation. Report 

of the TEAP, May 2006, United Nations Environment Program, 

Nairobi, 91 pp. 

(http://www.unep.org/ozone/teap/Reports/index.asp) 




A world of possibilities: the importance of international linkages 

The issues facing our societies and professions are global in 

nature. Plant pathology as a discipline is no different since plant 

pathogens know no geographic or political boundaries. Through 

the efforts of individual scientists, global networks were 

established for scientific disciplines and this has been occurring 

through the ages. Many of our professional societies even when 

national based have international members indicating the 

importance of international networks. The American 

Phytopathological Society began their efforts in international 

programs in the 1940s and refined their goals in 1983 and again 

in 2005. However these efforts did not result in international 

linkages that bring together scientific societies. For there to be 

linkages across societies there must be assurance of each society 

being successful and that ventures undertaken across societies 

must complement each other’s strengths and fill in potential 

weaknesses. Linkages must seek common goals and interests. 

Possible items that could generate linkages across our societies 

will be explored. In order to move forward in the 21st century, it 

is time to embrace networks of alliances to advance the 

knowledgebase and this requires international linkages. 

Barbara J. Christ{ XE "Christ, B." } 

The Pennsylvania State University, University Park, PA USA 


Poster abstracts 


Posters 

List of posters 

Poster 

no. Theme Title Page 

1 Disease and epidemiology Identification and characterisation of phytoplasma pathogen associated with alfalfa diseases in Al 

Hasa, Saudi Arabia 

Khalid Alhudaib and Y. Arocha 

2 Disease and epidemiology A Phytophthora sp. is the cause of jackfruit decline in the philippines 

L.M. Borines, R. Danieland D. Guest 

3 Disease and epidemiology The effects of calcium chloride and calcium carbonate on germination and growth of Colletotrichum 

acutatum and Penicillium expansum 

K.S.H. Boyd‐Wilson and M. Walter 

4 Disease and epidemiology A sensitive PCR test for detecting the potato cyst nematode (Globodera rostochiensis) in large volume 

soil samples 

S.J. Collins, X.H. Zhang, G.I. Dwyer, J.M. Marshall and V.A.Vanstone 

5 Disease and epidemiology Management strategies to economically control blackspot and maximise yield in new improved field 

pea cultivars 

J.A. Davidson, L. McMurray and M. Lines 

6 Disease and epidemiology Bacterial canker of tomato: Australian diversity of Clavibacter michiganensis subsp michiganensis 

L.M. Forsyth, T. Crowe, A. Deutscher and L. Tesoriero 

7 Disease and epidemiology A new report on Pseudomonas syringae pv. mori causal agent of bacterial blight of mulberries in 

Australia 

H. Golzar and P. Mather 

8 Disease and epidemiology Efficacy of pre‐seeding fungicides for control of barley loose smut 

K.W. Jayasena, G. Thomas, W. J. MacLeod, K. Tanaka and R. Loughman 

9 Disease and epidemiology Specific genetic fingerprinting of Pseudomonas syringae pv. syringae strains from stone fruits in Iran 

with REP sequence and PCR 

S. Ketabchi 

10 Disease and epidemiology Can additional isolates of the Noogoora burr rust fungus be sourced to enhance biocontrol in 

northern Australia? 

L. Morin, M. Piper, R. Segura and D. Gomez 

11 Disease and epidemiology Boneseed rust: a highly promising candidate for biological control 

L. Morin and A.R. Wood 

12 Disease and epidemiology Helicotylenchus nematode contributing to turf decline in Australia 

L. Nambiar, J M. Nobbsand M. Quader 

13 Disease and epidemiology Biological control of Uncinula necator by mycophagous mites 

N. Panjehkeh, S. Ramroodi andA.R. Arjmandinezhad 

14 Disease and epidemiology In vitro screening of potential antagonists of Xanthomonas translucens infecting pistachio 

A. Salowi, D. Giblot Ducray and E.S. Scott 

15 Disease and epidemiology Characterisation of the causal agent of pistachio dieback as a new pathovar of Xanthomonas 

translucens, x. Translucens pv. pistaciae pv. nov. 

D. Giblot Ducray, A. Marefat, N.M. Parkinson, J.P. Bowman, K. Ophel‐Keller, E.S. Scott 

16 Disease and epidemiology Investigation of the effect of three essential oils, alone and in combination, on the in vitro growth of 

Botrytis cinerea 

S.M. Stewart‐Wade 

17 Disease and epidemiology Survival of the pistachio dieback bacterium in buried wood 

T.A. Vu Thanh, D. Giblot‐Ducray, M.R. Sosnowski and E.S. Scott 

18 Disease and epidemiology Discovery of a Ceratocystis sp. associated with wilt disease of two native leguminous tree hosts in 

Oman and Pakistan 

A.O. Al Adawi, I. Barnes, A.A. Al Jahwari, M.L. Deadman, B.D. Wingfield and M.J. Wingfield 

19 Disease and epidemiology In vitro study on the effect of NanoSilver (Nanosid) on Sclerotinia sclerotiorum fungi the causal agent 

of rapeseed white stem rot 

A. Zaman Mirabadi, K. Rahnama, R. Mehdi Alamdarlou and A. Esmaailifar 

20 Disease and epidemiology Study on the effect of number of spraying with fungicides on rapeseed sclerotinia stem rot control 

R. Mehdi Alamdarlou, A. Zaman Mirabadi, A. Esmaailifar and K. Foroozan 

21 Disease management First report of Leveillula taurica on Ficus carica (matrix nova) 

Javad Abkhoo and Alireza Arjmandi Nezhad 

22 Disease management Pulse virus surveys from Victoria and South Australa in 2007 

M. Aftab, A. Freeman and J. Davidson 

23 Disease management Mango sudden death syndrome assessment in various mango growing districts of Punjab, Pakistan 

F.S. Fateh, M.R. Kazmi, C.N. Akem, A. Iqbal and G. Bhar 

134 

137 

138 

141 

143 

149 

156 

165 

168 

183 

182 

184 

193 

199 

202 

210 

218 

220 

224 

225 

128 

131 

133 


Poster 


24 Disease management Integrated management of mango diseases using inoculum reduction strategies with fungicide spray 

treatments 

C.N. Akem, G. MacManus, P. Boccalatte, K. Stockdale, D. Lakhesar and R. Holmes 

25 Disease management Effect of avocado crop load on postharvest anthracnose and stem end rot, and cations and phenolic 

acid levels in peel 

E.K. Dann,L.M. Coates, J.R. Dean, L.A. Smith, A.W. Cooke and K.G. Pegg 

26 Disease management In vitro fungicide sensitivity of Botryosphaeriaceae species associated with ‘bot canker’ of grapevine 

R. Huang, W.M. Pitt, C.C. Steel and S. Savocchia 

27 Disease management The value of combined use of genetic resistance and fungicide application for management of stripe 

rust 

K.W. Jayasena, G. Thomas, R. Loughman, K. Tanaka and W. J. MacLeod 

28 Disease management Molecular identification of Pythium isolates of ginger from Fiji and Australia 

M.F. Lomavatu, J. Conroy and E. Aitken 

29 Disease management Development of techniques to measure SAR induction in broccoli for clubroot disease resistance 

D. Lovelock, A. Agarwal, E.C. Donald, I.J. Porter, R. Faggian and D.M. Cahill 

30 Disease management Incorporating host‐plant resistance to Fusarium crown rot into bread wheat 

D.J. Herde and C.D. Malligan 

31 Disease management Management and distribution of huanglongbing in Pakistan 

Shahid Nadeem Chohan, Obaid Aftab, Raheel Qamar, Shazia Mannan, Muhammad Ibrahim, Iftikhar 

Ahmed, M. Kausar Nawaz Shah, Paul Holford, G. Andrew C. Beattie 

32 Disease management Investigating the potential of in‐field starch accumulation tests for targeted citrus pathogen 

surveillance in Australia 

A.K. Miles, N. Donovan, P. Holford, R. Davis, K. Grice, M. Smith and A. Drenth 

33 Disease management Aerial photography—a tool to monitor Mallee onion stunt 

S.J. Pederick, J.W. Heap, T.J. Wicks, S. Anstis and G.E. Walker 

34 Disease management Diatrypaceae species associated with grapevines and other hosts in New South Wales 

W.M. Pitt, R. Huang, C.C. Steel and S. Savocchia 

35 Disease management First report of a eucalypt yellowing disease in Syria and its similarity to Mundulla yellows 

D. Hanold, B. Kawas and J.W. Randles 

36 Disease management New host records for ‘Candidatus Phytoplasma aurantifolia’ in Australia 

J.D. Ray 

37 Disease management A comparative study of methods for screening chickpea and wheat for resistance to root‐lesion 

nematode Pratylenchus thornei 

R.A. Reen, J.P. Thompson 

38 Disease management Interactions between Leptosphaeria maculans and fungi associated with canola stubble 

B. Naseri, J.A. Davidson and E.S. Scott 

39 Disease management Seed‐borne concerns with wheat streak mosaic virus in 2008 

S. Simpfendorfer and D. Nehl 

40 Disease management A single plant test for resistance to two species of root‐lesion nematodes and yellow spot in wheat 

J.P. Thompson, T.G. Clewett, J.G. Sheedy, S.H. Jones and P.M. Williamson 

41 Disease management Sources of resistance to root‐lesion nematode (Pratylenchus thornei) in wheat from West Asia and 

North Africa 

J.P. Thompson, T.G. Clewett and M.M. O’Reilly 

42 Disease management A single plant test for resistance in wheat to crown rot and root‐lesion nematode (Pratylenchus 

thornei) 

J.P. Thompson and R.B. McNamara 

43 Disease management Effect of irrigation method on disease development in a carrot seed crop 

R.S. Trivedi, J.M. Townshend, M.V. Jaspers, H.J. Ridgway, and J.G. Hampton 

44 Disease management First report of rapeseed blackleg caused by pathogenicity group T (PGT) of Leptosphaeria maculans in 

Mazandaran province of Iran 

A. Zaman Mirabadi, K. Rahnama, R.M. Alamdalou and A. Esmaailifar 

45 Host‐parasite interactions Fungal endophytes of the Boab species Adansonia gregorri and other native tree species 

M.L. Sakalidis, G.E.StJ. Hardy and T.I. Burgess 

46 Host‐parasite interactions Two new books: Diseases of Fruit Crops in Australia and Diseases of Vegetable Crops in Australia 

Tony Cooke, Denis Persley and Susan House, Cherie Gambley 

47 Host‐parasite interactions Through chain assessment and integrated management of brown rot risks in stonefruit 

R. Holmes, O. Villalta, S. Kreidl, M. Hossain and C. Gouk 

48 Host‐parasite interactions Effects of temperature on mixed bunch rot infections of grapes 

L.A. Greer, S. Savocchia, S. Samuelian and C.C. Steel 

132 

145 

163 

167 

172 

173 

175 

176 

180 

189 

192 

194 

195 

196 

203 

205 

212 

214 

211 

216 

223 

139 

151 

157 

158 

Posters 


Posters 

Poster 


49 Host‐parasite interactions Development of nationally endorsed diagnostic protocols for plant pests 

B.H. Hall, J. Moran, J. Plazinski, M. Whattam, S. Perry, V. Herrera, P. Gray, D. Hailstones, M. Glen, J. La 

Salle 

50 Host‐parasite interactions The impact and diversity of Mycosphaerella leaf disease isolated from Eucalyptus globulus in western 

australia 

S.L. Jackson, A. Maxwell, S.L. Collins, M.C. Calver, G.E.StJ. Hardy and B. Dell 

51 Host‐parasite interactions Impact of Phytophthora cinnamomi on native vegetation in South Australia 

S.F. McKay, K.H. Kueh, A.J. Able, R.M.A. Velzeboer, J.M. Facelli and E.S. Scott 

52 Host‐parasite interactions Reducing the carbon footprint in Riverland vineyards: assessing the efficacy and efficiency of control 

for powdery mildew by evaluating growers’ spray diaries 

P.A. Magarey, R.W. Emmett, T.S. Smythe, M.M. Moyer, J.R. Dixon, A.J. Pietsch and P.M. Burne 

53 Host‐parasite interactions The inhibitory effect of sumac stem extract on some fungal plant pathogens 

N. Panjehkeh, M. Abdolmaleki, M. Salari, S. Bahraminejad 

54 Host‐parasite interactions Evaluation of commercial cultivars for control of white blister rust in Brassica rapa and Brassica 

oleracea vegetables 

J.E. Petkowski, F. Thomson, E.J.Minchinton and C. Akem 

55 Host‐parasite interactions Fertilisation with N, P and K above critical values required for adequate plant growth influences plant 

establishment of cotton varieties in fusarium infested soil 

L.J. Smith and J.K. Lehane 

56 Host‐parasite interactions Eradication of Elsinoe ampelina by burning infected grapevine material 

M.R. Sosnowski, R.W. Emmett, T.A. Vu Thanh, T.J. Wicks and E.S. Scott 

57 Pathogens and diagnostics New records of Erysiphaceae (Ascomycota: Erysiphales) for Iran mycoflora 


58 Pathogens and diagnostics Survey of propinquity among Erysiphe, Leveillula, Phyllactinia, Podosphaera, Sphaerothca, Uncinula 

and Uncinuliella based on analysis of morphological characters 


59 Pathogens and diagnostics Efficient transformation of Colletotrichum capsici, the causal agent of chilli pepper anthracnose by 

Agrobacterium 

A.S.M. Auyong, R. Ford and P.W.J. Taylor 

60 Pathogens and diagnostics Infection process of endophytic Colletotrichum gloeosporioides on cacao leaves 

C. Blomley, E.C.Y Liew and D.I. Guest 

61 Pathogens and diagnostics An emerging nematode pest on bananas? 

J.A. Cobon, and T. Pattison 

62 Pathogens and diagnostics Phellinus noxius: brown root rot is increasing in importance in the Australian avocado industry 

E.K. Dann, L.A. Smith, M.L. Grose, G.S. Pegg and K.G. Pegg 

63 Pathogens and diagnostics Dispersal potential of Gibberella zeae ascospores 

P.A.B. Davies, L.W. Burgess, R. Trethowan, R. Tokachichu, D. Guest 

64 Pathogens and diagnostics Hosts of citrus scab, brown spot and black spot in coastal NSW 

N.J. Donovan, P. Barkley and S. Hardy 

65 Pathogens and diagnostics Nitrogen form affects Spongospora subterranea infection of potato roots 

Richard E. Falloon, Denis Curtin, Ros A. Lister, Ruth C. Butler, Catherine L. Scott and Nigel S. Crump 

66 Pathogens and diagnostics Relationships between Spongospora subterranea DNA in field soil and powdery scab in harvested 

potatoes 

Farhat A. Shah, Richard E. Falloon, Ros A. Lister, Ruth C. Butler, Alan McKay, Kathy Ophel‐Keller and 

Ikram Khan 

67 Pathogens and diagnostics Detection of Mycosphaerella fijiensis in the skin of ‘Cavendish’ banana 

R.A. Fullerton and S.G. Casonato 

68 Pathogens and diagnostics Rapid and robust identification of fungi associated with Acacia mangium root disease using DNA 

analyses 

M. Glen, V. Yuskianti, A. Francis, L. Agustini, A. Widyatmoko, A. Rimbawanto and C.L. Mohammed 

69 Pathogens and diagnostics Survey of the needle fungi associated with Spring Needle Cast in Pinus radiata 

I. Prihatini, M. Glen, A.H. Smith, T.J. Wardlaw and C.L. Mohammed 

70 Pathogens and diagnostics Disease‐management strategies for the rural sector that help deliver sustainable wood production 

from exotic plantations 

C. Beadle, A. Rimbawanto, A. Francis, M. Glen, D. Page, C.L. Mohammed 

71 Pathogens and diagnostics Infection and host responses in interactions between melon and Colletotrichum lagenarium 

Yonghong Ge and David Guest 

72 Pathogens and diagnostics Genetic diversity of Iranian Fusarium oxysporum f. sp. ciceris by RAPD molecular markers 

Sara Haghighi, Saeed Rezaee, Bahar Morid, Shahab Hajmansoor 

73 Pathogens and diagnostics The cause of the barley leaf rust in Western Australia is a typical Puccinia hordei 

Y. Anikster, K.W. Jayasena, T. Eilamand J. Manisterski 

160 

164 

170 

174 

188 

191 

207 

208 

129 

130 

135 

136 

140 

142 

144 

146 

147 

148 

150 

154 

155 

153 

152 

159 

166 


Poster 


74 Pathogens and diagnostics Genetic diversity and population structure of Australian and South African Pyrenophora teres isolates 

A. Lehmensiek, R. Prins, G. Platz, W. Kriel, G.F. Potgieter and M.W. Sutherland 

75 Pathogens and diagnostics The Fusarium oxysporum f. sp cubense tropical race 4 vectoring ability of the banana weevil borer 

(Cosmopolites sordidus) 

R.A. Meldrum, A.M. Daly and L.T.T. Tran‐Nguyen 

76 Pathogens and diagnostics Genetic diversity of Pseudocercospora macadamiae populations by PCR‐RFLP 

A.K. Miles, O.A. Akinsanmi, E.A. Aitken and A. Drenth 

77 Pathogens and diagnostics Priming for resistance against pathogens: cellular responses of Arabidopsis to UV‐C radiation 

S.J.L. Mintoff, P.T. Kay and D.M. Cahill 

78 Pathogens and diagnostics The effect of phosphonate on the accumulation of camalexin following challenge of Arabidopsis by 


Zoe‐Joy Newby, Rosalie Daniel and David Guest 

79 Pathogens and diagnostics Characterisation of Phytophthora capsici isolates from black pepper in Vietnam 

N.V. Truong, L.W. Burgess and E.C.Y. Liew 

80 Pathogens and diagnostics Characterisation of Phytophthora capsici Isolates from chilli in Vietnam 

N.V. Truong, L.W. Burgess and E.C.Y. Liew 

81 Pathogens and diagnostics Survey of viruses infecting sweet potato crops in New Zealand 

Z.C. Perez‐Egusquiza, L.I. Ward, J.D. Fletcher and G.R.G. Clover 

82 Pathogens and diagnostics Multi‐locus sequence typing of isolates of Pseudomonas syringae pv. actinidiae, a biosecurity risk 

pathogen 

J. Rees‐George, I.P.S. Pushparajah and K.R. Everett 

83 Pathogens and diagnostics Uniform distribution of powdery mildew conidia using an improved spore settling tower 

Z. Sapak, V. Galea, D. Joyce and E. Minchinton 

84 Pathogens and diagnostics The effect of high nutrient loads on disease severity due to Phytophthora cinnamomi in urban 

bushland 

Kelly Scarlett, Zoe‐Joy Newby, David Guest and Rosalie Daniel 

85 Pathogens and diagnostics Non‐host resistance and pathogen virulence: an important role of toxic and infection‐inducing 

compound(s) from spore germination fluid of Botrytis cinerea 

N.N. Khanam, K. Toyoda, H. Yoshioka, Y. Narusaka and T. Shiraishi 

86 Pathogens and diagnostics First report of tomato yellow leaf curl virus in pepper (Capsicum annum) fields in Iran 

M. Shirazi, J. Mozafari, F. Rakhshandehrooand M. Shams‐Bakhsh 

87 Pathogens and diagnostics Effect of white rust infection, bion and phosphonate on glucosinolates in brassica crops 

Astha Singh, Les Copeland and David Guest 

88 Pathogens and diagnostics Recent plant virus incursions into Australia 

J.E. Thomas, V. Steele, A.D.W. Geering, D.M. Persley, C.F. Gambley, and B.H. Hall 

89 Pathogens and diagnostics Sugarcane downy mildew: development of molecular diagnostics 

N. Thompson and B.J. Croft 

90 Pathogens and diagnostics Role of nematodes and zoosporic fungi in poor growth of winter cereals in the northern grain region 

J.P. Thompson, T.G. Clewett J.G. Sheedyand K.J. Owen 

91 Pathogens and diagnostics Pathogenicity of Radopholus similis on ginger in Fiji 

U. Turaganivalu, G.R. Stirling, S. Reddy and M. K. Smith 

92 Pathogens and diagnostics The effect of dryland salinity on the diversity of arbuscular mycorrhizal fungi 

B.A. Wilson, G.J. Ash and J.D.I. Harper 

93 Pathogens and diagnostics Evaluation of plant extracts for control of sclerotinia pathogens of vegetable crops 

D. Wite, O. Villaltaand I.J. Porter 

94 Pathogens and diagnostics First report of Macrophominia phaseolina on rapeseed stem in some provinces of Iran 

A. Zaman Mirabadi, A. Esmaailifar, A. Alian and R. M. Alamdalou 

95 Pathogens and diagnostics DNA barcoding to support biosecurity decisions 

K. Pan, G.F. Bills, M.K. Romberg, W.H. Ho, and B.J.R. Alexander 

96 Pathogens and diagnostics Subcommittee on Plant Health Diagnostic Standards 

M.A. Williams, B.H. Hall, J. Plazinski, P. Gray, J. Moran, P. Stephens, S. Perry 

97 Pathogens and diagnostics What is laboratory accreditation and what will it mean for me and my laboratory? 

M.A. Williams, P. Gray, N. Kelly, J. Cunnington, P. Stephens, R. Makin and S. Peterson, B.H. Hall 

98 The biology and management of chestnut rot in south‐eastern Australia 

L. Shuttleworth, D. Guest, E. Liew 

171 

178 

179 

181 

185 

186 

187 

190 

197 

200 

201 

169 

204 

206 

209 

215 

213 

217 

219 

221 

222 

198 

161 

162 

227 

Posters 


Posters 

21 First report of Leveillula taurica on Ficus carica (matrix nova) 

Javad Abkhoo{ XE "Abkhoo, J." } A and Alireza Arjmandi Nezhad B 

A,B Department of Plant Protection Research, Agriculture and Natural Resoureces Research Center of Sistan, Iran‐Zabol 

INTRODUCTION 

Leveillula taurica Lev. Belong to Erysiphaceae (Erysiphales, 

Ascomycota) that causing powdery mildew on over from 50 

plant families(1). 


During the summer 2007, typical symptoms of powdery mildew 

were observed in several fig fields assessed in Kereman Province, 

Iran. Samples were stained with Lactofushin(3) and 

morphological characteristics of fungus investigated by Olympus 

microscope (Modle: BH2) and drawn by drawing tube connected 

on microscope. 


Morphological characters of this fungus on ficus carica is as 

follow: 

Diseased leaves displayed typical powdery mildew signs 

consisting of whitish masses of conidia and conidiophores. 

Mycelial growth was thick, forming irregulare white patches, 

sometimes effused to cover the whole leave surface and usually 

not present appressoria. Conidiofores erect, foot cells cylindric, 

40–126 (‐148) × 4/5–7/8 µm usually followed by (1‐) 2–3 (‐4) 

shorter and different length cells. Conidia formed singly, primery 

conidia lancaeolate, 31–67 (80) × 12–20 µm and secondary 

conidia ellipsoid to cylandric, 33–76 × 13–22 µm (fig 1). 

Ascomata found on leaves as embedded in the mycelial felt, 

were gregarious to scattered and measured 145–250 µm in 

diameter. Appendages were myceliod, arising from the lower 

half of ascomata, brown, paler upward. Asci 20–30 (‐45) in each 

cleistothecia, clvate, stalked, 77–120 (‐135) × 25–42 µm. 

Ascospores (1‐) 2 (‐4) in each ascus, ellipsoid‐ovoid shaped, (20‐) 

25–40 (‐45) × 15–22 µm (fig 2). 

Figure 2. Leveillula taurica (telemorph). (A) asci, (B) ascospores. 

The fungus caused significant losses, estimated at more than 

35% of production, at the location studied by making infected 

plants unsuitable for use in propagation. 

REFERENCES 

1. Braun U (1987) A monograph of the Erysiphales (powdery 

mildews). Beih. Nova Hedwigia 89:1–700. 

2. Braun U (1995) The Powdery Mildews (Erysiphales) of Europe. Jena, 

Germany: VEB G. Fischer Verlag. 

3. Carmichael, J W (1955) Lacto‐fuchshin: A new medium for 

mounting fungi. Mycologia 47: 611–619. 

On the basis of morphological characters of the anamorph and 

telemorph, this fungus was identified as Leveillula taurica (1). 

This is also the first report of genus Leveillula on Morceae in 

world and Morceae is a new host family for Leveillula 

taurica(1,2). 

Figure 1. Leveillula taurica (anamorph). (A) conidiophores, (B) primery 

conidia, (C) secondary conidia, (D) germinated conidium. 


57 New records of Erysiphaceae (Ascomycota: Erysiphales) for Iran mycoflora 



Posters 

INTRODUCTION 

Powdery mildew fungi belong to the family Erysiphaceae 

(Ascomycta: Erysiphales) and infect a wide range of 

angiosperms. This family consists of 18 genera and about 435 

species(1). Ershad (4) has provided the best list of powdery 

mildews and their hosts in Iran. 


During the years 2007 and 2008 Surveys were carried out to 

determine species composition and host range of powdery 

mildews(Erysiphaceae) in Sistan region, Iran. Samples were 

stained with Lactofushin(3) and morphological characteristics of 

fungus investigated by Olympus microscope(Modle: BH2) and 

drawn by drawing tube connected on microscope. Observation 

of conidial germ tubes was carried out using the method of 

Hirata (5). Identification of species were carried out by reliable 

references(1,2). 


In this study fourteen taxa were identified which according 

Ershad(4) Among this taxa, Erysiphe australiana is new to Iran 

mycoflora and other thirteen taxa viz. Erysiphe convolvuli, E. 

cruciferarum, E. lycopsidis, E. necator, E. polygoni, 

Golovinomyces cichoraceaerum, G. orontii, Leveillula saxaouli, L. 

taurica, Phyllactinia moricola, Podosphaera leucotricha, P. 

pannosa and Blumeria graminis have previously been recorded 

from Iran. 

Morphology of appressoria, conidiophores, conidia as well as the 

host species, fit the description for Erysipphe(Uncinuliella) 

australiana provided by Braun (1). conidia with multilobed 

appressoria and the host species determined that Oidium yeneii 

donot occurs on Lagerstromia indica. 

So, for your more information also six plant species viz. Alhagi 

persarum(a host for L. taurica), Althaea officinalis(a host for L. 

taurica), Gaillardia sp.(a host for G. cichoraceaerum), Haloxylon 

persicum(a host for L. saxaouli), Malva microcarpa(a host for L. 

taurica) and Phalaris paradoxa(a host for B. graminis) are 

recorded as a new hosts for Iranian powdery mildew fungi. 

REFERENCES 


mildews). Beih. Nova Hedwigia 89:1–700. 

2. Braun U and Takamatsu S (2000) Phylogeny of Erysiphe, 

Microspaera, Uncinula (Erysipheae) and Cystotheca, Podosphaera, 

Sphaeroteca (Cystotheceae) inferred from RDNA ITS sequences‐ 

Some taxonomic consequences. Schlechtendalia 4: 1–33. 

3. Carmichael J.W. (1955) Lacto‐fuchshin: A new medium for 

mounting fungi. Mycologia 47: 611–619. 

4. Ershad D (1995) Fungi of Iran. Pest and diseases research institute, 

department of botany, publication no. 10, 874 pp. 

5. Hirata K (1942) On the shape of the germ tubes of Erysipheae Bull 

Chiba Coll. Hortic. 5: 34–49. 

Morphological characters of Erysipphe australiana on 

Lagerstromia indica is as follow: 

Mycelium on leaves, effused, cover the whole leaves surface, 

nonpersistance, appressoria are multilobed. Conidiofores erect, 

foot cells cylindric occasionally ruffle, (23‐) 25–36 (‐50) (5‐) 6×‐ 

9/5 µm followed by (1‐) 2 (‐3) different length cells. Conidia 

formed singly, ellipsoid to cylandric, (25‐) 28–43 (‐49) × (11/5‐) 

12/48–18 (19/5) µm. This funus didn’t form telemorph(fig 1). 

Figure 1. Erysipphe australiana on Lagerstromia indica: A— 

conidiophores, B—conidia, C—appressoria 


Posters 

58 Survey of propinquity among Erysiphe, Leveillula, Phyllactinia, Podosphaera, 

Sphaerothca, Uncinula and Uncinuliella based on analysis of morphological characters 



INTRODUCTION 

Powdery mildew fungi belong to the family 

Erysiphaceae(Ascomycta: Erysiphales) which cause serious 

diseases in a variety of cultivated plants such as cereals, 

vegetables and ornamental plants. This family consists of 18 

genera and about 435 species(1). 

Phylogenetic relationships among the genera of powdery 

mildews have been proposed by some authors(1, 2, 3). 

This research is carried out in order to investigate propinquity 

and affinity among seven genera of powdery mildews based on 

morphological data. 


We used 18 morphological characters. Each character contains 2 

to 6 status. Varies status of characters take numbers 1 to 6. The 

data were analyzed using the Distance method by PAUP v.4.0b4a 

(4). Neighbour‐Joining(NJ) tree was obtained. The strength of the 

internal branches from the resulting trees were tested by 

bootstrap analysis (5). 


The results showed that all taxa are divided into five groups, 

which corresponded well to new mitosporic taxa. Clade 1 

consisted of Erysiphe section Erysiphe, Uncinula and Uncinuliella, 

all of which have single conidia, lobad apprasorium an Oidium 

subgenus Pseudoidium mitosporic state. Clade 2 consisted of E. 

galeopsidis, E. cichoracearum and E. orontii, which have without 

fibrosin badies catanate cinidia and Oidium subgenera 

Striatoidium and Reticuloidium mitosporic states. Clade 3 

consisted of of Leveillula and Phyllactinia, which have 

endophytic mycelia and same suface patterns of conidia and 

Oidiopsis and Ovulariopsis mitosporic states, respectively. Clade 

4 consisted of Podosphaera and Sphaerotheca, which have 

fibrosin badies catanate cinidia and singl ascual ascocarpes an 

Oidium subgenus Fibroidium mitosporic state. Clade 5 consisted 

of Blumeria graminis, which has digitat haustoria, bollbous 

sewellig of foot cell, unique suface patterns of conidia an Oidium 

subgenus Oidium mitosporic state. This resuts coincides with 

molocular analyses(1,3) 

Figure 1. Neighbour‐Joining tree inferred from morphological data. 

Branch support was determined by 1000 bootstrap replication, shown 

above the branches. Bootstrap values below 50% are not shown. 

REFERENCES 

1. Blumer S (1933) Die Erysiphaceen Mitteleuropas mit Besonderer 

Berucksichtigung der Schweiz. Beitr. Kryptogameflora Schweiz, 7: 

1–483. 


mildews). Beih. Nova Hedwigia 89:1‐ 700. 

3. Braun U and Takamatsu S (2000) Phylogeny of Erysiphe, 

Microspaera, Uncinula (Erysipheae) and Cystotheca, Podosphaera, 

Sphaeroteca (Cystotheceae) inferred from RDNA ITS sequences‐ 

Some taxonomic consequences. Schlechtendalia 4: 1–33. 

4. Felsenstein J (1985) Confidence limits on hylogenies; an approach 

using the bootstrap. Evolution 39: 783–791. 

5. Swofford DL (2000) PAUP: Phylogenetic analysis using parsimony 

and other methods (PAUP Version4). Illinois Natural History Survey, 

Champain, Illinois, U. S. A. 


22 Pulse virus surveys from Victoria and South Australa in 2007 

M. Aftab{ XE "Aftab, M." } A , A. Freeman A and J. Davidson B 

A Department of Primary Industries Victoria Private Bag 260, Horsham VIC 3400 

B South Australian Research and Development Institute, GPO Box 397, Adelaide SA 5001 

Posters 

INTRODUCTION 

Surveys of pulse crops in 2007 (field pea, faba bean, lentil, lupin 

and chickpea) were undertaken in Victoria and South Australia to 

determine the occurrence and incidence of eight pulse viruses: 

Alfalfa mosaic virus (AMV), Bean yellow mosaic virus (BYMV), 

Cucumber mosaic virus (CMV), Pea seedborne mosaic virus 

(PSbMV), Bean leafroll virus (BLRV), Beet western yellows virus 

(BWYV), Tomato spotted wilt virus (TSWV) and Subterranean 

clover stunt virus (SCSV). 


In Victoria in October 2007, random samples were taken from 45 

crops, comprising 13 field pea, eight lentil, 15 faba bean, five 

chickpea and four lupin from 31 locations (Ararat, Berriwillock, 

Boyeo, Clear lake, Culgoa, Dimboola, Dooen, Douglas, 

Gymbowen, Inverleigh, Jung, Kaniva, Kerang, Lake Boga, Lalbert, 

Linton, Marnoo, Minimay, Mininera, Minyip, Murtoa, Natimuk, 

Nhill, Noradjuha, Rockwood, Rupanyup, Skipton, Treso, 

Warracknabeal, Woorinen and Ultima). In South Australia in 

October 2007, random samples were taken from 49 crops, 

comprising 20 faba bean, 11 field pea, nine lentil, two chickpea, 

five lupin and two vetch from 27 locations (Agery, Arthurton, 

Blyth, Bordertown, Brecon, Cockle Beach, Coonalpyn, Cummins, 

Freeling, Giles Corner, Glen Park, Hart, Karkoo, Keith, Kybunga, 

Minlaton, Monta, Mundulla, Owen, Rhynie, Riverton, Rogers 

Corner, Tarlee, Saddleworth, Warooka, Willalooka, Yeelanna). 

One hundred, randomly selected petioles, tendrils or shoots 

were collected from each crop and bundled into groups of ten. 

The bundles were blotted onto nitrocellulose membranes and 

processed using tissue blot immunoassay. Within‐crop virus 

incidence for each crop was estimated from the number of 

positive samples. 

RESULTS 

In Victoria, the most serious virus problems were BWYV in pea, 

lentil and chickpea, CMV in lentil and PSbMV in pea (Table 1). 

BWYV occurred in 100% of pea and chickpea and 88% of lentil 

and 67% of bean crops and the within crop virus incidence was 

highest in lentils (up to 61%) and lowest in beans (up to 8%). 

CMV occurred in all crop types with low within crop incidence 

(

Posters 

24 Integrated management of mango diseases using inoculum reduction strategies 

with fungicide spray treatments 

C.N. Akem{ XE "Akem, C.N." }, G. MacManus, P. Boccalatte, K. Stockdale, D. Lakhesar and R. Holmes 

Horticulture and Forestry Science; Queensland Primary Industries and Fisheries, DEEDI, PO Box 15, Ayr, Qld 4807 

INTRODUCTION 

Anthracnose caused by Colletotrichum gloeosporoides (Penz.) 

and stem‐end‐rots caused by Neofusicoccum parvum 

(Botryospheria spp and Lasiodiplodia theobromae) are the main 

postharvest diseases of mango in all tropical and sub‐tropical 

environments where mangoes are grown. 

Managing these diseases effectively is the key for producing 

quality mango fruits with a long shelf life. The use of pre‐ and 

post‐harvest fungicide treatments has been the main mechanism 

of trying to achieve this objective (1). There are environmental 

and residue concerns on the overuse of these fungicides and 

therefore a push to limit their use. To do this, other strategies 

need to be integrated with minimal fungicide use to overcome 

such concerns and still achieve effective disease control. The 

main objective of this study was to determine the effectiveness 

of integrating field inoculum reduction strategies with minimal 

fungicide sprays in managing mango postharvest rots, especially 

anthracnose and stem end. 


The trials were conducted on a uniform block of 18‐year old 

Kensington Pride mango trees at Ayr Research Station of the 

Queensland Primary Industries and Fisheries, during 2007 and 

2008 seasons. The block was divided into two sub‐blocks to 

represent partial and optimal inoculum reduction levels. On the 

partial reduction sub‐block a one‐time removal of dead twigs, 

branches and leaves from the tree canopy was undertaken soon 

after mechanical pruning, while on the optimal reduction subblock 

dead twigs, branches and leaves were removed from 

within and underneath the trees soon after pruning, and were 

followed up with monthly repeats of the same exercise. 

The following fungicides were applied to the treatment trees in 

different combinations at strategic times in each season: 

Mankocide (Mc), Mancozeb (Mz), Octave (Oc), Amistar (Am), 

Bravo (Br), Aero (Ae) and Tilt (Tt). This was to determine their 

integrated effects with the inoculum reduction strategies on 

mango postharvest diseases. The treatment trees in each subblock 

were arranged in a 6 x 4 RCBD and standard mango 

industry tree husbandry practices for irrigation, fertilisation and 

insect pest control were implemented. 

At harvest, 35 fruits were randomly picked from each treatment 

tree from which 25 more uniform ones were selected, desapped, 

washed and then placed in boxes and stored in a cool 

room at ~20–22 ° C. Fruits were assessed for postharvest rots 

disease incidence 14 days after incubation. 


All fungicide spray combinations in 2007 and 2008 were 

significantly (P=0.05) better than the control in suppressing 

postharvest rots incidence on the fruits (Figs 1 and 2). In 2008 

there were additional treatment differences within the fungicide 

treatment combinations (Fig. 2). Significant differences (P=0.05) 

between partial and optimal inoculum reductions on fruit rots 

were observed on most treatments in 2008 but not 2007. The 

repeat of the inoculum reduction exercise on the same sub‐block 

for two seasons significantly reduced the level of inoculumcarrying 

dead materials within and underneath the treatment 

trees resulting in this accumulated significant effect in 2008. 

Fungicide treatment combinations used in both seasons ranged 

from a minimum of 3 to a maximum of 7 sprays. This was 

significantly less than the current industry practice of up to 12 or 

more sprays per season, to achieve the same level of disease 

control as compared to the low levels from the optimal inoculum 

reduction sub‐block. 

These trial results demonstrate the role that basic orchard 

hygiene can play in field management of mango postharvest 

diseases, especially when integrated with minimal fungicide 

spray treatments. 

Percentage 

120 

100 

80 

60 

40 

20 

0 

c c 

ab 

ab 

Ctrl 

Mc/Oc/Mz/Am 

Mc/Mz/Oc/Mz/Am/Mz/Am 

a ab 

Mc/Br/Oc/Br/Am/Br/Am 

a 

a 

Treatments 

b 

b 

McTt/Mz/Oc/Mz/Am 

b 

Mc/Tt/Mz/Tt/Oc/Mz/Am 

abc 

Partial IR 

Optimal IR 

{Ctrl = Control, Mc = Mankocide, Oc = Octave, Mz = Mancozeb, Am = Amistar, Br = 

Bravo, Tt = Tilt } 

Figure 1. Effect of inoculum reduction (IR) and limited fungicide sprays 

on the incidence of postharvest rots—2007 

Percentage 

120 

100 

80 

60 

40 

20 

0 

d 

Ctrl 

e 

c 

Oc/Mz/Am 

d 

ab 

Oc/Mz/Am/Mz/Am 

ab 

Oc/Br/Am/Br/Am 

ab 

bc 

Treatments 

Oc/Mz/Ae 

b 

cd 

a 

Oc/Mz/Ae/Ae 

a 

Partial IR 

Optimal IR 

Figure 2. Effect of inoculum reduction (IR) and limited fungicide sprays 

on incidence of postharvest rots—2008. 


We gratefully acknowledge HAL, AMIA and DPI&F for funding 

this research. 

REFERENCES 

1. Akem, N. Chrys (2006). Mango Anthracnose Disease: Present Status 

and Future Research Priorities. Plant Path J. 5(3):266–273. 


23 Mango sudden death syndrome assessment in various mango growing districts of 

Punjab, Pakistan 

Posters 

F.S. Fateh 1 , M.R. Kazmi 1 , C.N. Akem{ XE "Akem, C.N." } 2 , A. Iqbal 1 and G. Bhar 1 

1 Nat‐IPM Programme, IPEP, National Agricultural Research Centre, Park Road, Islamabad, Pakistan 

2 Queensland Department of Primary Industries and Fisheries, Ayr, Australia 

INTRODUCTION 

Mango is an important fruit in Pakistan enjoyed by all age groups 

in the country. The continuous production of this fruit is being 

threatened by a number of diseases. Among these is the mango 

sudden death syndrome (MSDS), a complex caused by a number 

of biotic and abiotic factors. Botryodiplodia theobromae and 

Ceratocystis fimbriata have been identified as the key fungal 

pathogens in Pakistan that lead to an increase in the severity of 

the disease. Typical symptoms of this disease include drooping 

and browning of leaves, bark splitting, gum oozing, and in most 

cases these symptoms are followed by the sudden wilting and 

death of the tree. 

The disease was first detected in Pakistan in 1995 from the 

Muzaffar Garh district of Punjab and its effects only became 

popularised in 2005 when it was reported to be spreading at 

epidemic proportions with serious effects on productivity (1). 

There has been a dire need to monitor the prevalence of the 

disease and identify factors associated with its rapid spread 

through out the mango production districts of Pakistan. The 

main objective of this study was to monitor the spread and 

distribution of the disease and collect data associated with its 

epidemiology as a first step towards the development of 

management strategies to stop or slow down its spread. 


A survey was conducted in the following mango growing districts 

of Punjab: Faisalabad, Jhang, Khanewal, Multan and Muzaffar 

Garh. The number of orchards visited in these districts was 3, 6, 

3, 8 and 4 respectively. Sampling was done from the twigs, 

branches, bark, stem at the collar regions and roots of the 

affected trees. The assessment was made on the basis of a mean 

disease severity rating of 0–5 reflecting the percentage of 

symptoms such as gummosis, bark splitting and bark beetle 

holes observed on the parts sampled, where 0=healthy trees; 

1=1–10%; 2=11–20%; 3=21–30%; 4=31–50% and 5= more than 

50% diseased area. 

The infected samples were cut into small pieces with a sterilised 

scissors and disinfected with 10% commercial bleach for one 

minute followed by three rinses in distilled water. After drying, 

the pieces were aseptically plated on potato dextrose agar 

medium and incubated at 25°C. After 7 days of incubation 

resulting fungal colonies were microscopically identified based 

on spore morphological characteristics. The colonisation 

frequency of each sample was also determined using the 

following formula: 

Colonisation (%) = No. of pieces colonised by a pathogen x 100 

Total No. of pieces 


The maximum of 27% mean disease incidence was found in 

Multan samples followed by 22% in Muzaffar Garh, 18% in Jhang 

and 15% in Khanewal. The minimum of 12% disease incidence 

was found in Faisalabad. A maximum severity rating of 4 was 

also observed on Multan samples followed by a 3 rating for both 

Khanewal and Muzaffar Garh and a 2 rating for Jhang samples. A 

minimum rating of 2 was recorded on Faisalabad samples (Fig 1). 

These results clearly demonstrate that mango sudden death 

disease prevails in all the mango growing districts of Punjab 

surveyed. The common prevalence of the disease may be 

associated with the large number of abandoned orchards that 

are receiving little or no management attention. It was also 

common to observe adjacent orchards with high levels of 

infection, especially in the Multan district, suggesting the ease of 

pathogen movement between such orchards. The colonisation 

percentage of individual fungi from the different orchards 

sampled shows that B. theobromae was the most common 

pathogen while C. fimbriata was the least (Fig 2) This survey 

results suggest the need for more emphasis on the importance 

of orchard sanitation and improved cultural practices to reduce 

the prevalence of different fungal pathogens causing sudden 

death of mango in Punjab 

Mean Disease Incidence (%) and Mean Disease 

Severity Rating (0-5) 

30 

25 

4.5 

4 

3.5 

20 

3 

15 

2.5 

2 

10 

1.5 

5 

1 

0.5 

0 

0 

Faisalabad Jhang Khanewal M ultan M uzaffar 

Locations 

Garh 

Figure 1. Mean incidence and severity of sudden death in different 

districts of Punjab. 

45 

40 

35 

30 

25 

20 

15 

10 

5 

0 

1 2 3 4 3 

Disease severity rating 

N 

Ceratocystis fimbriata 

Botryodilodia 

theobromae 

Fusarium sp. 

Nattrassia mangiferae 

Figure 2. Mean disease incidence of different fungi colonising mango 

trees with sudden death symptoms in Punjab 

ACKNOWLEGEMENTS 

Funding for this work was provided by Etiology and Management 

of Mango Project and ASLP Mango Production Project. 

REFERENCE 

Munawar, R.K., F.S. Fateh, K. Majeed, A.M. Kashkhely, I. Hussain, I. 

Ahmad and A. Jabeen. 2005. Incidence and etiology of mango 

sudden death phenomenon. Pak. J. Phytopathology. 17(2): 154– 

158. 


Posters 

1 Identification and characterisation of phytoplasma pathogen associated with alfalfa 

diseases in Al Hasa, Saudi Arabia 

Khalid Alhudaib{ XE "Alhudaib, K." } and Y. Arocha 

Plant Protection Department, King Faisal University PO Box 55009 Alhasa 31982 

National Center for Animal and Plant Health (CENSA), Havana, Cuba 

INTRODUCTION 

Alfalfa (Medicago sativa L.) is cultivated as a forage crop in many 

countries and is distinguished from other agricultural crops in 

having a perennial habit. However, phytoplasmas diseases have 

been reported to cause very significant economic losses in 

several countries worldwide. In Eastern province Saudi Arabia, 

alfalfa is the most important forage crop. 

A number of phytoplasma diseases have been reported to be 

associated with alfalfa plants that result from drastic reduction 

in forage yield. Average annual loss of alfalfa in the Sultanate of 

Oman due to witches’‐broom disease is approximately 25% of 

green hay, an estimated loss of US$30 million (1). 

Recently a phytoplasma of 16SrI, Ca. Phytoplasma asteris, has 

been associated with the Al‐Wijam disease of date palm disease, 

in Al Hasa, Saudi Arabia, and leafhoppers belonging to 

Cicadellidae family were identified as potential vectors (2). This 

paper reports results of a PCR‐based phytoplasma survey on 

diseased alfalfa grown in Eastern province of Saudi Arabia. 


Field‐collection of plants, leafhoppers Alfalfa (M. sativa L.) 

surveys were conducted from April to September 2008 in 

Eastern province of Saudi Arabia (Fig. 1). A total of 76 samples 

showing typical symptoms of witches’ broom disease. 254 

leafhoppers were collected from alfalfa field. Type specimens 

were identified at the National Museum of Wakes, Cardiff as 

follows: Empoasca decipiens (Paoli) and Cicadulina bipunctata 

(Melichar). 

16SrII. The 16SrII group was found in alfalfa and all insect species 

tested. In the Gulf region, the 16SrII group has been identified in 

lime alfalfa (1). 

Amplified DNA was sequenced to determine relationships 

between phytoplasma isolates. The work confirmed that 

phytoplasmas are infecting alfalfa crops in Saudi Arabia, and 

progress was made in identifying the phytoplasma groups 

present and information gained on their potential spread by 

vectors. 

E. decipiens and C. bipunctata, the most abundant insects 

collected from fields, were carrying phytoplasmas from 16SrI 

and 16SrII in proportions of 10:33, and 6:33, respectively. Results 

suggest that E. decipiens and C. bipunctata, are the major insect 

candidates to vector phytoplasmas from 16SrI and 16SrII groups. 

It is known that many vectors can transmit more than one type 

of phytoplasma and that many plants can harbour two or more 

distinct phytoplasmas. Vector‐host‐plant interactions play an 

important role in determining the spread of phytoplasmas. It is 

very likely that due to their abundance and capability to carry 

phytoplasmas, E. decipiens and C. bipunctata mainly contributed 

to the spread phytoplasma diseases, in alfalfa, date palm, 

decline in lime and the disease in papaya, by cycling from the 

alternative reservoirs to the crops, so that, the spread of 

diseases is a consequence of the vector‐phytoplasma‐plant three 

way interaction. 

PCR and RFLP analysis DNA was extracted from leaf tissue and 

insects. Aliquots of final DNA preparations were used as 

template for a nested PCR (nPCR) assay with phytoplasma 16S 

rDNA primers R16mF2/R16mR1 for the first round, and either 

R16F2n/R16R2 and fU5/rU3 for the nested reaction. Nested PCR 

products (10 ml) were digested with restriction endonucleases 

AluI, HpaII, Hea III and Sau3A I. 

16S rDNA sequencing and phylogenetic analysis Phytoplasma 

rDNA amplified by PCR using the primer pair P1/P7 was purified. 

The PCR products were sequenced in both directions using 

primer pair P1/P7 and the 16S rDNA sequences of phytoplasmas 

identified in our study were compared with others in Genbank 

by BLAST. 


Crop samples showing typical symptoms of phytoplasma 

infection were collected from different areas of Al Hasa (Fig 1). 

Leafhoppers were also trapped by netting for examination as 

potential vectors of the disease. Plant samples and leaf hoppers 

were analysed by DNA extraction and amplification with 

phytoplasma‐specific primers. 

Phytoplasmas were detected in 43/76 alfalfa samples, and from 

16/33 batches of all leafhopper species tested. No PCR products 

were obtained for asymptomatic plant samples. RFLPs were used 

to partially characterise isolates from plants and insects. Based 

on RFLP and sequencing analysis, phytoplasmas from group 

Figure 1. Alfalfa witches’‐broom symptoms 


We thank BAE Systems and the British Council for funding the 

Post doctoral Summer Research Program for Dr Khalid Alhudaib. 

We thank Dr Mike Wilson at the national Museum of Wales, 

Cardiff, UK, for the finer identification of the leafhopper species. 

REFERENCES 

1. Khan A, Botti S, Al‐Subhi A, Gundersen‐Rindal D, Bertaccini A. 2002. 

Molecular identification of a new phytoplasma associated with 

alfalfa witches’ broom in Oman. Phytopathology 92: 1038–47. 

2. Alhudaib K, Arocha Y, Wilson M, Jones P. 2007. First report of a 

16SrI, Candidatus Phytoplasma asteris group phytoplasma 

associated with a date palm disease in Saudi Arabia. Plant 

Pathology NDR 15: Feb. 2007. 


59 Efficient transformation of Colletotrichum capsici, the causal agent of chilli pepper 

anthracnose by Agrobacterium 

Posters 

A.S.M. Auyong{ XE "Auyong, A.S.M." }, R. Ford and P.W.J. Taylor 

BioMarka/Centre for Plant Health, Melbourne School of Land and Environment, The University of Melbourne, 3010, Victoria 

INTRODUCTION 

Anthracnose disease of chilli pepper is caused by a complex of 

Colletotrichum spp. with C. capsici being the most severe in 

South East Asia (1). Knowledge of the mechanisms for host 

resistance and pathogenicity is crucial for developing effective 

and durable disease control. Several putative pathogenicity 

genes involved in C. capsici infection of chilli pepper have been 

identified and partially cloned (Auyong, unpublished). A fungal 

transformation system is required to prove the function of these 

putative genes in the infection process. In this study an efficient 

transformation system was successfully developed to serve as a 

platform towards understanding chilli pepper‐C. capsici 

interactions. Agrobacterium tumefaciens carrying a hygromycin 

phosphotransferase gene (hph) and a green fluorescent protein 

(GFP) gene was used to transform the conidiospores of C. 

capsici. Transformation efficiency was correlated with 

conidiospores density, ratio of conidiospores to bacterial cells, 

type of Agrobacterium strains and plasmid, presence or absence 

of acetosyringone, co‐cultivation time and co‐cultivation 

temperature. 


Fungal culture. Colletotrichum capsici, BRIP 26974 isolated from 

Capsicum annuum was supplied by the Department of Primary 

Industry (DPI), Queensland, Australia, and maintained on potato 

dextrose agar (PDA). 

Fungal transformation. Conidial suspension was prepared and 

adjusted to 10 2 , 10 4 , 10 6 and 10 8 conidiospores per ml and mixed 

at different ratio (1:3, 1:5, 1:1, 3:1 and 5:1) with Agrobacterium 

(AGL1 or LBA4404) containing either pJF1, pPK2 or pKHt plasmid. 

The mixture was plated onto filter paper on solid induction 

medium, either amended or non‐amended with 200 μM 

acetosyringone. Following co‐cultivation for 1, 2, 3, 4, and 5 days 

at co‐cultivation temperature of 24°C, 28°C, 32°C or 36°C, the 

fungal‐bacterial cells on the filter paper were transferred to PDA 

amended with hygromycin B and cefotaxime to eliminate the A. 

tumefaciens cells. Individual transformants were transferred 

after 4 to 6 days to PDA amended with hygromycin B. In all 

experiments, C. capsici conidiospores co‐cultivated with 

uninoculated induction medium were included as a negative 

control. All experiments were replicated and results were 

analysed using ANOVA. 

Analysis of transformation events. The frequency and 

randomness of T‐DNA integration in the fungal genome was 

determined by PCR and Southern blot. 


Agrobacterium was successfully used to transform C. capsici 

conidiospores and mycelium (Figure 1). The biological 

differences among fungal species can influence transformation 

efficiencies in different filamentous fungi (2). Following 

optimisation, high transformation efficiencies were routinely 

obtained for C. capsici. 

Conidiospore density. Transformation efficiency was consistently 

found to be optimum at the conidiospores density of 10 6 and 10 8 

conidiospores per ml. Hence, subsequent transformations were 

carried out using 10 6 conidiospores per ml. 

Ratio of fungal spores to bacterial cells. The highest 

transformation efficiency was obtained with equal volume of the 

mixture. 

Agrobacterium strains. A. tumefaciens AGL1 strain produced 

more transformants (16.2% more) than LBA4404 regardless of 

the binary vector used. 

Plasmid type. pJF1 and pPK2 plasmids provided similar 

transformation efficiencies. In contrast, pKHt plasmid produced 

significantly less transformants (p

Posters 

60 Infection process of endophytic Colletotrichum gloeosporioides on cacao leaves 

C. Blomley{ XE "Blomley, C." } A , E.C.Y Liew B and D.I. Guest A 

A Faculty of Agriculture Food and Natural Resources, The University of Sydney, 2006, NSW 

B Royal Botanic Gardens Trust, The Royal Botanic Gardens, Sydney, NSW, 2000 

INTRODUCTION 

Colletotrichum species are commonly isolated as endophytes 

from leaves and fruits of tropical plants. In preliminary surveys 

Colletotrichum spp. accounted for 29–48% of isolates sampled as 

endophytes from leaves of the cacao tree (Theobroma cacao) in 

four sites in Australia and Papua New Guinea. By definition 

endophytes do not cause disease symptoms at the time they are 

isolated from plant tissue. The infection process and subsequent 

tissue colonisation has been elucidated for only a few endophyte 

host interactions, none of which include tropical plants. 

Colletotrichum species can penetrate plant tissue through 

wounds, natural openings such as stomata or by penetration of 

the plant cuticle 1 . They are often categorised into three groups: 

intracellular hemibiotrophs, subcuticular intramural colonisers 

and those that display a combination of the two infection 

strategies 1 . Intracellular hemibiotrophs first grow biotrophically 

in host tissue before switching to a necrotrophic stage which 

results in symptom development. Subcuticular intramural 

pathogens grow beneath the cuticle and cause dissolution of the 

epidermal cell walls. The aim of this research was to investigate 

the infection process of an endophytic isolate of C. 

gloeosporioides on T. cacao leaves. 


An isolate of C. gloeosporioides was isolated from apparently 

healthy leaf tissue of T. cacao in Far North Queensland, 

Australia. Young and mature leaves of cacao were sprayed with a 

1x10 5 conidia/mL suspension to runoff. Leaf tissue was sampled 

for observations every 2h for 16h, at 24h and then every 24h for 

6 days. Tissue was cleared for 4h at 60˚C followed by 20h at 

room temperature in a solution of 0.15% trichloroacetic acid in 

3:1 ethanol:chloroform. Tissue was immersed in 0.025% aniline 

blue in lactoglycerol for 1h at 60˚C followed by 23h at room 

temperature in order to stain fungal hyphae. Experiments were 

repeated at least three times. 

RESULTS 

Conidia began germinating within 6 hours post inoculation (hpi), 

usually giving rise to one and rarely two germ tubes. Appressoria 

were produced at 8–10 hpi, either directly or at the end of a 

short germ tube and became melanised by 12 hpi. Infection pegs 

were produced predominantly over cell walls at 12–16 hpi in 

both young and mature leaves. Stomatal penetration was never 

observed. Infection vesicles were visible at 3 days post 

inoculation (dpi) in young leaves and appeared as thick, highly 

lobed hyphae which filled the epidermal cell directly beneath the 

infection peg. At 4–5 dpi infection vesicles had branched into 

narrow secondary hyphae which penetrated cell walls and grew 

inter‐ and intra‐cellularly in young leaves (Fig. 1). Infection 

vesicles formed in mature leaves 4–5 dpi and had a similar 

appearance to those in young leaves (Fig 2). In mature leaves, 

infection was restricted to the initial cell in which the infection 

vesicle formed over the 6 days of observation. 

Figure 1. Primary hyphae of C. gloeosporioides colonising epidermal cells 

of T. cacao leaves 4 dpi. Bar = 10µm 

Figure 2. Primary hyphae of C. gloeosporioides restricted to the 

epidermal cell directly below appressoria (5 dpi). Bar = 20um). 

DISCUSSION 

Endophytic C. gloeosporioides on T. cacao leaves can be 

categorised as an intercellular hemibiotroph. Infection was 

observed in epidermal cells directly beneath the appressorium 

and no subcuticular intramural growth was observed. The 

infection process did not differ on young and mature T. cacao 

leaves in the first 3 dpi. Following this, colonisation was more 

rapid in young leaves and led to the production of disease 

symptoms. Infection in mature leaves remained biotrophic and 

fungal growth appeared to cease after infection and colonisation 

of one epidermal cell. The length of the biotrophic, 

asymptomatic phase has been correlated the redox state 2 and 

pH of the host tissue 3 in other Colletotrichum‐host interactions. 

Factors affecting the infection process in T. cacao are currently 

being investigated. 

REFERENCES 

1. Bailey JA, O'Connell RJ, Pring RJ & Nasby C (1992). Infection 

strategies of Colletotrichum species. In ‘Colletotrichum: Biology, 

Pathology and Control’ (Eds JA Barley & MJ Jeger) pp. 88–120. 

(C.A.B. International: Wallingford) 

2. Wei YD, Byer KN, Goodwin, PH (1997) Hemibiotrophic infection of 

round‐leaves mallow by Colletotrichum gloeosporioides f.sp. 

malvae in relation to leaf senescence and reducing agents. 

Mycological Research 101, 357–364 

3. Kramer‐Haimovitch H, Servi E, Katan T, Rollins J, OkonY, & Prusky, 

D. (2006) Effect of Ammonia production by Colletotrichum 

gloeosporioides on pelB activation, pectate lyase secretion and fruit 

pathogenicity. Applied and Environmental Microbiology 72,1034– 

1039. 


2 A Phytophthora sp. is the cause of jackfruit decline in the philippines 

L.M. Borines{ XE "Borines, L.M." } A , R. Daniel B and D. Guest B 

A Department of Pest Management, Visayas State University, Visca, Baybay, 6521 Leyte, Philippines 

B University of Sydney, Sydney, NSW 2006 Australia 

Posters 

INTRODUCTION 

Jackfruit is a very popular domestic fruit in the Philippines. It has 

a wide distribution and is cultivated throughout the country. A 

survey of jackfruit growers in the Eastern Visayas indicated that 

wilt disease was the main constraint to improved productivity. In 

some areas up to 90% of jackfruit trees are affected by wilt 

disease, manifested by leaf yellowing, defoliation, girdling stem 

lesions and rot. Previous attempts to identify the pathogen 

yielded a range of fungal, nematode or bacterial isolates, none 

of which proved pathogenic. Accurate identification of the cause 

of the decline syndrome is imperative for the control of the 

disease. This study seeks to isolate and identify the pathogen 

causing jackfruit wilt and to evaluate a range of disease 

management strategies through participatory action research. 


Affected roots, stem canker lesions and soil from near infected 

trees was suspended in water and baited with flower petals 1 . 

Lesions that developed within 2 days were surface sterilised and 

plated on Potato Dextrose Agar, Carrot Agar and Onion Agar, 

supplemented with benomyl, nystatin and streptomycin. Pure 

cultures were re‐introduced to flower baits to induce sporangia, 

zoospore and chlamydospore formation for inoculation of 

detached jackfruit leaves and seedlings. 

RESULTS 

Wilt disease was recorded in all the fields examined within Leyte 

and Samar islands, at an incidence of 5–90% of trees. Areas with 

very high incidence were typically subject to periodic heavy 

flooding, particularly during the rainy season. Yield losses were 

estimated to be range from 5–80%. Field visits and farmer 

interviews showed that almost all of the farmers were unaware 

of the cause of the disease or appropriate management 

strategies. 

zoospores through a vesicle before they separate and swim 

away (Figs 2a and 2b). The isolated Phytophthora species 

produces abundant intercalary and terminal chlamydospores 

when re‐introduced to flower baits. 

a 

Figure 2. a) Phytophthora sporangia, b) zoospores exiting via spherical 

vesicles. 

Participatory action research (PAR) disease management trials 

are being established by researchers, extension officers and 

jackfruit farmers in Leyte and Samar Islands. Nine PAR trials have 

been established in Leyte and Samar to test a range of 

management options including field sanitation, organic 

amendments, improved drainage, good nursery practices and 

chemical control in managing wilt disease. 

The identification of the pathogen associated with the symptoms 

of decline and wilt will enable the development of more 

effective, targeted management strategies. 


This research is funded by ACIAR HORT/2006/067/2 

REFERENCES 

Drenth A. & Guest DI. 2006. Biology and Management of Phytophthora 

diseases in the tropics. ACIAR Monograph 114. 

b 

A Phytophthora species was consistently isolated from affected 

jackfruit roots and canker lesions, and from soil collected near 

infected plants. Pathogenicity was confirmed when the isolates 

produced typical wilting symptoms on inoculated plants (Fig. 1a) 

and leaf lesions (Fig.1b). 

a 

b 

Figure 1. a. Un‐inoculated (leftmost) and inoculated jackfruit seedlings 

showing different degrees of wilting. b. The isolated pathogen causes 

leaf lesions. 

In pure culture the mycelium of the pathogen is white with a 

stellate growth pattern. Sporangia are seldom produced in PDA, 

Carrot or Onion Agar, but readily produced when pure cultures 

were re‐introduced to flower petal baits. The pathogen 

produced spherical to ovoid sporangia with an average length of 

41.5 µm and breadth of 26.5 µm. Sporangia have a relatively 

long pedicels, are semi‐papillate to papillate and release 


Posters 

3 The effects of calcium chloride and calcium carbonate on germination and growth 

of Colletotrichum acutatum and Penicillium expansum 

K.S.H. Boyd‐Wilson{ XE "Boyd‐Wilson, K.S.H." } A and M. Walter A 

A The New Zealand Institute for Plant and Food Research Limited, PO Box 51, Lincoln 7640, New Zealand 

INTRODUCTION 

Calcium chloride (CaCl 2 ) and calcium carbonate (CaCO 3 ) have 

been found to enhance the biocontrol activity of yeasts against a 

range of diseases. A number of factors including inhibition of the 

pathogen by the compounds may account for this (1). The aim of 

this research was to investigate whether these compounds 

inhibited germination and growth of Penicillium expansum, the 

causal agent of blue mould of apples, and of Colletotrichum 

acutatum, which causes bitter rot of pome fruit (2,3). 


Germination (%) and germ‐tube length (µm) were assessed after 

20–24 h at 20ºC for three C. acutatum isolates made up in 0, 10, 

or 20 mg/ml CaCl 2 . P. expansum requires exogenous nutrients to 

germinate well, thus germination assays were conducted in 0, 

12.5 and 25% apple broth with 20 mg/ml CaCl 2 for three P. 

expansum isolates. For each combination, the per cent 

germination of 150 conidia and germ‐tube length of 30 conidia 

was recorded. 

Because suspended CaCO 3 made it difficult to observe conidia in 

germination tests, the effects of CaCO 3 and CaCl 2 (each 20 

mg/ml) on the three isolates of P. expansum and two of C. 

acutatum were also investigated by dilution plating on 0, 12.5 

and 25% apple broth agar with and without CaCl 2 and counting 

colony forming units (cfu) after 4–7 days. 

All experiments were conducted twice and data were analysed 

using analysis of variance. Germ‐tube lengths were log 10 

transformed and colony counts were square‐root transformed 

before analysis. P=0.05 was used to assess significance. 

On apple broth agar, no differences between treatments were 

observed and therefore results are given only for agar with no 

apple broth. 

For all P. expansum isolates, the addition of CaCO 3 to the agar 

resulted in significantly fewer cfu than in the CaCl 2 and water 

only treatments. The addition of calcium carbonate did not 

significantly affect cfu counts of C. acutatum isolates. 

In conclusion, neither CaCl 2 nor CaCO 3 reduced germination, 

germ‐tube growth or cfu counts for C. acutatum. This suggests 

that some other mode of action contributes to enhancement of 

bitter rot control when these compounds are combined with 

yeasts. In contrast, the germination, germ‐tube growth and cfu 

counts for P. expansum were all reduced by the addition of CaCl 2 

and CaCO 3 to the growth medium suggesting that this direct 

inhibition could contribute to the improved blue mould control 

in apples when yeasts are combined with these compounds. 


Thanks to the New Zealand Foundation for Research, Science 

and Technology for funding this project (C06X0302). 

REFERENCES 

1. Everett KR, Vanneste JL, Hallett IC, Walter M (2005) Ecological 

alternatives for disease management of fruit rot pathogens. New 

Zealand Plant Protection 58, 55–61. 

2. Rosenberger DA (1997) Blue mold. In ‘Compendium of apple and 

pear diseases’. (Eds A L Jones, HS Aldwinckle) pp 54–55. (APS Press: 

USA) 

3. Sutton TB (1997) Bitter rot. In ‘Compendium of apple and pear 

diseases’. (Eds A L Jones, HS Aldwinckle) pp 15–16. (APS Press: USA) 


Increasing concentrations of CaCl 2 increased the germination and 

germ‐tube length of C. acutatum, although there was a 

significant interaction between the factors studied (Table 1). 

Table 1. Mean per cent germination and germ‐tube length (log 10 

transformed) for each Colletotrichum acutatum isolate and CaCl 2 

concentration. 

Germination (%) Germ‐tube length (µm log 10 ) 

CaCl 2 

(mg/ml) 

CaCl 2 

(mg/ml) 

Isolates 0 10 20 0 10 20 

C4 57 57 85 0.56 0.45 0.34 

C7 41 69 100 0.39 0.67 0.70 

C8 71 51 85 0.45 0.27 0.70 

s.e.d. interaction 17.2 s.e.d concentration 0.097 

P. expansum conidia did not germinate in water alone. In apple 

broth, the addition of CaCl 2 significantly reduced mean 

germination of P. expansum from 37 to 16% and germ‐tube 

length from 0.382 to 0.160 compared with the control. There 

was no difference in germination and germ‐tube length between 

the two concentrations of apple broth. 


45 Fungal endophytes of the Boab species Adansonia gregorri and other native tree 

species 

Posters 

M.L. Sakalidis AB , G.E.StJ. Hardy B and T.I. Burgess{ XE "Burgess, T.I." } B 

A monique.sakalidis@hotmail.com 

B Faculty of Sustainability, Environmental and Life Sciences, Murdoch University, Murdoch 6150, WA, Australia 

INTRODUCTION 

In southern Africa dying Boabs have been reported and 

subsequent surveying of these trees has indicated the presence 

of the fungal pathogen Lasiodiplodia which may be the cause of 

the decline. Due to the close genetic relationship of the African 

and Australian Boabs and the fact that these two continents 

share are large amount of floral families, they may subsequently 

also share the pathogens of many of these plants. The surveying 

of the otherwise healthy Australian Boab and surrounding tree 

species deemed a prudent course of action. 

In this study Boabs were surveyed in 25 sites in the Kimberley 

region and material was also taken from surrounding tree 

species at 3 sites. Endophytic fungi that were isolated from these 

samples were identified using both molecular and morphological 

data and seven new species were described (2). The 

pathogenicity of identified species to Boabs was determined. 

This is the first study to identify endophytes of the Adansonia 

and to conduct pathogenicity trials on these trees. 

At the extreme margin of the lesions the wood was cut away 

using a knife in order to establish the extent of interior lesion 

development. 


433 fungal isolations were made, 282 of these consisted of 

isolates belonging to Botryosphaeriaceae including species of 

Neofussicoccum, Pseudofusicoccum, Lasiodiploidia Dothiorella 

and Neoscytalidium. 

For the trial with tap roots, isolates from the Lasiodiplodia 

theobromae complex produced the largest lesions. 

Neofusiccocum ribis and Neoscyltalidium novaehollandia caused 

moderate lesions and isolates of Lasiodiploida crassispora, 

Dothiorella longicollis, Pseudofusicoccum adansoniae and 

Fusicoccum ramosum all caused minor lesions indicating low 

virulence. 


Stem and leaf material was collected from a range of sites across 

the Kimberlys, Western Australia. Material was taken from 

Adansonia gregorrii and a range of native flora in the same area. 

Endophytes were isolated using standard protocols (1). 

Lesion development in seedling tap roots. 24 isolates that 

represented the genetic diversity of samples collected were used 

to inoculate the tap root of four‐month‐old Boab seedlings. They 

were inoculated by using a sterile scalpel blade to make a small 

lateral incision along the middle of the carrot. Into which a 1 cm 2 

agar plug colonised with mycelium was inserted face up. This 

was then lightly wrapped with parafilm. There were 24 isolates 

plus controls (10 replicates of each). Tap roots from each 

replicate were placed in random order onto wooden racks inside 

plastic. The containers were then sealed with aluminium foil and 

tape and placed into a 25̊C room and left for 4–5 days. After four 

days lesion development in the tap roots were measured. The 

lesions presented as a rotted mass that could easily be scraped 

out of the tap root. The inoculated tap root was weighed, the 

lesion was scraped out and the carrot was re‐weighed 

immediately. The lesion length and width was also measured. 

Lesion development in young trees. 2–3 year old Boab trees 

were harvested in Kununurra from commercial Boab growers 

“Boabs in the Kimberlies.”. They were planted within 2 weeks of 

initial removal into one meter long PVC pipes in a potting 

medium of 1/3 coarse river sand and 2/3 potting mix and were 

watered twice a day for ten minutes by an automatic dripping 

system. Nine isolates were selected from the tap root trial. Boab 

stems were inoculated in the same manner as the roots. There 

were 5 replicates for each of the 9 isolates and also noninoculated 

controls. After 6 months trees were assessed for leaf 

cover and stems with lesions were harvested. The width, length 

and depth of lesions were measured using callipers and a ruler. 

The stems were cut in half at the centre of the initial mycelium 

plug insertion in order to determine the depth of lesion 

development. 

Figure 1. Mean length(cm) of lesions in 2–3 year old boab trees. 

Standard deviations are represented by the error bars. 

The results of the tree trial (Figure 1) confirm the results of the 

preliminary investigation, L. theobromae was found to be 

significantly more pathogenic then other species considered in 

the study. The lesions produced from inoculation of boab stems 

by L. theobromae resulted in the lesions lengths ranging from 3 

cm to 25cm (mean= 10.68cm). N. ribis and Neoscytalidium 

novaehollandia both exhibited similar lesion severity (means= 

3.46 cm and 3.54 cm respectively). 

This trial indicates the potential threat that L. theobromae 

presents to the iconic Boab trees. Recently a dying Boab in 

Broome was reported with similar disease symptoms those of 

dying Boabs in South Africa and similarly, L. theobromae was the 

only pathogen isolated from the cankers. As shown in this trial, 

endophytes such as L. theobromae are capable of causing 

disease and killing Boabs in Australia. 

REFERENCES 

1. Taylor, K., Barber, PA, Giles E. St J. Hardy and Burgess. TI (2009) 

Botryosphaeriaceae from tuart (Eucalyptus gomphocephala) 

woodland, including descriptions of four new species. Mycological 

Research 113: 337–353 

2. Pavlic D, Barber PA, Hardy GESJ, Slippers B, Wingfield MJ, Burgess 

TI, 2008. Seven new species of the Botryosphaeriaceae discovered 

on baobabs and other native trees in Western Australia. Mycologia. 

100: 851–866. 


Posters 

61 An emerging nematode pest on bananas? 

J.A. Cobon{ XE "Cobon, J.A." } A , and T. Pattison B 

A Queensland Primary Industries and Fisheries, 80 Meiers Rd, Indooroopilly, 4068, Queensland 

B Queensland Primary Industries and Fisheries, PO Box 20, South Johnstone, 4859, Queensland 

INTRODUCTION 

The focus of nematode control on bananas in Australia and 

worldwide has been on Radopholus similis (burrowing 

nematode) as the key nematode pest. International research and 

breeding programs have been active in managing and selecting 

cultivars for resistance to this nematode. However, recent 

surveys of African bananas have found Pratylenchus goodeyi P. 

coffee, Meloidogyne spp. and Helicotylenchus multicinctus as key 

nematode species. 

P. goodeyi (lesion nematodes) is considered to be indigenous to 

Africa where its distribution has been limited to the cooler 

highland growing areas including Central, Eastern and West 

Africa. It is considered that P. goodeyi has the potential to 

become an important pest of bananas where they are grown in 

cooler climatic zones of the Mediterranean and Middle Eastern 

countries. Bananas, as well as a number of other tropical crops, 

have been planted in the subtropical regions of South America, 

southern Africa, the Mediterranean basin, Australia and 

southern China. P. goodeyi has been recorded in the Canary 

Island, Crete and Egypt and Australia (1). However, it has 

recently also been found in warmer banana production areas of 

Africa (2). 

P. goodeyi can invade and feed in the root and corm tissue of 

banana plants. It causes similar symptoms and destruction as 

caused by R. similis including root lesions, stunted growth, 

reduced bunch weight and toppling of the bunching 

pseudostem. 

There is concern that the distribution of P. goodeyi may spread 

throughout subtropical banana production areas and it may also 

move into warmer, tropical production areas in Australia, 

following the recent experience in Africa. 


Root samples were submitted from several banana growing 

properties from northern NSW for the extraction of R. similis for 

molecular analysis. Roots were sliced open lengthwise and 

placed in a misting chamber for 5 days for the extraction of 

nematodes (3). Nematodes were caught by passing the washing 

from the mister over a 38 µm sieve. The washings were then 

examined under a compound microscope for the presence of 

nematodes and positive identifications made. For this accurate 

identification, nematodes were picked from solution using an 

eyelash and placed under higher magnification to further 

distinguish between R. similis and P. goodeyi. 

As P. goodyei was thought to have originated from the African 

highlands it is still unclear how this nematode arrived in 

Australia. However, with the number of sites with P. goodeyi 

increasing in NSW and the experience in Africa of P. goodeyi 

moving into the hotter production areas, the Australian banana 

industry needs to be aware of the distribution of these 

nematodes to avoid a repeat of the African experience. 

The movement of infested planting material and soil could 

increase the spread of P. goodeyi to additional banana growing 

areas within Australia, therefore, growers need to adhere to the 

clean planting material policy and be aware of the possibility of 

spread with infested soil and machinery. 

Accurate identification of the nematode species is essential to 

develop management options such as crop rotation and use of 

resistant cultivars. Surveys need to be undertaken to establish 

the spread of this nematode, as well as resistance screening of 

rotation crops and of new banana cultivars. 


Funding for this work was provided by Queensland Primary 

Industries and Fisheries. 

REFERENCES 

1. Bridge, J., Fogain, R., Speijer, (1997) (1981) The root Lesion 

Nematodes of Banana. Musa pest fact sheet No 2. 

2. Coyne, D. & L. Waeyenberge (2008) Plant‐parasitic Nematodes 

Affecting Banana and Plantain in Africa: A Shifting Focus? 

Proceedings of the 5th International Congress of Nematology, 

Brisbane, Australia. pp 64 

3. Hooper, D. J. (1986) Extraction of nematodes from plant material. 

IN SOUTHEY, J. F. (Ed.) Laboratory methods for work with Plant and 

Soil Nematodes. London, Her Majesty's Stationary Office.51–58 

4. Moody, E. H., Lownsbery, B. F. & Ahmed, J. M. (1973) Culture of the 

Root‐Lesion nematode Pratylenchus vulnus on Carrot Disks. Journal 

of Nematology. 5, 225–226. 

Single mature female nematodes of both R. similis and P. 

goodeyi were placed on a sterile carrot (Daucus carota) disc in 

order to initiate a single genotype isolate (4) for further 

experimental work. 


The root samples from these farms were found with a high 

incidence of P. goodeyi. Furthermore, some farms had 

exclusively P. goodeyi, and not R. similis as was believed. This 

suggested that P. goodeyi may be increasing in numbers and 

importance within banana plantations of NSW and south‐east 

Queensland. 


4 A sensitive PCR test for detecting the potato cyst nematode (Globodera 

rostochiensis) in large volume soil samples 

Posters 

S.J. Collins{ XE "Collins, S.J." } A , X.H. Zhang A , G.I. Dwyer A , J.M. Marshall B and V.A.Vanstone A 

A 

Department of Agriculture and Food Western Australia, South Perth, 6151, Western Australia 

B JM Advisory NZ Ltd, Christchurch, 8052, New Zealand 

INTRODUCTION 

Potato cyst nematode (PCN) Globodera rostochiensis, a 

devastating plant pathogen worldwide, impacts potato 

production and affects market access. PCN was detected 

between 1986 and 1989 on six properties (a total of 15ha) in the 

metropolitan area of Perth, Western Australia (WA). A strict 

quarantine and eradication program was immediately 

implemented, and no PCN has been detected anywhere in the 

state since. With almost 20 years since the last detection, WA is 

now in an excellent position to re‐claim Area Freedom from PCN. 

We are developing a sensitive PCR test to enable 

presence/absence of PCN to be determined directly from large 

soil samples for confirmation of Area Freedom for the state. PCR 

offers an alternative to traditional microscopic detection of PCN, 

which is time‐consuming and prone to operator error, 

particularly if cysts are present in low numbers. 


Field survey. Proving a ‘negative’ is always a challenge. With this 

in mind, survey methods were tailored to generate data to show 

with the highest possible confidence that PCN no longer occurs 

in WA. At all survey sites, 50g soil samples to a depth of 15 cm 

were collected on a 5 x 5 m grid pattern across entire fields. This 

resulted in collection of approx. 20 kg/ha, all of which was 

processed (without sub‐sampling) by the Fenwick method for 

total organic matter extraction. This sampling regime is far more 

intensive than any standard worldwide. All organic matter 

samples will be assessed using the PCR test under development. 

PCR test. There are numerous technical challenges when 

amplifying DNA extracted directly from soil (e.g. incomplete 

cyst/egg lysis, DNA adsorption to soil, co‐purification of PCR 

inhibitors, and degradation of target DNA). To reduce inputs, it is 

necessary to develop methods that maximise sample area per 

test without compromising assay integrity. PCR analysis of soil 

has usually been done with samples of only 1 to 15g. In contrast, 

we are developing a novel strategy to test 20kg pooled soil 

samples (each representing assessment of 1ha sampled on a 5 x 

5m grid) for presence/absence of PCN. 

Due to quarantine against the use of PCN, we are developing 

methodologies using Cereal Cyst Nematode, Heterodera avenae 

(CCN). The goal is to develop the technology for routine 

detection of 10 cysts in a 20kg soil sample. Once optimised, 

detection methodologies will be validated in blind studies using 

PCN‐infested soil in New Zealand. 


Results are encouraging, with as little as 1 CCN cyst detected in 

20kg of soil (Fig. 1). Since the average PCN cyst contains approx. 

400 eggs, this is equivalent to detection of approx. 0.02 eggs/g 

soil which is a detection level that could identify extremely low 

levels of infestation. 

—Lanes: —1 — —2 — — 3 — — 4 — — 5 — — 6 — –— 7 —– — 8—–—9 

Figure 1. PCR results from samples with 1‐200 CCN cysts. Lane 1: 1 cyst; 

Lane 2: 5 cysts; Lane 3: 10 cysts; Lane 4: 20 cysts; Lane 5, 50 cysts; Lane 

6: 100 cysts; Lane 7: 200 cysts; Lane 8: blank; Lane 9: H 2 O. 

Although we have been able to detect only 1 CCN cyst in 20kg of 

soil, reliability of the test is more consistent for 10 cysts/20kg of 

soil (Fig. 2). This represents detection of approx. 0.2 eggs/g soil, 

which is far below national and international standards. 

——Lanes— —1—— 2— —3— — 4 — — 5— — 6— — 7 — 8 —— 9—— 10 

Figure 2. PCR results using target DNA extracted from samples with 10 

CCN cysts. Lanes 1–4: 5uL target DNA; Lanes 5–8: 10uL target DNA; Lane 

9: +ve control; Lane 10: H 2 O. 

Currently, the test is being refined to eliminate the effects of 

contaminants and inhibitors in the soil. Ways to increase 

reliability of the PCR test in different soil types are also being 

assessed. For example (Fig. 3), results from a pilot trial have 

shown that detection of CCN DNA from Albany soil (Humic 

Podzols) was more reliable than from Busselton soil (Jindong 

Sandy Loam). 

— Lanes: — 1— 2— 3— 4— 5— 6— 7— 8— 9— 10 —11 —12 —13 —14 

Figure 3. PCR results using 5ul of target DNA extracted from 10 CCN cysts 

in two different soil types (Albany and Busselton). Lanes 1 and 2: ‐ve 

control for Albany soil; Lanes 3–6: Albany soil; Lanes 7 and 8: ‐ve control 

for Busselton soil; Lanes 9–12: Busselton soil; Lane 13: +ve control; Lane 

14: H 2 O. 

Once optimised, this test could have potential application for 

detection of other pests and pathogens that can be found in soil 

organic matter. 


Horticulture Australia Ltd and the Potato Growers’ Association 

WA provide funding. WA growers allowed us to sample fields. 

Larry Hegarty (Potato Marketing Corporation) supplied planting, 

harvest data and maps. Dyane Jardine and Ali Bhatti provided 

field and lab technical support. Peter Philippe (WA Quarantine 

Inspection Service) allowed access to historical PCN sampling 

data. 


Posters 

62 Phellinus noxius: brown root rot is increasing in importance in the Australian 

avocado industry 

E.K. Dann{ XE "Dann, E.K." }, L.A. Smith, M.L. Grose, G.S. Pegg and K.G. Pegg 

Queensland Primary Industries and Fisheries, Department of Employment, Economic Development and Innovation, 80 Meiers Rd, 

Indooroopilly, QLD 4068 

INTRODUCTION 

Phellinus noxius is an indigenous wood decay basidiomycete, 

common in tropical and subtropical rainforests of eastern 

Australia, Asia, the Pacific, central America and Africa. Phellinus 

noxius causes root and lower stem rot (“brown root rot”) disease 

of native and introduced trees planted on former rainforest 

sites. Overseas, it has caused significant losses through tree 

deaths in hosts such as rubber, mahogany, teak, cocoa, longan, 

litchi, pear, persimmon and Acacia mangium (widespread 

plantings in south east Asia for pulpwood). 

Infection takes place when roots contact infested woody matter 

present in the soil, and thus spread is most likely via root‐root 

contact. Trees can suffer a rapid decline, and foliage may 

transform from green and healthy to wilted and dead within a 

few weeks (Plate 1). Decline in older trees can be more gradual, 

with some mature infected trees surviving for many years. One 

key diagnostic feature is the presence of a thick brown mycelial 

matt with a white actively growing margin that melanises with 

age, which can be found growing on the root and stem surfaces 

(Plate 2). Fruiting bodies, although uncommon, occur in two 

forms. The resupinate form is seen on the underside of fallen 

logs, and between buttress roots of Ficus spp., and the bracket 

form is more often seen on dead trees in higher rainfall areas 

such as northern Queensland. 


Several orchards across the Atherton Tablelands and 

Childers/Bundaberg production regions, representing areas of 

approximately 650 and 300 km 2 , respectively, were visited. 

Selected additional properties in other areas of SE QLD or 

northern NSW were also visited. Samples from actively growing 

infection stockings were collected and plated onto malt extract 

agar containing 1%w/v streptomycin and 1ppm benomyl. 

Cultures were identified by morphological features of the 

hyphae. 

RESULTS 

P. noxius was confirmed on 17 out of 18 properties visited on the 

Atherton Tablelands, including in mango at 2 sites. It was also 

confirmed from 3 (and suspected on a further 2) orchards in the 

Childers/Bundaberg area, where 2 properties visited were 

apparently free of the disease. It has been confirmed on one 

orchard at Maleny and 2 orchards in northern NSW. Losses were 

particularly severe (approx. 10% tree death in affected blocks) in 

at least 4 orchards visited, and attempts to replant in infested 

soil failed. To date, no fruiting bodies have been found on 

avocado. 

The disease leads to significant losses in hoop pine plantations in 

Queensland, and in broadleaf hosts (eg. Ficus spp.) in urban 

parks and gardens (2). Death of avocado trees successively down 

rows was first noted on the Atherton Tablelands in QLD in 2001. 

The first positive identification of P. noxius causing tree death in 

avocado occurred in 2002 from the Maleny district of the 

Sunshine Coast hinterland in Queensland. 

This paper reports on a scoping study undertaken to assess the 

spread and severity of brown root rot in major avocado growing 

areas of north eastern Australia. 

Plate 2. The characteristic infection “stocking” at the base of avocado 

trunk 

DISCUSSION 

Effective management relies on complete removal of dead and 

dying trees and their roots, and one apparently healthy tree on 

either side. Root barriers can then be installed to prevent roots 

from uninfected trees coming into contact with infected debris 

in soil. There is currently no effective chemical control. 


We acknowledge M. Weinert (QPIF, Mareeba) and E. Dunn (Crop 

Tech, Bundaberg), for assistance in organising the orchard visits 

and numerous avocado growers for their cooperation and 

access. The project is funded by Avocados Australia Ltd. and HAL. 

Plate 1. Quick decline of an avocado tree, laden with fruit. 

REFERENCES 

1. Bolland L (1984) Phellinus noxius: cause of a significant root‐rot in 

Queensland hoop pine plantations. Australian Forestry 47:2–10. 

2. Hood I (2003) “An introduction to fungi on wood in Queensland” 

pp. 312–315. (University of New England: Armidale) 


5 Management strategies to economically control blackspot and maximise yield in 

new improved field pea cultivars 

Posters 

J.A. Davidson{ XE "Davidson, J.A." } A , L. McMurray B and M. Lines B 

A South Australian Research and Development Institute (SARDI), GPO Box 397, Adelaide, 5001, SA 

B South Australian Research and Development Institute (SARDI), GPO Box 822, Clare, 5453, SA 

INTRODUCTION 

Field pea production in South Australia has remained constant at 

approximately 120,000 ha since the mid 1990s, although 

plantings have increased in medium to low rainfall areas. 

Blackspot, caused by a complex of fungi i.e. Mycosphaerella 

pinodes, Phoma medicaginis var. pinodella, Ascochyta pisi and 

Phoma koolunga (1), is the most common disease in field peas. 

Research on blackspot in the 1990s, based in traditional areas 

and on traditional late‐maturing trailing type peas i.e. cv. Alma, 

found that foliar fungicides were uneconomic but delaying 

sowing minimised blackspot infection from airborne spores. 

Delayed sowing is still a major recommendation for the pea 

industry across South Australia (2). Given the expansion into low 

rainfall areas and increasing frequency of low rainfall seasons, 

the potential yield loss through delayed sowing is often now 

greater than the loss from blackspot. Furthermore, fungicide 

costs have reduced and this practice may now be economic in 

some environments. The pea industry has also adopted higher 

yielding cultivars including early maturing erect semi‐leafless 

types i.e. cv. Kaspa. Agronomic trials were conducted in 2007 

and 2008 to identify economic strategies to control blackspot in 

new improved pea cultivars, and to identify optimum sowing 

dates in low to medium rainfall areas for these cultivars. 


Trials were sown at three sites each season, viz. high rainfall 

(450mm per annum) at Kingsford in 2007 and Turretfield in 

2008; medium rainfall (400mm per annum) at Hart in both 

seasons; low rainfall (325 mm per annum) at Minnipa in both 

seasons. The high and medium rainfall sites had three sowing 

times and the low rainfall site had two sowing times. First sowing 

occurred within a week of the break of the season (first week of 

May) at each site and subsequent sowing times were at intervals 

of three weeks. Trials were split plot design, with time of sowing 

as the main block, with three replicates. Cultivars included the 

conventional trailing types Alma and cv. Parafield (the latter at 

Minnipa only), and the new erect semi‐leafless types including 

the current commercial cultivar Kaspa and advanced breeding 

lines WAPEA2211 and OZP0602 (the latter in 2008 only). 

Fungicide treatments were the seed treatment P‐Pickel T ® 

(thiram plus thiabendazole, 200 ml/100kg seed), a foliar 

application of mancozeb (2 kg/ha) at 9 node growth stage, foliar 

applications of mancozeb at 9 nodes plus early flowering growth 

stage, P‐Pickel T ® seed dressing plus a foliar application of 

mancozeb at 9 nodes, foliar applications of chlorothalonil (2 

L/ha) every fortnight (i.e. disease control) and an untreated 

control. Disease was assessed regularly, 2 or 3 weeks apart, 

throughout the growing season, and recorded as % leaf area 

diseased (%LAD) in the early stages of the epidemic, or as % of 

nodes infected (%ND) in the later stages of the epidemic. Plot 

yields were recorded as tonnes per hectare. Significant 

differences identified by analyses of variance were separated on 

P

Posters 

63 Dispersal potential of Gibberella zeae ascospores 

P.A.B. Davies{ XE "Davies, P.A.B." } A , L.W. Burgess B , R. Trethowan A , R. Tokachichu A , D. Guest B 

A 

Plant Breeding Institute, University of Sydney, PMB 11, Camden, NSW, 2750 

B 

Faculty of Agriculture, Food and Natural Resources, University of Sydney, NSW, 2006 

INTRODUCTION 

Fusarium head blight (FHB) of wheat, caused by the fungus 

Gibberella zeae (anamorph Fusarium graminearum) is a disease 

that occurs sporadically in the Liverpool Plains region of 

Northern NSW. The fungus is also a pathogen of maize, causing 

Gibberella stalk and ear rots, and an asymptomatic endophyte of 

sorghum. The pathogen survives in the residues of these hosts, 

and in spring and autumn, perithecia form on these residues and 

forcibly discharge ascospores into the air (1). 

spores away from the source of inoculum closely fitted an 

exponential curve (R 2 =0.97) (Figure 1). 

The potential for long distance dispersal of these ascospores has 

been examined in North America (1, 2, 3), where spores have 

been recovered at least 3km from the nearest inoculum source 

and at 60m above the earth’s surface (2). This suggests that 

where there is a significant regional source of inoculum, 

localised control of infested residue through rotation or tillage 

practices may not effectively reduce the risk of FHB in individual 

fields (1). 

While inoculum levels and potential for dispersal are 

traditionally greater in North America compared to Australia, 

due to more favourable climatic conditions and the greater 

presence of maize within the farming system, evidence to 

support longer distance dispersal has been observed in the 

Liverpool Plains during 2005, when wheat crops free of inoculum 

had moderate levels of FHB. 

To determine the potential for long distance dispersal of 

ascospores under Australian conditions, a spore trapping 

experiment was established during October, 2008. 


A centre pivot irrigation field (80ha) in Spring Ridge (latitude 31° 

31'2.1''S longitude 150°14'6.3''E) was identified as a source of 

inoculum due to significant amounts of G. zeae perithecia on 6 

month old maize residue and high levels of FHB and perithecia 

on a cv. Beaufort wheat crop. 

Spore traps, standing 1m in height were placed at 50m intervals 

in a north easterly direction into a field 12 months fallow from 

Chickpeas, to a distance of 250m from the inoculum. Traps were 

also placed at 50m intervals into the wheat crop to a distance of 

250m into the crop. Traps consisted of four 90mm petri dishes 

containing Fusarium‐selective medium with increased rates of 

antibiotics, exposed to the atmosphere from sunset to sunrise 

the following morning. Exposure of the plates was timed to 

follow an irrigation event to the wheat crop of equivalent to 

15mm of rainfall 24 hours prior. 

Plates were recovered and incubated for 3 days under 

alternating light and dark conditions with temperatures at 24°C 

and 22°C respectively. A random subset of the colonises were 

subcultured from each plate and identified morphologically. 

Spore counts were taken from each plate and used to determine 

the number of G. zeae ascospores intercepted. 

RESULTS 

Ascospores of G. zeae were recovered at all locations and ranged 

from 90 cfu per plate at 250m from the inoculum source to 750 

cfu per plate within the wheat crop. The pattern of dispersal of 

Figure 1. G. zeae ascospore deposition away from inoculum source. The 

pattern of deposition closely follows the exponential curve y = 1.52 + 

56.99 x 0.99 x R 2 = 0.97 

DISCUSSION 

The pattern of ascospore dispersal agrees with previous reports 

of the incidence of disease away from an inoculum source being 

described by an exponential model (3). The results also suggest 

that recovery of spores at distances greater than 250m is likely. 

Extrapolation of the model to 500m suggests that 4000 

spores/m 2 would be deposited nightly. Whether this level of 

deposition is sufficient to initiate disease however is yet to be 

established. 

This experiment demonstrated that spore release events can be 

triggered by overhead irrigation events. The timing of irrigation 

events on wheat crops following maize should attempt to avoid 

irrigating during anthesis, at which wheat is susceptible to 

infection. Residue management may also be necessary to reduce 

the risk of FHB in such situations. 


The research was completed with the assistance of a GRDC 

Grains Research Scholarship. 

REFERENCES 

1. Schmale, D.G., III, E.J. Shields, and G.C. Bergstrom, Nighttime 

spore deposition of the fusarium head blight pathogen, 

Gibberella zeae, in rotational wheat fields. Canadian Journal 

of Plant Pathology, 2006. 28(1). 

2. Maldonado‐Ramirez, S.L., et al., The relative abundance of 

viable spores of Gibberella zeae in the planetary boundary 

layer suggests the role of long‐distance transport in regional 

epidemics of Fusarium head blight. Agricultural and Forest 

Meteorology, 2005. 132(1/2): p. 20–27. 

3. Paulitz, T.C., et al., A generalized two‐dimensional Gaussian 

model of disease foci of head blight of wheat caused by 

Gibberella zeae. Phytopathology, 1999. 89(1): p. 74–83. 


25 Effect of avocado crop load on postharvest anthracnose and stem end rot, and 

cations and phenolic acid levels in peel 

Posters 

E.K. Dann, L.M. Coates, J.R. Dean{ XE "Dean, J.R." }, L.A. Smith, A.W. Cooke and K.G. Pegg 

Queensland Primary Industries and Fisheries, Department of Employment, Economic Development and Innovation, 80 Meiers Rd, 

Indooroopilly, QLD 4068 

INTRODUCTION 

Crop load (or tree yield), rootstock and mineral nutrition in the 

flesh can influence quality of ‘Hass’ avocado fruit in terms of 

anthracnose and internal flesh disorders (1,2). While fruit from 

higher yielding trees are often smaller, they have been reported 

to have less anthracnose (Colletotrichum gloeosporioides) and 

higher Ca (2). Ca is thought to strengthen cell walls making them 

more resistant to fungal pectolytic enzymes. The balance 

between N and Ca is also critical as excessive nitrogenous 

fertiliser can result in increased photosynthetic activity in leaves, 

outcompeting the developing fruit for water and Ca. 

Phenolic compounds are abundant in plants and have important 

roles as/in cellular support materials, eg. lignins, detoxification, 

components of flower and fruit colour (eg. anthocyanins), 

protection against herbivore predators, signal molecules, and as 

phytoalexins. Thus, they contribute to disease resistance 

mechanisms of plants. 

We investigated the effect of crop load on anthracnose and stem 

end rot (caused primarily by Botryosphaeria spp. but also C. 

gloeosporioides) postharvest diseases in ‘Hass’ avocado in two 

field seasons, and measured cation concentrations (particularly 

Ca and N) and total soluble phenolic acid levels in peel to 

determine associations with disease levels. 


“Hass” avocado fruit was harvested from trees in commercial 

orchards in northern NSW determined to have ‘high’ or ‘low’ 

crop loads, in 2007 and 2008. Peel samples were collected from 

sub‐samples for cation analyses, and at harvest, ‘sprung’ (when 

fruit first start to soften) and ‘eating ripe’ for total soluble 

phenolic acid contents. Other fruit samples were maintained in a 

controlled environment room (22–23°C, 65% RH), and assessed 

at eating ripe stage for anthracnose and stem end rot diseases. 

Dried peel samples were finely ground and analysed for major 

cations by SGS Agritech. Phenolic acid contents were determined 

by using the Folin‐Ciocalteau reagent on samples extracted with 

50% v/v methanol, and compared against a gallic acid standard 

curve. 


In both years, the incidence of fruit with anthracnose disease 

was significantly less when harvested from trees with high crop 

loads (Table 1). Severity of disease was also less, but not 

significantly. Conversely, stem end rot, caused primarily by 

Botryosphaeria spp., was more severe in fruit from high crop 

bearing trees (significant in 2008, Table 2). The trees were 

drought stressed, which is thought to exacerbate stem end rot 

diseases in mango and avocado, and the greater crop load most 

likely added to this stress. There was a higher percentage of 

marketable fruit from high crop load trees (data not shown). 

Table 1. Severity and incidence of anthracnose in “Hass” fruit from high 

and low crop bearing trees in 2007 and 2008 

Crop load 

% severity 

anthracnose 

% incidence anthracnose 

2007 2008 2007 2008 

High 11.1 34.2 27.1 b 78.8 b 

Low 19.5 53.6 50.3 a 90.0 a 

Table 2. Severity and incidence of stem end rot in “Hass” fruit from high 

and low crop bearing trees in 2007 and 2008 

% severity 

stem end rot 

% incidence 

stem end rot 

Crop load 2007 2008 2007 2008 

High 10.5 3.83 a 33.5 16.5 

Low 4.8 1.42 b 27.7 8.8 

Cation analyses show that peel from fruit harvested in 2008 from 

high crop load trees had significantly higher calcium, lower N:Ca 

ratio, and higher Ca+Mg:K ratio than from fruit from low crop 

load trees. This is consistent with what was previously known, ie. 

that high Ca and low N is associated with better quality fruit (2). 

Table 3. Effect of crop load on major cations and their ratios in ‘Hass’ 

avocado peel at harvest, 2008 

Crop Content (% dry wt of fruit peel) N:Ca Ca+Mg:K 

load N Ca Mg K ratio ratio 

High 0.792 0.036 a 0.082 1.078 22.3 b 0.110 a 

Low 0.868 0.028 b 0.078 1.232 31.8 a 0.087 b 

The results for soluble phenolics in these trials did not indicate 

that they were influenced by crop load, and no clear associations 

can be made between severity and incidence of postharvest 

disease and total soluble phenolic acid content. There was, 

however, a clear association between phenolics and disease 

reaction and rootstock type in another study (unpublished). 

Fruit quality can thus be improved by optimising tree yield and 

nutrient concentrations, and reducing drought stress. 

REFERENCES 

1. Willingham SL, Pegg KG, Cooke AW, Coates LM, Langdon PWB, 

Dean JR (2001) Rootstock influences postharvest anthracnose 

development in ‘Hass’ avocado. Australian Journal of Agricultural 

Research 52: 1017–1022. 

2. Hofman PJ, Vuthapanich S, Whiley AW, Klieber A, Simons D (2002) 

Tree yield and fruit minerals concentrations influence ‘Hass’ 

avocado fruit quality Scientia Horticulturae 92:113–123. 


Posters 

64 Hosts of citrus scab, brown spot and black spot in coastal NSW 

N.J. Donovan{ XE "Donovan, N.J." } A , P. Barkley B and S. Hardy C 

A NSW Department of Primary Industries, PMB 8, Camden, 2570, NSW 

B Citrus Australia Ltd, PO Box 46, Mulgoa, 2745, NSW 

c NSW DPI, Locked Bag 26, Gosford, 2250, NSW 

INTRODUCTION 

Characterisation of endemic pathogens, including knowledge of 

host range and pathotyping, is important for disease control 

programs and trade negotiations. 

Citrus scab is a serious leaf and fruit disease of lemons in coastal 

areas of NSW and Qld. Previous studies have reported six Elsinoë 

fawcettii pathotypes on citrus worldwide (1, 2). In Australia, the 

Tryon’s and “Lemon” pathotypes have been described (1) but 

the pathotype range may not have been well‐represented as all 

of the isolates studied were from one lemon producing area of 

NSW. 

Citrus brown spot (Alternaria alternata) affects fruit and foliage 

of mandarins, tangelos and tangors in the humid coastal regions 

of Australia and is rarely found on grapefruit. In Florida, isolates 

sampled from grapefruit and the hybrid cv. Nova were 

genetically distinct from isolates sampled from other hybrid 

cultivars including Minneola tangelo and Murcott tangor (3). 

Citrus black spot (Guignardia citricarpa) is a serious disease of 

Valencia and navel oranges in coastal areas of eastern Australia. 

A non‐pathogenic species G. mangiferae has a wider host range 

which includes citrus. 

The aim of this study was to observe the incidence of scab, 

brown and black spots in an old citrus germplasm collection 

containing some rare species. The trees had not been sprayed 

for several years. By expanding the host varieties observed 

additional pathotypes may be found. 


Surveys were conducted in 1999 and 2009 in a citrus arboretum 

at NSW DPI’s Gosford Horticultural Institute. Symptoms on fruit 

and foliage were recorded for scab, black spot and brown spot. 

Further work will be conducted to characterise and identify 

pathotypes. 


Survey findings are presented in Table 1. Citrus scab was not 

observed on Satsuma mandarin, in contrast to overseas studies 

(2). Wotton rough lemon was the only rough lemon clone not to 

show symptoms of scab. Leaves of this clone are typical of rough 

lemon, but the fruits are acharacteristic, suggesting that it is a 

hybrid. 

The surveys found no evidence of brown spot affecting 

grapefruit, even though symptoms have been seen on a red 

grapefruit tree in Qld adjacent to badly affected Minneola 

tangelo trees. 

Sour orange is reportedly not susceptible to black spot, but one 

clone of smooth seville (a sour orange hybrid) in the arboretum 

showed symptoms. Lemons are often a preferred host of G. 

citricarpa with infections in new regions often occurring first on 

lemons. Infection was severe on the foliage of a number of 

lemon varieties and hybrids and on the rootstocks Troyer 

citrange and Swingle citrumelo, but not on C. trifoliata. All 

species/clones except C. trifoliata showed melanose (Diaporthe 

citri) symptoms to varying degrees including the native finger 

lime C. australasica. 

REFERENCES 

1. Timmer LW, Priest M, Broadbent P, Tan MK (1996) Morphological 

and pathological characterisation of species of Elsinoë causing scab 

diseases of citrus. Phytopathology 86, 1032‐1038 

2. Hyun JW, Yi SH, MacKenzie SJ, Timmer LW, Kim KS, Kang SK, Kwon 

HM, Lim HC (2009) Pathotypes and genetic relationship of 

worldwide collections of Elsinoë spp. causing scab diseases of 

citrus. Phytopathology 99,721‐728 

3. Peever TL, Olsen L, Ibanez A, Timmer LW (2000) Genetic 

differentiation and host specificity among populations of Alternaria 

spp. causing brown spot of grapefruit and tangerine x grapefruit 

hybrids in Florida. Phytopathology 90, 407‐414 

Table 1. Survey findings for scab and other fungal pathogens in the citrus arboretum, Narara NSW 

Citrus species 1 

Common name 

Varieties with scab symptoms 

observed 

Varieties with brown spot 

symptoms 

Varieties with black spot 

symptoms 

C. reticulata Blanco mandarin tangerine ex China Shekwasha, Szinkom, Ladu, Cleopatra, Batanges 

Cleopatra, Batanges, Emperor, 

Sunki, Satsuma 

C. x microcarpa Bunge calamondin calamondin 

C. × insitorum Mabb citrange Troyer citrange, Swingle 

citrumelo 

C. × aurantium L. 

(= C. aurantium L. and 

C. sinensis (L.) Osbeck) 

sour, sweet, Valencia 

and navel oranges, 

grapefruit & King 

orange 

Taiwanica 

tangelo (Sampson, Minneola, 

Orlando, Yalaha, San Jacinto, 

Wekiwa, Seminole, Thornton, 

Sexton) 

smooth Seville (Waddell), 

San Jacinto tangelo, Shunkokan 

C. × limon (L.) Osbeck lemon lemon (Volkamer, Lisbon, 

Eureka, Lemonade, Yen Ben, 

Villafranca, Thornless, Meyer, 

Assam), Rangpur lime 

C. × taitensis Risso 

rough lemon 

rough lemon (Settree, Wilson, 

(= × jambhiri Lush.) 

Narara) 

C. × aurantiifolia (Christm.) lime 

lime (West Indian, Kusiae, acid, 

Swingle 

accession 3233) 

C. × indica Tanaka Indian wild orange Indian wild orange 

1. Classification is according to Mabberley DJ (1997) A classification for edible citrus. Telopea 7, 167‐72o 


Narara, Wotton) 

Kusaie lime 

lemon (Volkamer, Lisbon, 

Eureka, Lemonade, Yen Ben, 

Villafranca, Thornless, Meyer), 

Rangpur lime 


Wotton) 


65 Nitrogen form affects Spongospora subterranea infection of potato roots 

Richard E. Falloon{ XE "Falloon, R.E." } A,B , Denis Curtin A , Ros A. Lister A , Ruth C. Butler A , Catherine L. Scott A and Nigel S. Crump C 

A New Zealand Institute for Plant and Food Research Limited, PB 4704, Christchurch, New Zealand 

B Bio‐Protection Research Centre, PO Box 84, Lincoln University, Canterbury, New Zealand 

C DPI Victoria, Knoxfield Centre, Private Bag 15, Ferntree Gully Delivery Centre, Victoria 3156, Australia 

Posters 

INTRODUCTION 

Powdery scab of potato tubers (Solanum tuberosum) is caused 

by the plasmodiophorid pathogen Spongospora subterranea f. 

sp. subterranea. The disease is important where potatoes are 

grown under intensive management, as it causes severe 

reductions in quality of seed and ware potatoes from affected 

crops (1). The pathogen can also infect potato roots, causing 

root galls and reducing plant growth (1). Manipulation of soil 

nutrients could be part of integrated powdery scab 

management. Nitrogen (N)‐containing amendments have been 

shown to reduce (2) and increase (3) powdery scab in fieldgrown 

potatoes. 

We present results from an experiment that aimed to determine 

effects of different rates and types (nitrate or ammonium) of N 

compounds on infection of potato plant roots by S. subterranea. 


The experiment was carried out in a glasshouse compartment 

(17ºC ± 2ºC; 16 h light, 8 h dark). Tissue‐cultured potato 

plantlets (cv. Iwa; very susceptible to powdery scab) were 

planted into a 50:50 w:w mix of field soil and coarse sand (>1 

mm) in plastic pots (11 cm diam., 680 ml capacity). The soil in 

each pot was irrigated with deionised water (by weight) to 90% 

water holding capacity three times each week for 8 weeks. 

Two weeks after planting, treatments of three N compounds 

(ammonium nitrate (NH 4 NO 3 ), ammonium sulphate ((NH 4 ) 2 SO 4 ), 

calcium nitrate (CaNO 3 ) 2 .4H 2 O)) were each applied to separate 

pots as solutions at five different rates, calculated to apply 

equivalent amounts of N. The rates were 0.05, 0.10, 0.20, 0.40, 

or 0.60 g N pot ‐1 , equivalent to 62.5, 125, 250, 500 and 750 kg N 

ha ‐1 . At the same time the pots were each inoculated with 

suspensions of S. subterranea sporosori (30,000 pot ‐1 ). Two 

control treatments of no added N with or without inoculum 

were also applied. The experiment included 17 treatments 

(three N compounds, five rates of each, plus two controls), and 

was of randomised complete block design with seven replicates. 

The plants were harvested 8 weeks after planting. Each plant 

was carefully washed free of soil, the number of S. subterranea 

root galls was counted and root dry weight (10 h at 70ºC) 

determined. Data were transformed (square root) to stabilise 

variances and analysed with ANOVA. 


Fig. 1 summarises data of severity of S. subterranea galling on 

the roots of harvested plants. No galls were observed on 

uninoculated plants, while plants from the nil N inoculated 

treatment had a mean of 80.5 galls g ‐1 root. All of the N 

treatments reduced root galling. Increasing rates of N for both 

ammonium sulphate and ammonium nitrate gave decreasing 

numbers of root galls. For calcium nitrate, however, increasing 

rate had little effect on root galling. At the three lowest rates in 

N, of the three N‐containing compounds, ammonium sulphate 

gave the greatest reduction in root galling. 

These results indicate that ammonium‐N is more inhibitory to S. 

subterranea infection of potato roots than nitrate‐N. They also 

suggest that increased powdery scab in the field after addition of 

high rates of N fertiliser (3) were unlikely to be due to direct 

effects of N on the pathogen, but may have been caused by 

indirect host growth effects (e.g. increased root mass resulting in 

increased amounts of zoospore inoculum). 

Mean galls per g root dry weight 

80 

50 

20 

10 

0 

0.00 0.05 0.10 0.20 0.40 0.60 

N (g pot -1 ) 

Inoculated Control 

Uninoculated Control 

NH 4 NO3 

(NH 4 )2SO4 

Ca(NO 3 )2 

Figure 1. Mean numbers of Spongospora subterranea root galls on 

potato plants grown in pots treated with different amounts of N‐ 

containing compounds. Bar = LSD (P=0.05) for visual comparison of the 

means (square root transformed scale). 

Ammonium‐N is usually converted to nitrate by soil microorganisms 

soon after application (4). It is likely, therefore, that 

the inhibitory effect of ammonium on S. subterranea occurred 

during early host infection stages, possibly affecting zoospore 

release from sporosori and/or infection of host roots. 

These results suggest that ammonium‐N may usefully reduce S. 

subterranea infection of potato. This should be confirmed in 

field evaluations in crops of potatoes grown in soil naturally 

infested with the pathogen. 


The NZ Foundation for Research, Science and Technology and 

HAL (through the Australian Processing Potato Research 

Programme) funded this research. 

REFERENCES 

1. Merz U, Falloon RE (2009) Review: powdery scab of potato— 

increased knowledge of pathogen biology and disease 

epidemiology for effective disease management. Potato Research 

52: 17–37. 

2. Falloon RE (2008) Control of powdery scab of potato; towards 

integrated disease management. American Journal of Potato 

Research 85: 253–260. 

3. Falloon RE et al. (2007) Nitrogen fertiliser increases powdery scab 

incidence and severity; work in progress. 2nd European Powdery 

Scab Workshop, Langnau, Switzerland, 29–31 Aug, 2007. 

www.spongospora.ethz.ch/EUworkshop07/index.htm 

5. Haynes RJ, Williams PH (1992) Changes in soil solution composition 

and pH in urine‐affected areas of pasture. Journal of Soil Science 

43: 323–334. 


Posters 

66 Relationships between Spongospora subterranea DNA in field soil and powdery 

scab in harvested potatoes 

Farhat A. Shah A , Richard E. Falloon{ XE "Falloon, R.E." } A,B , Ros A. Lister A , Ruth C. Butler A , Alan McKay C , Kathy Ophel‐Keller C and Ikram 

Khan A 

A New Zealand Institute for Plant and Food Research, PB 4704, Christchurch, New Zealand 

B Bio‐Protection Research Centre, PO Box 84, Lincoln University, Canterbury, New Zealand 

C South Australian Research and Development Institute, GPO Box 397, Adelaide 5001, South Australia 

INTRODUCTION 

Powdery scab (caused by Spongospora subterranea f. sp. 

subterranea) is an important disease of potato (Solanum 

tuberosum). This disease is difficult to control, partly because S. 

subterranea can survive in soil for many years (1). Molecular 

detection and quantification of the pathogen in soil are possible 

components of disease management, to indicate pre‐planting S. 

subterranea inoculum levels and powdery scab risk (1). 

per ha.). In this study, where large pre‐planting quantities of S. 

subterranea DNA occurred in soil, DNA quantification did not 

accurately predict incidence or severity of powdery scab in 

harvested tubers. 

100 

90 

A 

We measured S. subterranea DNA levels in soil from a naturally 

infested field at planting and powdery scab in subsequently 

harvested tubers, over two growing seasons. Relationships 

between pre‐planting soil DNA and disease on harvested tubers 

were examined. 


The field area (0.36 ha) for this study had been previously used 

as a trial during the 2006/07 growing season. Twelve treatments 

(two cropping histories, three nitrogen fertiliser application 

rates, two irrigation regimes) were applied to potatoes grown in 

96 plots, each 5 × 5 m. The trial was of split split plot design with 

eight replicates (2). The treatments resulted in different levels of 

powdery scab in each plot (April 2007). During two subsequent 

growing seasons (2007/08 and 2008/09), the same plots were 

planted with cv. Agria (very susceptible to powdery scab) in 

October, in rows (2 m long; eight tubers/row) centrally in the 5 × 

5 m plots. Soil samples were taken from each row at planting 

and analysed for S. subterranea DNA, using quantitative PCR 

techniques (3). Resulting tubers were harvested in April, washed 

free of soil and individually assessed for powdery scab severity (0 

= no disease, 1 = 5% tuber surface affected, 2 = 20%, 3 = 46%, 4 = 

60%). Relationships between the S. subterranea DNA in soil and 

powdery scab incidence and severity were explored graphically 

and with linear correlations (Pearson’s r). 

Mean score 

% Tubers infected 

80 

70 

60 

50 

40 

30 

2.5 

2.0 

1.5 

1.0 

0.5 

B 


2007/08 growing season. Powdery scab incidence in the plots 

varied from 30 to 100%, and mean severity score varied from 0.3 

to 2.7 (equivalent to 2 to 40% of tuber surface area affected). 

The relationships between S. subterranea DNA quantities in soil 

and powdery scab incidence (r = 0.53) and severity (r = 0.63) are 

illustrated in Figure 1. 

2008/09 growing season. Powdery scab incidence in the plots 

varied from 4 to 83%, mean severity score varied from 0.04 to1.6 

(equivalent to 0.2 to 16% of tuber surface area affected) and 

amount of S. subterranea DNA varied from 58 to 1997 pg g ‐1 soil. 

The relationships between amount of DNA in soil and powdery 

scab incidence and severity were very poor (r = 0.02 and 0.07 

respectively). 

This study has shown moderate to poor correlations between S. 

subterranea DNA in soil sampled at the time of sowing and 

powdery scab in harvested tubers. These results were from a 

field where soil DNA quantities and powdery scab were assessed 

from 96 evenly spaced positions in a 0.36 ha area (≈ 270 samples 

1.8 2.0 2.2 2.4 2.6 2.8 3.0 3.2 3.4 3.6 

log 10 

pg DNA g -1 soil 

Figure 1. Relationships between S. subterranea DNA in soil at planting 

and powdery scab incidence (A) and mean severity score (B) for potatoes 

grown in field plots. 


The NZ Foundation for Research Science and Technology and 

HAL (through the Australian Potato Research Program) funded 

this research. 

REFERENCES 

1. Merz U, Falloon RE (2009) Review: powdery scab of potato— 

increased knowledge of pathogen biology and disease 

epidemiology for effective disease management. Potato Research 

52: 17–37. 

2. Falloon RE, FA Shah, et al. (2007) Nitrogen fertiliser increases 

powdery scab incidence and severity; work in progress. 

Proceedings of the 2nd European Powdery Scab Workshop. 

www.spongospora.ethz.ch/EUworkshop07/index.htm 


3. Ophel‐Keller K, McKay A, Hartley D, Herdina, Curran J (2008) 

Development of a routine DNA‐based testing service for soilborne 

diseases in Australia. Australasian Plant Pathology 37: 243–253. 

Posters 


Posters 

6 Bacterial canker of tomato: Australian diversity of Clavibacter michiganensis subsp 

michiganensis 

L.M. Forsyth{ XE "Forsyth, L.M." }, T. Crowe, A. Deutscher and L. Tesoriero 

NSW Department of Primary Industries, Elizabeth Macarthur Agricultural Institute, Woodbridge Rd, Menangle 2568 

INTRODUCTION 

Bacterial canker of tomato is an important disease in Australian 

tomato production, especially amongst the greenhouse industry. 

The disease is caused by systemic vascular infection of the 

bacteria Clavibacter michiganensis subsp. michiganensis (Cmm). 

Canker infection can result in yield reductions of up to 100%. 

Currently there are no effective chemical or biological control for 

canker, the only effective methods are the quarantine and 

eradication of infected material. The external symptoms of 

bacterial canker have altered over the past decades. Whether 

this is due to the use of newer tomato cultivars which react 

differently to infection or due to the introduction of new genetic 

strains of the bacteria is not known. 

It is possible that there are new strains present in Australia since 

Cmm can be seed borne and imported seed is generally 

untreated since the relaxation of Australian quarantine 

requirements in the early 1990s. 


Isolate collection. Isolates were collected from tomato growing 

areas around Australia with a particular focus on greenhouse 

tomatoes. International isolates have been sourced from the 

Belgium culture collection (BCCM) and from America. 

Genetic diversity. DNA was extracted from the isolates using the 

Qiagen DNeasy kit, before quantification and dilution. DNA 

fingerprinting was undertaken using the ERIC, BOX and REP PCR 

(1). Further analysis of the genomic internal transcribed region 

(ITS) was undertaken on all isolates using a combination of 

sequencing and PCR‐RFLPs (2). 

Pathogenic diversity. A range of tomato cultivars were used to 

compare pathogenicity of Cmm isolates selected based upon the 

genetic diversity results. Isolates were also screened against 

other solanaceous crop plants commonly grown including 

eggplant and capsicum. 

RESULTS 

Genetic diversity. Preliminary screening results using BOX, ERIC 

and REP primers have revealed differences amongst Australian 

Cmm isolates. Sequencing analyses of the ITS region of four 

selected isolates has shown some base changes allowing the 

development of PCR‐RFLP. 

Pathogenic diversity. All tomato cultivars examined showed high 

levels of susceptibility to Cmm, though symptom expression 

appears to be cultivar dependent. Of the isolates examined the 

majority were pathogenic, though there was at least one isolate 

which appears to be avirulent. 

DISCUSSION 

Cmm diversity. Early results from the DNA fingerprinting of the 

Australian isolates of Cmm has revealed genetic diversity. 

Further comparisons with international isolates and isolates 

from field‐grown tomatoes will help understanding of whether 

this diversity is reflected in the international diversity or 

localised population drift potentially due to the high selection 

pressure within the greenhouse environments. 

Preliminary analyses of the genetic diversity of the avirulent 

isolate has not revealed any distinct differences. The avirulent 

isolate is being further tested using pulse field gel 

electrophoresis to examine the presence of pathogenicity 

conferring plasmids and virulence genes previously described 

(3). 

Only limited pathogenic diversity has been observed amongst 

isolates of Cmm. Although there was some variation between 

tomato cultivars in symptom expression, all tomato cultivars 

assessed showed high levels of susceptibility to the majority of 

isolates and eventually died due to application of Cmm. The 

localised lesions which developed on the capsicum leaves did 

not spread systemically in these experiments, implying that in a 

controlled environment only direct contact with Cmm on the 

leaves will lead to disease. Further testing using Cmm isolates 

isolated from capsicum plants will be undertaken to determine 

whether more severe disease could develop. 


This work was funded by ACIAR, NSW DPI, Horticulture Australia 

Ltd, AusVeg and the tomato consortium. Acknowledgement for 

technical assistance from J. Collins, K. Turton, and S. Austin. 

REFERENCES 

1. Versalovich J, Schneider M, De Bruijn FJ, Lupski JR (1994) Genomic 

fingerprinting of bacteria using repetitive sequence based 

polymerase chain reaction. Methods in Molecular and cellular 

biology 5, 25–40. 

2. Fegan M, Croft BJ, Teakle DS, Hayward AC, Smith GR (1998) 

Sensitive and specific detection of Clavibacter xyli subsp. xyli, 

causal agent of ratoon stunting disease of sugarcane, with a 

polymerase chain reaction‐based assay. Plant pathology, 47, 495– 

504. 

3. Meletzus D, Bermpohl A, Crier J, Eichenlaub R (1993) Evidence for 

plasmid encoded virulence factors in the phytopathogenic 

bacterium Clavibacter michiganensis subsp. michiganensis 

NCPPB382. Journal of Bacteriology, 175, 2131–2136. 

Experiments examining a wider host range of Cmm revealed that 

pathogenic isolates were able to infect the two capsicum 

cultivars examined resulting in small localised lesions on the leaf 

lamina where the inoculum was initially applied. No systemic 

infection was observed within the capsicum plants. No 

symptoms were observed on the eggplant cultivar used. 


67 Detection of Mycosphaerella fijiensis in the skin of ‘Cavendish’ banana 

R.A. Fullerton{ XE "Fullerton, R.A." } A and S.G. Casonato A 

A The New Zealand Institute for Plant and Food Research Limited, Private Mail Bag 92169, Auckland Mail Centre 1142, New Zealand 

Posters 

INTRODUCTION 

Mycosphaerella fijiensis, cause of black leaf streak, has a very 

slow incubation period compared with many other pathogens. 

The fungus infects leaves as they emerge from the plant. The 

first symptoms (rusty streaks) appear in the highly susceptible 

‘Cavendish’ types in 2–3 weeks, extending to over 35 days for 

the more resistant ‘Ducasse’, ‘Pahang and ‘Pisang Mas’. In some 

genotypes symptoms may not be expressed until the leaf begins 

to senesce (1). These patterns of host response show that the 

pathogen has the ability to survive without symptoms in the leaf 

for extended periods. There are no records of infection of the 

fruit of dessert bananas. A record of infection in plantain (2) 

shows that the fungus has the capacity to invade the skin of 

fruit. This study aimed to investigate whether the fungus can be 

present without symptoms in the skin of ‘Cavendish’ bananas. 


Source of fruit. Green, fully developed fruit were obtained from 

diseased ‘Cavendish’ plants in the field in Samoa. Additionally, 

‘green‐mature’ and ripe fruit were obtained from the local 

market. 

is a constant association between the red fleck symptom and 

M. fijiensis. 

In many cases the presence of M. fijiensis may have remained 

undetected because of overgrowth of the skin pieces by other 

faster growing fungi such as Colletotrichum spp., Cordana 

musae, Penicillium sp., Cladosporium sp., Curvularia sp., 

Fusarium sp., Rhizopus sp., Trichoderma sp., and Pestalotiopsis 

sp. 

This study has shown that M. fijiensis can infect and survive 

without symptoms in the skin of ‘Cavendish’ banana. While only 

a very low recovery rate was achieved in this study, the 

incidence in nature may be much higher. 

–—– A ––– B – – C – – D –– E –– F – – G –– H – – I – – J 

Isolation protocol. Pieces of skin tissue approximately 5 mm 

square and 0.5–1.0 mm thick were excised aseptically and plated 

onto Potato Dextrose Agar (PDA) or V8 agar, both modified with 

streptomycin and penicillin (100 µg/ml of each). Plates were 

incubated under continuous white/near‐UV light and were 

examined microscopically after five days 

Overall, a total of 1040 skin pieces were taken from 60 fruit from 

13 different sources. Five pure cultures of putative M. fijiensis 

were returned to New Zealand under a Biosecurity New Zealand 

permit to confirm their identities. 

Identification of isolates. The identities of the cultures returned 

to New Zealand were confirmed by spore morphology, 

polymerase chain reaction (PCR) using species‐specific primers 

provided on a confidential basis by the Cooperative Research 

Centre (CRC) for Tropical Plant Protection, and by the 

sequencing of the internal transcribe spacer region of rDNA. 


Of the five fruit isolates returned to New Zealand, two were 

positively identified as M. fijiensis, with concurring results from 

spore morphology, PCR, and sequencing (100% homology to 

sequences of M. fijiensis in GenBank). PCR results are shown in 

Figure 1. Both isolates were obtained from different skin 

samples from the same fruit. Microscopical examination (in 

Samoa) of a cluster of hyphae on skin of a different fruit revealed 

dark hyphae strongly resembling the early stages of a stroma of 

M. fijiensis. The structure was insufficiently developed to obtain 

a positive identification based on morphology, and overgrowth 

by other fungi prevented its isolation into pure culture. In all 

three cases, (two confirmed M. fijiensis, one suspected), the 

fungus was associated with minute (~1 mm diameter) red, 

necrotic flecks on the surface of the skin. Red flecks were 

relatively common on many of the test fruit. Most did not yield 

any fungi and others were overgrown by various fungal species 

before the slow growing M. fijiensis would have had time to 

emerge. It cannot be determined from this study whether there 

Figure 1. Amplified Mycosphaerella fijiensis products of approximately 

1050 bp. Lane A: 100 bp ladder B: 88a; C: 88b; D: Mfb; E: Mfc; F: Myc#1; 

G: 589 yellow Sigatoka; H: 748 M. fijiensis (positive control); I: blank 

(negative control); J: 100 bp ladder. Arrow indicates 600 bp on 100 bp 

ladder. 


We gratefully acknowledge the Samoa Ministry of Agriculture, 

Fisheries, Forests and Meteorology for access to the laboratories 

of the Nuu Crop Research Centre, and assistance in this study. 

We thank Dr Juliane Henderson of CRC for Tropical Plant 

Protection for supplying primer sequences. 

REFERENCES 

1. Cedeño L, Carrero C, Quintero K. 2000. Identification of 

Mycosphaerella fijiensis as cause of specks on fruits of plantain cv 

Harton in Venezuela. Fitopatologia‐Venezolana. 1:6–10. 

2. Fullerton RA, Olsen TL. 1995. Pathogenic variability in 

Mycosphaerella fijiensis Morelet, cause of black Sigatoka disease in 

banana and plantain. New Zealand Journal of Crop and 

Horticultural Science. 23:39–48. 


Posters 

46 Two new books: Diseases of Fruit Crops in Australia and Diseases of Vegetable 

Crops in Australia 

Tony Cooke, Denis Persley and Susan House, Cherie Gambley{ XE "Gambley, C." } 

Queensland Primary Industries and Fisheries, Department of Employment, Economic Development and Innovation, 80, Meiers Road, 

Indooroopilly Qld 4068, Australia 

Accurate information on disease diagnosis and management is 

essential for sustainable crop production. Two new books, 

Diseases of Fruit Crops in Australia and Diseases of Vegetable 

Crops in Australia, provide comprehensive coverage of 

important diseases affecting the broad range of fruit and 

vegetables grown throughout Australia. Written in a practical, 

straight forward style, the text explains how to identify and 

manage each disease, describing the symptoms of the disease, 

its importance, the means of infection and spread, and disease 

management. 

Based on the highly regarded early 1990 editions of Diseases of 

Fruit Crops and Diseases of Vegetable Crops published by the 

Department of Primary Industries and Fisheries, Queensland, 

these new books have been extensively revised and expanded. 

Emphasis is placed on integrated disease management and 

diseases that are biosecurity threats to Australian fruit and 

vegetable production. 

The text is supported by quality colour images. The books will 

become new standard references in applied plant pathology in 

Australia for fruit and vegetable crops. 

FEATURES 

• Chapters are authored by experienced plant pathologists 

from throughout Australia. 

• Written in a straightforward style with a minimum of 

scientific terms. 

• Provides accurate information about significant diseases 

affecting major and specialty fruit crops and vegetable 

crops in Australian tropical and temperate regions. 

• Each disease is extensively illustrated with high quality 

colour photographs. 

• Contains a comprehensive glossary and provides up‐to‐date 

sources of further information. 

• Describes key exotic diseases that are biosecurity risks to 

Australian fruit and vegetable growers. 

Both books are being published by CSIRO Publishing (Landlinks 

Press) and are due for release in October 2009 

REFERENCES 

1. Persley Denis (1993) Diseases of Fruit Crops. Department of 

Primary Industries, Queensland. 

2. Persley Denis (1994) Diseases of Vegetable Crops. Department of 

Primary Industries, Queensland. 


71 Infection and host responses in interactions between melon and Colletotrichum 

lagenarium 

Posters 

Yonghong Ge{ XE "Ge, Y." } and David Guest 

Faculty of Agriculture, Food and Natural Resources, The University of Sydney, Sydney, 2006, NSW AUSTRALIA 

INTRODUCTION 

Melon is an economically important horticultural crop that is 

susceptible to anthracnose caused by Colletotrichum 

lagenarium. Two types of infections are caused by 

Colletotrichum species: intracellular hemibiotrophic invasion or 

subcuticular intramural necrotrophic invasion (1). However, the 

infection process of melon anthracnose caused by C. lagenarium 

remains unknown. This study of the compatible interaction 

between C. lagenarium and melon leaves investigated the 

infection process and monitored defence responses of the 

melon plant. 


Preparation of infected tissues. Seeds of rockmelon cv. Galaxy 

and Ultra sweet Miami (Terranova seeds Pty Limited, NSW, 

Australia) were grown in 10 cm plastic pots filled with UC potting 

mix in the glasshouse at 24oC, with illumination for 16 h. Plants 

were watered daily and fertilised with Aquasol® weekly. Three 

week old seedlings were inoculated on the abaxial surface of the 

first leaf with a suspension of 106 conidia mL‐1 of C. lagenarium. 

Inoculated plants were maintained at 25oC, 100% relative 

humidity for 24 h, then returned to the glasshouse. 

Conidia attached and germinated on the leaf surface 6 hai (Fig. 

1A), and differentiated a germ tube at one tip 12 hai (Fig. 1B). 

Melanised appressoria were first observed 24 hai, sometimes 

formed directly from one tip of the conidium (Fig. 1C), or from 

the tip of the germ tube. Penetration pegswere observed 48 hai 

(Fig. 1D). By 72hai, epidermal cells of melon leaves had been 

penetrated and contained intracellular fungal structures 

comprising swollen, saccate infection vesicles with elongated 

neck regions (Fig. 1E). Infection vesicles enlarged and formed 

primary hyphae (Fig. 1E), and at this stage of host‐pathogen 

interaction, infected melon leaves were symptomless. Beyond 

72 hai, secondary hyphae developed from the primary hyphae 

and invaded surrounding tissues (Fig. 2F), and the infected 

melon leaves developed visible anthracnose symptoms. The 

results also indicated that the resistant and susceptible cultivars 

use the same infection process. 

Callose deposition around the infection sites was noted 48 hai in 

susceptible and resistant cultivars (Fig. 2, Fig. 3). Callose 

deposition was brighter and more intense in the resistant 

cultivar. 

Light microscopy. Leaf samples were collected at 6, 12, 24, 48, 

72, 96 hrs after inoculation. Decolourised sections were 

immersed in lactophenol for 1min and then stained with 0.025% 

aniline blue for 30 min. After staining, the tissues were rinsed 

(2!2min) in lactophenol and mounted in fresh lactophenol on 

glass slides for microscopy(2). Callose was visualized under UV 

after staining with aniline blue (3). 


Figure 2. (A) Light and (B) UV micrographs showing the accumulation of 

callose 48 hai of the first leaves of susceptible melon with C. lagenarium. 

(C) Light and (D) UV micrographs showing the accumulation of callose 48 

hai of resistant melon. 

a=appressorium; Ca=callose 

These results indicate that the infection process of C. lagenarium 

was intracellular hemibiotrophic invasion. 


This research was supported by the Australian Centre for 

International Agricultural Research (ACIAR). We thank Suneetha 

Medis for technical assistance. 

Figure 1. Infection structures of C. lagenarium in the first leaves of 

rockmelon. (A) Ungerminated conidia on the leaf surface with stomata 6 

hai. (B) Conidia with germ tubes 12 hai. (C) Melanised appressoria 24 hai. 

(D) Appressorium with penetration peg 48 hai. (E) Formation of infection 

vesicle and primary hyphae 72 hai. (F) Formation of secondary hyphae 96 

hai. 

c=conidia;s=stomata; gt=germ tube; a=appressorium; pp=penetration 

peg; ph=primary hyphae;sh=secondary hyphae; iv=infection 

vesicle;hai=hour after inoculation.Bars=20μm. 

REFERENCES 

1. Bailey JA, O’Connell RJet al. (1992) Infection strategies of 

Colletotrichum species. In Colletotrichum: Biology, Pathology and 

Control (JA Bailey, and MJ Jeger, Eds), CAB International 

2. Latunde‐Dada AO, Bailey JAet al.(1997) Infection process of 

Colletotrichumdestructivum O’Gara from lucerne (Medicagosativa 

L.). European Journal of Plant Pathology 103, 35‐41. 

3. Borden S, Higgins VJ (2002) Hydrogen peroxide plays a critical role 

in the defence response of tomato to Cladosporium fulvum. 

Physiological and Molecular Plant Pathology 61, 227‐236. 


Posters 

70 Disease‐management strategies for the rural sector that help deliver sustainable 

wood production from exotic plantations 

C. Beadle A , A. Rimbawanto B , A. Francis C , M. Glen{ XE "Glen, M." } A , D. Page C , C.L. Mohammed A,C 

A CSIRO Sustainable Ecosystems, Private Bag 12, Hobart, Tasmania 7001, Australia 

B Centre for Biotechnology and Tree Improvement, Yogyakarta, Indonesia 

C Tasmanian Institute of Agricultural Science and School of Agricultural Science, University of Tasmania, PB 54, Hobart, TAS 7001, 

Australia 

INTRODUCTION 

A training workshop and post‐workshop field trip was held in 

May 2009 in Indonesia to advance knowledge and understanding 

in disease management. It was opened by the Minister for 

Forestry and attended by a wide range of participants from the 

forest, oil palm and rubber industries, universities, and research 

and government agencies. The workshop was supported by 

international experts from South Africa, the United Kingdom and 

Australia. 

Case studies were used at the workshop to provide training and 

exposure for participants in concepts of forest pathology, 

biosecurity and forest health surveillance and their application 

towards developing strategies for disease management. These 

case studies focused on disease issues and threats of immediate 

relevance to tree crops in Indonesia, for example, fungal rot in 

hardwood plantations, rubber and oil palm, rust galling in 

Paraserianthes falcata, and the significance of a guava rust 

incursion. An exercise was carried out in the field to train in the 

basic concepts of ground based forest health surveillance. The 

field trip in Sumatra examined demonstration sites and 

experiments in acacia and eucalypt areas most severely affected 

by root rot, and included hands‐on experience in disease 

assessment and novel ways to examine disease risk. 

OUTPUTS OF TRAINING EXERCISE 

Position paper. The position paper focuses on using all available 

information about root and basal stem rot in plantation‐based 

industries to assist in capturing both the current status of forest 

disease management capacity in Indonesia and what type of 

capacity will be required to combat some very serious diseases 

of plantation crops. It first considers the background that has led 

to root rot and basal stem rot becoming diseases that have a 

significant economic effect on plantation‐based industries. A 

summary of the current size of the plantation estates in the oil 

palm, pulpwood and rubber industries is then provided. These 

sections give us an idea of the possible returns from investing in 

building capacity. 

The paper then collates information that has been collected 

from professional staff working in both the private and public 

sector in roles that are connected to disease management for oil 

palm, forestry (primarily pulpwood) species and rubber, and 

supports this information with that from published literature. A 

separate section considers the concept of ecosystem 

management—this research focus lies primarily in the public 

sector. Next there is a dissertation on biological control that 

examines the potential characteristics and development of 

control agents and the challenges that must be overcome to 

make them work. These three sections assist in highlighting the 

types of research and operational disease management capacity 

required. 

policy directions that are relevant to both this education and the 

application of disease management. 

Proceedings and DVD Disease Management Strategies in 

Plantations. The Proceedings will summarise the information 

from the workshop from the various sessions (Introduction to 

Disease Management; Morphological and Molecular 

Identification Tools; Forest Health Surveillance; Biosecurity; 

Chemical, Genetic and Biological Control; Silvicultural and Risk 

Management; Integrated and Ecosystem Management; Policy 

Development). 

The DVD which contains all the talks from the Workshop is 

available on request and the Proceedings will be available in 

September. 

Field guide. A field guide to the identification of basidiomycete 

root rot diseases in tree crops will be published at the end of 

2009. This will include crown and root symptoms associated with 

the various stages of root rot disease and a description of the 

sporocarps associated with the various fungal pathogens capable 

of causing root rot disease. 

SUMMARY 

As in Australia there is little specific University training in forest 

pathology or disease management. Plant pathology education is 

comparatively well resourced in Indonesia, especially in Bogor, 

and the industries can draw from this pool of graduates. Barriers 

to building expertise in forest disease management lie in the fact 

that young people do not wish to live in remoter regions and 

there are often organisational barriers to the sharing of 

expertise and a collaborative approach to solving problems, even 

within the same industry. 

The Government of Indonesia has no formal approach to disease 

management in its forest policy. However the Minister has 

acknowledged the problem of disease, especially root‐rot 

disease (which is probably the most serious pest problem faced 

by the hardwood plantation industry) and is actively encouraging 

a cooperative approach to disease management. Substantial 

funding is potentially available to promote this collaboration and 

this supports the case for more open communication as was 

achieved by the workshop and field trip. Root rot disease has 

been a surprising catalyst for opening pathways of 

communication. 


We thank the AUSAID Public Sector Linkage Programme for 

funding this activity. We also thank the many numerous 

Indonesian colleagues who participated in this activity. 

The current capacity to deliver professional services in disease 

management is then examined. The paper concludes with a 

consideration of the part of Indonesia’s higher education system 

that delivers training in Plant Protection and Plant Pathology and 


68 Rapid and robust identification of fungi associated with Acacia mangium root 

disease using DNA analyses 

Posters 

M. Glen{ XE "Glen, M." } A , V. Yuskianti B , A. Francis C , L. Agustini C,D , A. Widyatmoko B , A. Rimbawanto B and C.L. Mohammed A,C 

A CSIRO Sustainable Ecosystems, Private Bag 12, Hobart, Tasmania, Australia, 7001 

B Centre for Biotechnology and Tree Improvement, Yogyakarta, Indonesia 

C IAR, University of Tasmania, Private Bag 12, Hobart, Tasmania, Australia, 7001 

D Forest and Nature Conservation Research and Development Centre, FORDA, Bogor, Indonesia 

INTRODUCTION 

Indonesia, like many developing and developed countries, lacks 

people with experience in identifying root rot pathogens, both as 

sporocarps but more particularly, in culture. This increases the 

difficulty of managing Acacia mangium plantations which suffer 

severe economic losses due to root rot. This type of disease is 

caused by a variety of primary pathogens in Indonesian 

plantations. Existing forestry research laboratory facilities 

already use DNA techniques in plant genetics research and this 

capability was adapted to identification of fungi isolated from 

diseased roots of Acacia mangium. 

Several species of Ganoderma are associated with root rot in 

Acacia mangium (1). As part of ACIAR project FST/2003/048 a 

large number of fungal cultures were isolated from the roots of 

A. mangium and sporocarps collected from A. mangium 

plantations, with a view to determining the most prevalent and 

damaging root pathogens, elucidating their mode of dispersal 

and developing strategies for their management. Accurate 

isolate identification is a prerequisite for success in these aims. 


DNA was extracted and the rDNA ITS was amplified and 

sequenced (1). Isolates were grouped into Operational 

Taxonomic Units (OTUs) based on DNA sequence similarity. The 

OTU was identified by DNA sequence identity with herbarium 

collections where possible. 

Development of species‐specific primers targeting the rDNA ITS 

allowed faster and cheaper identification of two of the most 

prevalent species associated with root rot in Acacia mangium, 

Ganoderma philippii and G. mastoporum. Subsequent to the 

development of these specific primers all isolates isolated from 

roots or sporocarps were screened with these primers. This 

allowed faster identification and reduced the number of isolates 

sent for sequencing. 


Over 200 root rot isolates were confirmed as G. philippii or G. 

mastoporum either by DNA sequencing or species‐specific PCR 

(Figure 1). Another 120 cultures were grouped into 43 

operational taxonomic units (OTUs) by DNA sequence similarity. 

Eighteen OTUs were linked by DNA sequences to sporocarp 

collections, facilitating the morphological verification of culture 

identification. 

Figure 1. Species‐specific PCR for identification of Ganoderma philippii. 

Upper panel, PCR with primers Gphil2f/Gphil6r; lower panel, PCR with 

primers Gphil3f/Gphil4r. Lanes contain: 1, DNA size marker; 2–10, G. 

philippii isolates; 11–22, other Ganoderma spp.; 23–24, positive controls 

(G. philippii); 25, negative control (no DNA). 

G. philippii and G. mastoporum, G. aff. australe, G. aff. 

steyaertanum, G. subresinosum, G. aff. subresinosum, G. 

colossum, G. weberianum, Amauroderma rugosum and Phellinus 

noxius were isolated from A. mangium plantations. Isolates from 

diseased roots are predominantly G. philippii, with a low 

incidence of G. mastoporum and Phellinus noxius. 

Sporocarps of Fomes, Irpex, Phlebia, Trametes spp. have been 

collected and formally identified by DNA analysis. This study also 

discovered another fungal species that warrants investigation as 

a potential root‐rot biocontrol. Some cultures from roots were 

identified as belonging to the genus Phlebiopsis. Phlebiopsis 

gigantea has been demonstrated to be an effective prophylactic 

biocontrol for root rot caused by Heterobasidion annosum. 

Maintaining a large number of fungal isolates in tropical regions 

poses a challenge. Confident and rapid identification of fungal 

isolates has reduced the work required to maintain fungal 

isolates by allowing non‐target fungi to be discarded. This also 

reduces the risk of culture contamination by ‘weedy’ species. 


This work was funded by ACIAR project FST/2003/048. 

REFERENCES 

1. Glen M, Bougher NL, Francis A, Nigg SQ, Lee SS, Irianto R, Barry KM, 

Beadle CL & Mohammed CL. (2009) Ganoderma and Amauroderma 

species associated with root‐rot disease of Acacia mangium 

plantation trees in Indonesia and Malaysia. Australasian Plant 


Identification of the remaining OTUs is based on DNA sequence 

similarity to sequences from public DNA databases. Only one 

Ganoderma isolate has not been linked to a sporocarp collection. 

33 OTUs are linked to species/genus information in public DNA 

databases, providing an indication, at various taxonomic levels of 

species affinities. 


Posters 

69 Survey of the needle fungi associated with Spring Needle Cast in Pinus radiata 

I. Prihatini A , M. Glen{ XE "Glen, M." } B , A.H. Smith A , T.J. Wardlaw C and C.L. Mohammed A,B 

A Tasmanian Institute of Agricultural Science and the School of Agricultural Science, University of Tasmania, Private Bag 54, Hobart, 

Tasmania 7001, Australia 

B CSIRO Sustainable Ecosystems, Private Bag 12, Hobart, Tasmania 7001, Australia 

C Forestry Tasmania, 79 Melville St, Hobart, Tasmania 7000, Australia 

INTRODUCTION 

Spring needle cast (SNC) is currently classified as a serious 

disease of Pinus radiata growing in closed‐canopy stands on high 

altitude, wet sites in Tasmania (1). SNC affects about 30% of the 

Pinus radiata estate in Tasmania and causes the premature 

casting of needles at the end of their first year. This leads to 

growth reductions in direct proportion to the amount of 

defoliation. Stands with moderate or severe SNC can be 

expected to suffer potential losses in clearfall volume of 30–50% 

(1). Unlike other serious needle cast diseases elsewhere in 

Australia and New Zealand such as Dothistroma septospora or 

Cyclaneusma, SNC in Tasmania is not considered to be a classical 

needle blight disease caused by a primary fungal pathogen. It is 

thought to be caused by a suite of endophytic fungi that are 

triggered into secondary pathogenic activity by an 

environmental stress. Three fungal species are considered to 

play a role in Spring Needle Cast in Tasmania: Cyclaneusma 

minus, Lophodermium pinastri and Strasseria geniculata (2). 

The Pinus radiata Spring Needle Cast Marker Aided Selection 

(MAS) trial was planted in June 1999 by Forestry Tasmania in 

Oonah, North West Tasmania (annual rainfall: 1655mm/yr; mean 

daily temperature: 9.9 °C; altitude 450 metres). There are three 

full sib families with known breeding values for SNC (3). 

The objective of this study was to characterise the fungal 

communities associated with needles on trees scored for SNC 

damage in the MAS trial. 

MATERIAL AND METHODS 

The needle samples were collected in spring 2007 from the 

Oonah SNC MAS trial. The trees in this trial were scored for SNC 

severity immediately before sample collection. Trees were given 

a score ranging from 1 (no disease) to 4 (severe disease). For 

each disease score within each family, 3 trees were sampled for 

needles. Three different ages of needle were collected from a 

tree. 

DNA was extracted from needles and fungal DNA was amplified 

by PCR (4). PCR products from the same aged needles of trees in 

the same disease class and family (i.e. 3 trees) were pooled then 

cloned using a commercial kit. Thirty‐two colonies from each 

cloning reaction were randomly selected and screened using 

PCR‐RFLP to reduce the number of samples for sequencing. 

Approximately 12–16 clones from each set were sequenced. 

Sequences of high similarity were retrieved from public 

databases. 


PCR, cloning and DNA sequencing has been completed for 

samples in disease categories 1 to 3 (Table 1). 

Table1. Prevalence of fungal species detected in disease categories 1 (no 

disease) to 3 (moderate disease) for all families combined. 

Disease Category 

Species 1 2 3 4 

Allantophomopsis sp 2 1 2 0 na 2 

Catenulostroma sp 3 3 3 na 

Cyclaneusma sp 4 5 2 na 

Mycosphaerella sp 1 8 6 4 na 

Mycosphaerella sp 2 8 6 5 na 

Mycosphaerella pini 5 6 2 na 

Lophodermium pinastri 0 1 4 na 

Phoma sp 1 2 1 na 

Tumularia sp 5 3 0 na 

1 the number of samples out of 9 in which a species was detected 

2 Data to be presented on poster. 

In this study Mycosphaerella species 1 and and 2 were common 

to all three disease categories. Mycosphaerella pini was common 

to classes 1 and 2 but less frequently detected in class 3. 

Cyclaneusma sp. was not clearly correlated with disease 

incidence in the three disease categories analysed. 

Lophodermium pinastri was found more frequently in needles 

from trees with a higher disease severity. 

From the data so far collated, no clear association of any fungal 

species with disease incidence is evident. Further data analysis 

will be needed to study the correlation of fungal species with the 

host genetics. 


Australian Research Council, Forestry Tasmania, Rayonier, 

Taswood Growers, Norske‐Skog, Forests NSW, Hoskings Ltd. 

New Zealand. Istiana Prihatini is the recipient of a John Allwright 

Fellowship, ACIAR. 

REFERENCE 

1. Dick MA, Somerville JG, Gadgil, PD (2001). Variation in the fungal 

population in Cyclaneusma needle‐cast in New Zealand. In 'Forest 

Reseach Bulletin'. (Ed. LS Bulman) pp. 12–20) 

2. Wardlaw T (2008) A review of the outcomes of a decade of forest 

health surveillance of state forests in Tasmania. Australian Forestry 

71, 254–260. 

3. Kube P, Piesse M (1999) 'Pinus radiata Spring Needle Cast Marker 

Aided Selection Trial.' Forestry Tasmania, RP251/9. 

4. Glen M, Tommerup IC, Bougher NL, and O' Brien PA (2002) Are 

Sebacinaceae common and widespread ectomycorrhizal associates 

of Eucalyptus species in Australian forests? Mycorrhiza 12, 243– 

247. 


7 A new report on Pseudomonas syringae pv. mori causal agent of bacterial blight of 

mulberries in Australia 

Posters 

H. Golzar{ XE "Golzar, H." } and P. Mather 

Department of Agriculture and Food Western Australia, Bentley Delivery Centre, WA 6983, Australia 

INTRODUCTION 

Pseudomonas syringae pv. mori (Boyer & Lambert) Young et al. 

causes a leaf spot and blight of young shoots on mulberry. It has 

been a common disease of mulberry worldwide. Symptoms 

appear as small water‐soaked leaf spots, turning brown or black, 

sometimes with a yellow halo. Spots on the midribs and vines 

are sunken. Infected leaves are often become distorted and 

bacterial ooze may be extruding from lenticels. Young shoots 

may show rapid necrosis and cankers (Fig. 1). The disease has 

been reported on mulberry (1) however, there is no official 

record of P. syringae pv. mori in Australia. 


Leaf spots and blight of young shoots were observed on 

mulberry trees in east of Perth in the summer of 2008 (Fig.1). 

Samples of leaf and infected branches were collected. Isolations 

were made from lesions on the leaf and stem tissues. Isolates 

with positive hypersensitivity on tobacco (Nicotiana glutinosa) 

were used for further tests. The bacterial isolates were identified 

based on biochemical tests (2) and using the Biolog identification 

system based on the carbon utilisation microplate assay (Biolog 

MicroLog 4.0 System, Biolog Inc., Hayward, CA). 

Pathogenicity tests. To confirm identification of the bacterial 

strains, pathogenicity tests with two isolates were performed on 

immature lemon, pear fruits, young bean pods and tomato 

seedlings (3). Isolates were grown on sucrose peptone agar (SPA) 

for 24 h and then suspended in sterile water and diluted to a 

concentration of 10 6 CFU/ml. Fruits and bean pods were surface 

sterilised with alcohol, washed with sterile water and inoculated 

by placing drops of an aqueous bacterial suspension on the 

surface and pricked through the drops using sterile needles. 

Controls were inoculated with sterile water. After inoculation, 

fruits and bean pods were incubated in the moist trays at 25°C 

for 7 days. Four‐week‐old healthy tomato plants were inoculated 

using the same bacterial inocula, controls and techniques. Plants 

were placed under mist for 48 h and then moved to the 

growthroom chamber at 22 ± 1°C. Disease symptoms were 

checked 7 days post‐inoculation. 

To test pathogenicity of the same P. syringae pv. mori isolates on 

Malus alba, young shoots and detached leaves were inoculated 

by placing drops of bacterial suspension (10 6 cfu/ml) on freshly 

wounded shoot and midrib tissues. Controls were inoculated in 

the same way using sterile water and then incubated in moist 

trays at 25°C. 

RESULTS 

A bacterial blight was found on mulberries in east of Perth in the 

summer of 2008. White‐coloured and fluorescent bacterial 

colonies were consistently isolated from the leaf and stem 

tissues. Isolates were gram negative, fluorescent on King's 

medium B, oxidase negative, catalase positive, potato soft rot 

negative, arginine dihydrolase negative and tobacco HR positive. 

The representative isolates were tested using the biolog system 

and were identified as P. syringae pv. mori with a probability 

range of 96 to 100%. 

The isolates caused necrosis of the shoots and tissue along the 

midribs of the mulberry leaves 7 days after inoculation (Fig.2). 

The isolates also caused water soaked lesions on the bean pods, 

pear and lemon fruits, although they did not produce disease 

symptoms. In leaves of tomato inoculated by pricking, 

chlorosis areas were seen 7 days after inoculation. Koch's 

postulates were fulfilled and reisolated bacterial colonies were 

identified as P. syringae pv. mori. Culture of P. syringae pv. mori 

has been deposited in the WA culture collection as WAC 13254. 

To our knowledge, this is the first official report of P. syringae pv. 

mori on mulberry in Australia. 

Figure 1. Disease symptoms; leaf spots (a) and blight of a young shoot 

(b). Bars = 1cm. 

Figure 2. Pathogenicity test; Mulberry leaves showing necrosis 

symptoms (a), in comparison with a healthy leaf (b) 

REFERENCES 

a 

a 

1. Janse JD (2006) Pseudomonas syringae pv. mori. In 

‘Phytobacteriology Principles and Practice’. pp. 212–213. (CAB 

Publishing. UK) 

2. Lelliott RA, Stead DE (1987) Methods in Plant Pathology Vol. 2: 

Methods for the Diagnosis of Bacterial Diseases of Plants. Blackwell 

Scientific Publications. Oxford, UK. 

3. Scheck HJ, Canfield ML, Pscheidt JW, Moore LW (1997) Rapid 

evaluation of pathogenicity in Pseudomonas syringae pv. syringae 

with a lilac tissue culture bioassay and syringomycin DNA probes. 

Plant Dis 81, 905–910. 

b 

b 


Posters 

47 Through chain assessment and integrated management of brown rot risks in 

stonefruit 

R. Holmes, O. Villalta, S. Kreidl, M. Hossain and C. Gouk{ XE "Gouk, C." } 

Department of Primary Industries, Knoxfield, Private Bag 15 Ferntree Gully DC, Vic, 3156 Australia 

INTRODUCTION 

Brown rot caused by Monilinia fructicola (G. Wint.) Honey is the 

major disease challenge for stonefruit growers and supply chain 

businesses in Australia. Crop losses are attributed to blossom 

blight and fruit rots, and occur despite fungicidal sprays applied 

by growers. Infection can be controlled with well‐timed, 

effective fungicides (1); however, growers lack access to sitespecific 

weather data and disease models to support control. 

M. fructicola may infect during flowering, fruit development and 

after harvest, thus a through chain approach to disease 

management is required. There are many key management 

strategies including reducing inoculum potential, predicting 

infections, optimal timing of protectant and curative fungicides, 

understanding changes in host tissue susceptibility, controlling 

pests which vector the disease or assist infection and 

understanding the potential for postharvest disease. In this 

paper, we summarise our research in these areas and discuss the 

potential for their integration into a brown rot management 

strategy. 


Field sites. Trials were established in commercial orchards in the 

main Victorian stonefruit districts: 4 sites in 06/7, 7 in 07/8 and 

10 in 08/9. Each site had 6 plots of 10 trees. A weather station 

was placed in the centre of the 4th plot at each site. These 

recorded day length, rainfall, leaf wetness inside and outside the 

canopy, RH and air temperature. 

Inoculum for primary infection. In the first and second seasons, 

sites were surveyed during bloom for the presence of dried or 

mummified fruit in the trees and on the ground. Samples of 

these were collected (up to 20/plot) and moist incubated to 

detect M. fructicola. 

Weather based prediction of infection risk. A weather‐driven 

infection risk model (G Tate pers. comm.) was evaluated using 

data collected by the weather stations over 3 seasons. In the first 

season, surface wetness duration, a critical factor for infection 

risk was compared inside and outside tree canopies. 

Effectiveness of fungicide programs. The predicted occurrence 

and severity of infection periods were examined in relation to 

fungicides applied by growers and brown rot incidence after 

harvest. Over the three seasons, growers made incremental 

changes towards spraying in response to predicted infection 

periods. The success of this was evaluated. 

Influence of Carpophilus beetle populations on infection risk. 

At two sites, canning peach (var T204) blocks were treated with 

the carpophilus attract and kill system. Beetle populations and 

postharvest brown rot incidences were compared against 

untreated blocks. 

Phenological influence on infection risk. In the 08/09 season, 

peach fruit (vars Golden Queen and T204) were spray inoculated 

at early shuck fall, post pit hardening and 1–2 weeks prior to 

harvest. Brown rot development was monitored during the 

growing season and postharvest. 

A postharvest predictor of rot risk. At each site 20 fruit per plot 

were harvested at commercial maturity and moist incubated at 

21°C for 7 and 12 days to establish the level of latent infections 

leading to rots. 


The abundance of mummified fruit infected with M. fructicola 

did not exclusively explain the incidence of postharvest rot (2). 

Tate’s infection model was convenient for identifying periods of 

weather conducive to infection. However to make best use of 

the model it is necessary to understand a) the susceptibility of 

the crop at different phenological stages and b) the inoculum 

potential. In the first season of trials, inoculation of developing 

flowers and fruit at different growth stages did not reveal 

differences in tissue susceptibility and therefore, more 

comprehensive trials are planned. 

There was a strong positive relationship between the number of 

moderate and severe infection risk events in the two weeks 

before harvest and the postharvest rot incidence. Well timed 

fungicides during this period appeared to have suppressed 

infections. 

Flat plate sensors outside tree canopies generally recorded 

longer wetness intervals than sensors inside canopies, for both 

rain and dew events. This agrees with Henshall et al. (3) who 

showed this was the case in vineyards. Therefore wetness 

duration measured outside tree canopies will estimate greater 

disease risks (2). 

Controlling carpophilus significantly reduced postharvest rot 

incidence and more work is required to determine how this fits 

into a disease control strategy. 

Moist incubating samples of fruit collected a few days before 

commercial harvest can be used to estimate the risk of rots 

developing during storage, transport and marketing. Thus 

packers and distributors can appropriately treat and market high 

risk fruit into short supply chains, minimising wastage. 


This project is supported by the Victorian Government, 

Summerfruit Australia, the Canned Fruit Industry Council and 

Horticulture Australia. 

REFERENCES 

1. Tate, K.G., Wood, P.N. and Manktelow, D.W. (1995). Development 

of an improved spray timing system for process peaches in Hawke’s 

Bay. Proceedings 48th N.Z. Plant Protection Conference, 101–106. 

2. Holmes, R., Villalta, O., Kreidl, S., Partington, D., Hodson, A. and. 

Atkins T A (2007) Weather‐based Model Implemented in HortPlus 

MetWatch with Potential to Forecast Brown Rot Infection Risk in 

Stone Fruit. Acta Hort. 803:19–27 

3. Henshall, W.R., Beresford, R.M., Chynoweth, R.W. and Ramankutty, 

P. 2005. Comparing surface wetness inside and outside grape 

canopies for region‐wide assessment of plant disease risk. New 

Zealand Plant Protection 58:80–83. 


48 Effects of temperature on mixed bunch rot infections of grapes 

L.A. Greer{ XE "Greer, L.A." }, S. Savocchia, S. Samuelian and C.C. Steel 

National Wine and Grape Industry Centre, Charles Sturt University, Locked Bag 588, Wagga Wagga, NSW 2678 

Posters 

INTRODUCTION 

Although bunch rot of grapes is frequently associated with 

Botrytis cinerea or grey mould, this pathogen can be absent from 

bunch‐rot affected vineyards under some climatic conditions. Of 

note is the occurrence of Ripe Rot and Bitter Rot caused by 

Colletotrichum acutatum and Greeneria uvicola respectively, in 

sub‐tropical vineyards that experience warm and wet conditions 

close to harvest. In Australia, Ripe Rot and Bitter Rot have been 

recorded in coastal regions such as the Hunter Valley (NSW), 

Kingaroy (QLD) and Carnarvon (WA). 

Previous studies have revealed that C. acutatum and G. uvicola 

were the predominant bunch rot pathogens isolated from 

berries collected at different phenological stages in the Hastings 

Valley (mid north coast NSW) (1), whereas isolation of B. cineria 

was infrequent. Both C. acutatum and G. uvicola can occur 

concurrently in the one vineyard and even on the one berry. In 

an attempt to explore factors leading to the absence of B. 

cinerea from some vineyards, we investigated the ability of C. 

acutatum, G. uvicola and B. cinerea to co‐infect berries at either 

20°C or 27°C. 


Detached, disease‐free Cabernet Sauvignon berries (22.4° Brix) 

were surface sterilised, rinsed in sterile water and placed into 24 

well microtitre plates. Berries were inoculated either singularly 

or with combinations of B. cinerea, C. acutatum and G. uvicola 

(10 μL droplet on the distal apex of the berry, 10 6 spores/mL) 

using three replicates per isolate with 24 berries per replicate. 

Berries were incubated for five days at either 20°C or 27°C in the 

dark at 100% RH. Berry colonisation was assessed by plating 

grape berries onto potato dextrose agar. Results were expressed 

as the mean percentage of berries infected. 


Grape berries were susceptible to infection by all three of the 

bunch rot pathogens examined. A higher percentage of berries 

were infected by B. cinerea at 20°C than at 27 ºC, while G. 

uvicola infection was favoured at 27ºC. There was little 

difference in the infection of grape berries by C. acutatum at 

either temperature (Table 1). 

The colonisation of grape berries by B. cinerea was not affected 

by co‐inoculation with either C. acutatum or G. uvicola at 20ºC 

but was reduced at 27ºC. Conversely the growth of C. acutatum 

and G. uvicola was reduced by co‐inoculation with B. cinerea at 

20ºC and not at 27ºC. G. uvicola failed to colonise any berries at 

20ºC when co‐inoculated with B. cinerea. C. acutatum also 

reduced berry infection by G. uvicola when co‐inoculated at 

either temperature. G. uvicola had no effect on berry 

colonisation by C. acutatum at either of the temperatures 

examined. 

vinifera cv. Cabernet Sauvignon berries (22.4º Brix). Control berries were 

water inoculated. 

Treatment 

% berries infected with 

Inoculum Temp ºC B. cinerea C. acutatum G. uvicola 

Control 20 0 0 0 

27 0 0 0 

Bc 20 92 ‐ ‐ 

27 65 ‐ ‐ 

Ca 20 ‐ 96 ‐ 

27 ‐ 100 ‐ 

Gu 20 ‐ ‐ 57 

27 ‐ ‐ 99 

Bc + Ca 20 82 65 ‐ 

27 29 97 ‐ 

Bc + Gu 20 95 ‐ 0 

27 46 ‐ 99 

Ca + Gu 20 ‐ 95 12 

27 ‐ 96 55 

Bc + Ca + + 20 88 28 0 

Gu 27 45 96 45 

B. cinerea is frequently associated with bunch rot of grapes in 

cool climates. Our results support earlier observations on the 

optimum climatic conditions for grey mould development (2). 

The sub‐tropical climatic conditions of regions experiencing Ripe 

Rot and Bitter Rot are likely to pre‐dispose berries to these 

diseases. Our additional observations (unpublished data) on the 

relative growth rates of the three pathogens on PDA, at a range 

of temperatures, support this hypothesis and may partially 

explain the absence of grey mould in sub‐tropical vineyards. 


This work was supported by the Winegrowing Futures Program, 

a joint initiative of the Grape and Wine Research and 

Development Corporation and the National Wine and Grape 

Industry Centre. 

REFERENCES 

1. Steel CC, Greer LA, Savocchia S (2007) Studies on Colletotrichum 

acutatum and Greeneria uvicola: Two fungi associated with bunch 

rot of grapes in sub‐tropical Australia. Australian Journal of Grape 

and Wine Research 13, 23–29. 

2. Broome JC, English JJ, Marois BA, Latorre BA & Aviles JC (1995) 

Development of an infection model for Botrytis bunch rot of grapes 

based on wetness duration and temperature. Phytopathology 85, 

97–102 

These observations were further confirmed by inoculating grape 

berries with all three bunch rot pathogens at the same time. At 

20ºC B. cinerea was the pre‐dominant pathogen while at 27ºC C. 

acutatum predominated. 

Table 1. Effect of co‐inoculating Colletotrichum acutatum (Ca), Greeneria 

uvicola (Gu) and Botrytis cinerea (Bc) on disease expression in Vitis 


Posters 

72 Genetic diversity of Iranian Fusarium oxysporum f. sp. ciceris by RAPD molecular 

markers 

Sara Haghighi{ XE "Haghighi, S." } 1 , Saeed Rezaee 2 , Bahar Morid 2 , Shahab Hajmansoor 2 

1 Islamic Azad University, Damghan Branch, Iran, sara_haghighi1026@yahoo.com 

2 Islamic Azad University, Science and Research Branch Tehran, Iran 

INTRODUCTION 

Fusarium oxysporum Schlecht, Emend (Snyder & Hansen) is one 

of the most important soilborn plant pathogens with a 

worldwide distribution. One of the most important crops in Iran 

is the Iranian chickpea (Cicer arietinum L.) with the annual 

production of 260,000 tons from 755,000 hectares. Fusarium 

wilt of chickpea is a devastating disease in chickpeas growing in 

different regions of Iran. This fungal disease is caused by 

Fusarium oxysporum f.sp. ciceri. Characteristic symptoms of 

disease are leaves necrosis, yellowing, vascular wilt and 

damping‐off (2). 

Iran is the world’s fourth important chickpea producing 

countries and, this pathogen can reduce yield about 15%, so an 

investigation of genetic diversity of this pathogen in the regions 

seems to be of great significance. 


Thirty isolates of Fusarium oxysporum f.sp. ciceri with different 

geographical origins were chosen for genetic diversity studies. In 

vitro pathogenicity tests were performed using a root‐dip assay, 

cluster analysis of the isolates classified into three categories of 

highly, moderate and weakly virulent groups. DNA extraction 

was performed using Readers & Borda method with few 

modifications (3). For RAPD analysis thirty random primers were 

screened and ten primers producing the highest number of 

scorable bands were selected for the final analysis (Table 1). 20 

ng of genomic DNA from each isolate was amplified with the 

selected primers. Amplified DNA was cluster analysed using 

MVSP software and UPGMA method with jaccard coefficient. 

Table 1. Sequence of primers used in this study. 

primers Sequences 5 –3 

1 CCG GCC TTA G 

2 ACC GGG TTT C 

3 GGG GGG ATC A 

4 CCT GGC GGT A 

5 CCT GTG CTT A 

6 CCT GGG CTT G 

7 CCT GGG GGT T 

8 CCT GGG CTT C 

9 CCT GGG CCT A 

10 CCT GGG TTC C 


Results showed that there is a high genetic diversity among F. 

oxysporum isolates. Honnareddy & Dubey (2005) probed the 

genetic diversity of the aforementioned fungus utilising RAPD 

technique and isolates were classified into seven categories (1). 

Singh (2006) through the investigations performed on 30 isolates 

of F. oxysporum f.sp. ciceri collected from North India, observed 

little genetic variability and classified the isolates into three 

clusters (4). 

Through our investigation of polymorphic bands, 15 bands were 

observed. Considering a 70% similarity on dendrogram diagram 

genotypes were classified into 8 clusters (figure 1). Our results of 

RAPD‐PCR demonstrated the existence of polymorphism in the 

fungi populations, and a high genetic diversity was also observed 

among isolates under investigation. According to existence or 

non‐existence of bands, the genotypes classification has not 

matched geographical localisation. With respect to the fact that 

there is no significant correlation between the geographical 

origin of isolates and polymorphic bands, the occurrence of such 

a condition could be the result of seed exchange between the 

farmers. 

It seems that the more the polymorphic bands are the more is 

the possibility of recombination and genetic diversity in 

pathogens which is in turn due to their ability to mutate and 

anastomosis with other isolates. This will result in resistance 

break down against the pathogen in resistant cultivars. Due to 

the fact that resistant cultivars are used to control this disease, 

when genetic characteristic of the pathogen population changes 

continuously, we should prevent resistance break down by 

relentless reviewing of the genetic diversity on the one hand and 

searching for new resistant cultivars on the other hand. 

UPGMA 

F 25 

F 28 

F 22 

F 6 

F 5 

F 29 

F 23 

F 26 

F 21 

F 8 

F 30 

F 24 

F 20 

F 3 

F 14 

F 16 

F 27 

F 7 

F 4 

F 12 

F 18 

F 11 

F 19 

F 9 

F 15 

F 10 

F 2 

F 17 

F 13 

F 1 

0.04 0.2 0.36 0.52 0.68 0.84 1 

Jaccard's Coefficient 

Figure 1. Dendogram derived from RAPD analysis of Fusarium oxysporum 

f.sp. ciceri by UPGMA. 

REFERENCES 

1. Honnareddy N and Dubey SC (2005) Pathogenic and molecular 

characterization of Indian isolates of Fusarium oxysporum 

F.sp.ciceris causing chickpea wilt. Current science 5, 662–666. 

2. Nelson P (1981) Life cycle and epidemiology of Fusarium 

oxysporum. In ‘Fungal wilt diseases of plants’. (Eds ME Mace, AA 

Bell, CH Beckman) pp. 51–80. (Academic Press: New York). 

3. Reader V and Borda P (1985) Rapd preparation of DNA from 

filamentous fungi. Lett. Appl. Microbiology 1, 17–20. 

4. Singh BP, Saikia R, Yadav M, Singh R, Chauhan VS, and Arora DK 

(2006) Molecular characterization of Fusarium oxysporum 

F.sp.ciceris causing wilt of chickpea. African Journal of 

Biotechnology 5, 497–502. 


49 Development of nationally endorsed diagnostic protocols for plant pests 

B.H. Hall{ XE "Hall, B.H." } A , J. Moran B , J. Plazinski C , M. Whattam D , S. Perry E , V. Herrera F , P. Gray C , D. Hailstones G , M. Glen H , J. La Salle I 

A South Australian Research and Development Institute, GPO Box 397, Adelaide 5001, South Australia 

B Department of Primary Industries, Victoria Private Bag 15, Ferntree Gully DC 3156, Victoria 

C Office of the Chief Plant Protection Officer, GPO Box 858, Canberra 2601, ACT 

D AQIS, Private Bag 19, Ferntree Gully 3156, Victoria 

E Biosecurity Queensland, GPO Box 46, Brisbane 4001, Qld 

F MAF Biosecurity New Zealand, PO Box 2049, Auckland 1140, New Zealand 

G CRC Diagnostics Research Program, NSW DPI, PMB 8 Camden 2570, NSW 

H CSIRO Sustainable Ecosystems, Private Bag 12, Hobart 7001, Tasmania 

I CSIRO Entomology, GPO Box 1700, Canberra 2601, ACT 

Posters 

INTRODUCTION 

In 2005, a new “committee on plant diagnostics and laboratory 

accreditation” was formed as a subcommittee of Plant Health 

Committee (PHC). Called the Subcommittee for Plant Health 

Diagnostic Standards (SPHDS), the primary goal was to 

“establish, implement and monitor professional and technical 

standards within plant health diagnostic laboratories through 

the development and maintenance of an accreditation system 

and national diagnostic standards”. 

The Diagnostic Standards Working Group (DSWG) of SPHDS has 

developed a set of reference standards (1) to assist potential 

authors in developing diagnostic protocols for the detection and 

identification of plant pests, particularly the 253 organisms 

categorised as being of high importance under the Emergency 

Plant Pest Response Deed (2) and Industry Biosecurity plans. The 

standards are consistent with the international standard for 

diagnostic protocols for regulated pests. (3) 

PROTOCOL DEVELOPMENT 

National Diagnostic Protocols are defined as “A PHC endorsed 

Australian document containing detailed information about a 

specific plant pest or group of plant pests relevant to its 

diagnosis”. They are designed to assist diagnosticians in the 

identification of a specific pest and include data on the pest, its 

hosts and taxonomy, methods for detection and identification, 

acknowledgements, references and contacts for further 

information. 

New protocols are often developed with the assistance of a 

scholarship to work in an overseas laboratory, as it is not always 

possible to bring positive controls into Australia. Information for 

many of the pests of concern is available on the Plant Biosecurity 

Toolbox (4), part of the Pest and Disease Image Library (PaDIL). 

Draft protocols are developed by authors utilising information 

from the Plant Biosecurity Toolbox and then submitted to SPHDS 

for assessment. 

ASSESSMENT PROCESS 

When protocols are submitted to SPHDS, the DSWG form an 

Assessment Panel, comprising members of DSWG and other 

“experts” as deemed necessary by SPHDS. The protocols are 

assessed using the criteria outlined in Reference Standard (RS) 

No. 3 (1). In collaboration with the author, the Assessment Panel 

facilitates verification and peer review of the protocol according 

to RS No. 4 (1). Verification is undertaken by an independent 

laboratory with the aim of demonstrating whether the 

diagnostic procedures can be followed. Peer review is where an 

expert of the pest area reviews the accuracy and currency of the 

scientific information provided in the submitted diagnostic 

protocol, similar to a journal review. Once both Verification and 

Peer Review reports are received by SPHDS, the Assessment 

Panel reconvenes and determines whether the protocol has 

been deemed acceptable, or more revision is required. 

Once accepted, the Assessment Panel recommends to SPHDS 

that the completed protocol be submitted to PHC with a 

recommendation for endorsement as a National Diagnostic 

Standard. 

ENDORSED NATIONAL DIAGNOSTIC PROTOCOLS 

Protocols endorsed by PHC are placed as a version controlled 

document on the SPHDS website (5) to be used as part of a 

national response to emergency plant pest incidents for specific 

pest species. In some instances they may also be suitable for use 

in surveys to demonstrate evidence of absence to enable market 

access of Australian produce. 

Currently there are two endorsed protocols: 

NP1—Apple Brown Rot (Monilinia fructigena) 

NP2—Plum Pox Virus 

The protocols are reviewed every three years and if necessary 

are subject to rewriting and resubmission to SPHDS. 

FUTURE WORK 

DSWG is in the process of facilitating the verification and peer 

review of another 15 protocols. It is anticipated that at least 10 

of these will be completed and endorsed by the end of 2009. 

With 253 important pests on the list to do, not counting other 

high risk regulated pests and others that may appear 

unexpectedly, there is still a lot of work ahead. 

REFERENCES 

1. SPHDS Reference Standards. http://www.daffa.gov.au/animalplanthealth/plant/committees/sphds/national_diagnostic_protocol_gui 

delines_and_reference_standards (viewed 30 April 2009). 

2. Emergency Plant Pest Response Deed (EPPRD). 

http://www.planthealthaustralia.com.au/project_documents/displ 

ay_documents.asp?category=15 (viewed 30 April 2009). 

3. International Standards for Phytosanitary Measures No. 27 

Diagnostic Protocols for Regulated Pests (2006) www.ippc.int 

4. PaDIL Toolbox. http://www.padil.gov.au/pbt/ (viewed 30 April 

2009) 

5. SPHDS National Diagnostic Protocols. 

http://www.daffa.gov.au/animal‐planthealth/plant/committees/sphds/national_diagnostic_protocol_gui 

delines_and_reference_standards/national_diagnostic_protocols_f 

or_emergency_plant_pests (viewed 30 April 2009). 


Posters 

96 Subcommittee on Plant Health Diagnostic Standards 

M.A. Williams A , B.H. Hall{ XE "Hall, B.H." } B , J. Plazinski C , P. Gray C , J. Moran D , P. Stephens E , S. Perry F 

A Department of Primary Industries and Water 13 St John’s Ave, New Town, 7008, Tas 

B South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001, SA 

C ffice of the Chief Plant protection Officer, Department of Agriculture, Fisheries and Forestry, GPO Box 858, Canberra, 2601, ACT 

D Department of Primary Industries, Victoria, Private Bag 15, Ferntree Gully, 3156, Vic 

E Department of Regional Development, Primary Industry, Fisheries and Resources, PO Box 3000, Darwin, 0801, NT 

F Department of Employment, Economic Development and Industry, GPO Box 46, Brisbane, 4001, QLD 

INTRODUCTION 

In 2005, a new “committee on plant diagnostics and laboratory 

accreditation” was formed as a subcommittee of Plant Health 

Committee (PHC). Called the Subcommittee for Plant Health 

Diagnostic Standards (SPHDS), the primary goal was to 

“establish, implement and monitor professional and technical 

standards within plant health diagnostic laboratories through 

the development and maintenance of an accreditation system 

and national diagnostic protocols”. This is all part of a push to 

facilitate activities that will enhance Australia’s plant biosecurity. 

WORK IN PROGRESS 

Laboratory accreditation: Several different models were 

explored with accreditation to the international standard AS 

ISO/IEC 17025 (1) adopted as the way forward. Steps in 

development of a Field Application Document (FAD) included: 

draft FAD incorporating plant health diagnostic testing with the 

requirements for Veterinary Testing, independent FAD for the 

field of Plant Health Diagnostic Testing and, most recently, 

incorporation of plant health testing requirements into the 

Biological Testing FAD. 

A revised edition of the Biological Testing FAD incorporating a 

Plant Health Diagnostic Testing Annex should appear on the 

NATA website shortly (5). 

Diagnostic Protocols. The Diagnostic Standards Working Group 

(DSWG) of SPHDS has developed a set of reference standards (2) 

to assist potential authors in developing diagnostic protocols for 

the detection and identification of plant pests, particularly those 

categorised as being of high importance. These reference 

standards provide a standardised format for protocols and 

describe a process for assessment involving verification and peer 

review (2). Most, but not all, of the organisms on the list for 

protocol development come from the Emergency Plant Pest 

Response Deed (4) and from industry biosecurity planning 

processes. 

Currently two National Diagnostic Protocols have been endorsed 

by Plant Health Committee and can be found on the SPHDS 

website (3). 

• National Diagnostic Strategy. PHC has charged SPHDS with 

developing a National Diagnostic Strategy for plant health. 

This is additional to the National Plant Health Strategy 

developed by Plant Health Australia. 

• Training Workshops. One of SPHDS tasks is to prioritise and 

coordinate training in the diagnostic community. 

FUTURE ACTIVITIES 

Enhancing plant biosecurity for Australia is integral to successful 

plant health management. Having readily available, soundly 

based, diagnostic protocols for plant pests plays an important 

role. The magnitude of the task facing DSWG is illustrated by the 

over 230 plant pests listed in Table 4 of the National Plant Health 

Status Report(6) that require protocol development. Laboratory 

accreditation assures quality and integrity of the results 

produced and provides confidence to biosecurity administrators 

in managing biosecurity emergencies. Information on plant 

health laboratory accreditation and what it means for plant 

health diagnosticians will be prepared. 


The guidance of NATA staff in preparation of the FAD documents 

is gratefully acknowledged. 

REFERENCES 

1. AS ISO/IEC 17025: 2007 General requirements for the competence 

of testing and calibration laboratories. referred to generally as ‘ISO 

17025’ 

2. SPHDS Reference Standards. http://www.daffa.gov.au/animalplanthealth/plant/committees/sphds/national_diagnostic_protocol_gui 

delines_and_reference_standards (viewed 30 April 2009). 

3. SPHDS www.daff.gov.au/sphds (viewed on 18 May 2009) 

4. Emergency Plant Pest Response Deed (EPPRD). 

http://www.planthealthaustralia.com.au/project_documents/displ 

ay_documents.asp?category=15 (viewed 30 April 2009). 

5. NATA http://www.nata.asn.au/ (viewed 18 May 2009) 

6. Plant Health Australia, 2009 The National Plant Health Status 

Report (07/08), Canberra, ACT 

Diagnostic Services. Diagnostic service capability and capacity in 

Australia is a critical issue. SPHDS is involved in multiple ways of 

highlighting the issues and developing strategies. These include: 

• DAFF Training scholarships, administered by SPHDS, help to 

increase diagnostic capacity by sending diagnosticians 

overseas for training. There is an expectation that a draft 

diagnostic protocol would be an outcome of a scholarship. 

Scholarships have been awarded each year since 2004. 

Thirty‐eight scholarships had been awarded by the end of 

2008. 


97 What is laboratory accreditation and what will it mean for me and my laboratory? 

M.A. Williams A , P. Gray B , N. Kelly C , J. Cunnington D , P. Stephens E , R. Makin F and S. Peterson G , B.H. Hall{ XE "Hall, B.H." } H 

A Department of Primary Industries and Water, 13 St John’s Ave, New Town, 7008, Tasmania 

B Office of the Chief Plant protection Officer, Department of Agriculture, Fisheries and Forestry, GPO Box 858, Canberra, 2601, ACT 

C NSW Department of Primary Industries, PMG 8, Camden, 2570, NSW 

D Department of Primary Industries, Victoria, Private Bag 15, Ferntree Gully, 3156, Vic 

E Department of Regional Development, Primary Industry, Fisheries and Resources, PO Box 3000, Darwin, 0801, NT 

F National Association of Testing Authorities, PO Box 7507, Silverwater, 2128, NSW 

G Plant Health Australia, 5/4 Phipps Close, Deakin, 2600, ACT 

H South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001, SA 

Posters 

INTRODUCTION 

Accreditation is seen as a key plank in supporting the 

improvement of capability and capacity in Australian plant 

health diagnostic laboratories to respond to biosecurity 

emergencies and is a key part of the business of Subcommittee 

on Plant Health Diagnostic Standards (1). 

There are two types of accreditation that could apply to plant 

health laboratories. The first of these examines the ability of a 

laboratory to secure and contain plant pests while undertaking 

diagnostic procedures and is administered by Australian 

Quarantine Inspection Service (AQIS). To this end a number of 

Quarantine Containment or QC Levels are recognised. This 

scheme is not discussed here. 

The second type of accreditation is an internationally recognised 

system for Quality Assurance based on the international 

standard AS ISO/IEC 17025 (2) administered in Australia by 

National Association of Testing Authorities (NATA) (3). This paper 

details the development of this scheme and how it will affect 

you. 


The support of NATA, Plant Health Australia and Plant Health 

Committee, the parent body of SPHDS, is gratefully 

acknowledged; together with the input from staff of already 

accredited laboratories who have given examples of what it 

means to be accredited from their perspective. 

REFERENCES 

1. Williams MA, Hall BH, Plazinski J, Gray P, Moran J, Stephens P 2009 

Subcommittee on Plant Health Diagnostic Standards. Submitted for 

‘Plant Health Management: An Integrated Approach’ APPS 2009. 

2. AS ISO/IEC 17025: 2007 General requirements for the competence 

of testing and calibration laboratories. Referred to generally as ‘ISO 

17025’. 

3. NATA www.nata.asn.au 


Several plant health diagnostic testing laboratories are currently 

accredited to AS ISO/IEC 17025 under the Biological Testing Field 

Application Document (FAD). An additional Annex to this FAD 

has been developed to specifically cover plant health diagnostic 

laboratories. 

To get to this stage, SPHDS explored several different models, 

with accreditation to the international standard AS ISO/IEC 

17025 (2) adopted as the way forward. Steps in development of 

a FAD included: drafting plant health diagnostic testing 

requirements for incorporation with the Veterinary Testing FAD, 

drafting an independent FAD for the field of Plant Health 

Diagnostic Testing and, most recently, incorporation of plant 

health testing requirements into the Biological Testing FAD. 

RESULTS 

A revised edition of the Biological Testing FAD incorporating a 

Plant Health Diagnostic Testing Annex should appear on the 

NATA website shortly (3). 

DISCUSSION 

There are significant advantages in developing and operating 

according to an internationally recognised quality assurance 

system. It is recognised that there are also some disadvantages 

including the cost associated with developing and maintaining 

the system. 

What will it mean to laboratories and individuals working in 

them? This will be discussed in the context of examples from 

laboratories already accredited. 


Posters 

26 In vitro fungicide sensitivity of Botryosphaeriaceae species associated with ‘bot 

canker’ of grapevine 

R. Huang{ XE "Huang, R." }, W.M. Pitt, C.C. Steel and S. Savocchia 

National Wine and Grape Industry Centre, Charles Sturt University, Locked Bag 588, Wagga Wagga, NSW, 2678 

INTRODUCTION 

Botryosphaeriaceae species are commonly associated with the 

grapevine trunk disease, ‘Bot canker’. This disease is a serious 

threat to the productivity and longevity of vineyards in Australia 

and begins when pruning wounds are infected by these fungi. 

Consequently, damage to the vascular system of the vine limits 

vegetative growth and reduces yield. Control strategies 

emphasise the protection of wounds against infection, and a 

number of chemicals have been screened in vitro for inhibition 

of the Botryosphaeriaceae (1). To date, there are still no 

fungicides registered for the management of ‘Bot canker’ in 

Australia. Based on a previous study (1), 10 fungicides were 

selected and further evaluated for their activity on four 

additional Botryosphaeriaceae species recently isolated from 

diseased grapevines in New South Wales and South Australia. 

The aims of this research were to determine the sensitivity of 

these species to chemical fungicides and to identify potential 

agents for management of the Botryosphaeriaceae. 


The active ingredients of 10 fungicides were evaluated in‐vitro 

for mycelial inhibition of five isolates each of Diplodia mutila, 

Neofusicoccum australe, Dothiorella viticola, and Dothiorella 

iberica (Table 1). Agar plugs (5 mm diameter) from the margins 

of actively growing four‐day‐old fungal cultures were transferred 

to fungicide‐amended‐agar plates. Fungicides were dissolved in 

acetone (

50 The impact and diversity of Mycosphaerella leaf disease isolated from Eucalyptus 

globulus in western australia 

Posters 

S.L. Jackson{ XE "Jackson, S.L." } A , A. Maxwell B , S.L. Collins C , M.C. Calver A , G.E.StJ. Hardy A and B. Dell A 

A School of Biological Sciences and Biotechnology, Murdoch University, Perth, Western Australia 6150 

B Australian Quarantine Service PO Box 606 Welshpool Western Australia 6986 

C ITC Ltd, PO Box 1421 Albany Western Australia 6331 

INTRODUCTION 

The most serious foliar disease of eucalypt plantations in WA is 

Mycosphaerella leaf disease (MLD) (1). Since the 

commencement of the plantation industry, several fungal 

species contributing to MLD, previously known only in eastern 

Australia or overseas, have been reported on E. globulus in WA. 

Initially only three species were identified (2). More recently, 

five new records from WA (M. aurantia, M. ellipsoidea, M. 

mexicana and M. fori) have been identified that have not been 

recorded elsewhere in Australia (1, 3). Currently, 13 species of 

Mycosphaerella have been recorded in WA from Eucalyptus (3). 

Re‐examination of cultures adds six new species that have yet to 

be described from E. globulus in WA. The impact of MLD on 

growth of E. globulus plantations in WA was examined in a 

chemical exclusion trial at two plantations in the Albany region. 


Plantations were surveyed over the period 2001–2006 for MLD 

and associated pathogens. Lesions from infected leaves were 

soaked 20–60 mins before being blotted dry and place on the lid 

of a Petri dish. Single spore isolations were made according to 

(1). Thirty spore measurements of each species were made at 

1000x magnification. The internal transcribed spacer region (ITS) 

was sequenced to confirm the identity of each species. 

To examine the effect of controlling MLD, an experiment was 

conducted on two (A and B) one‐year‐old commercial E. globulus 

plantations and consisted of four spray treatments (fungicide, 

insecticide, fungicide plus insecticide and non‐treated controls), 

replicated 5 times with 50 trees per replicate. This regime was 

designed to determine whether controlling pest and fungal 

diseases for 2–3 yrs increases above‐ground biomass at 2 and 5 

yrs. The systemic fungicide benomyl (Benlate ® , DU PONT 

Australia Ltd), and chlorothalonil (Bravo ® 500 DU PONT Australia 

Ltd) or chlorothalonil/ethylene glycol (Rover ® 500 Flowable, 

NUFARM Australia Ltd), were used alternately to ensure 

fungicide resistance would not occur. Alphacypermethrin 

(Dominex ® 100, Crop Care Australasia Pty Ltd) was applied 

regularly to control insects. Tree height and stem diameter were 

measured prior to the experiment (1 yr) and twice thereafter (3 

and 5 yrs). Volume was calculated using ITC’s standard equation 

and standardised for statistical analysis. 


The current study documents an increase in the number of 

Mycosphaerella species associated with E. globulus plantations 

in WA from 13 to 19. There are a number of important 

implications that arise from these detections including the 

potential impact on plantations in WA; biosecurity implications 

of the origin and spread of eucalypt diseases; and the ecological 

function of the diverse Mycosphaerella assemblage that is 

associated with Eucalyptus forests and plantations. 

volumes by 2.9%–13.5%. The critical question from a 

management viewpoint is whether the demonstrated increases 

in standardised tree volume were sufficient to warrant the cost 

of fungicide and insecticide treatments of the trees. Significantly, 

the plantations experienced a very low incidence of disease and 

pest attack during the trial period. Even so, the results clearly 

showed a significant difference between treatment types and 

disease outcome. This suggests that the use of chemical 

treatments may be useful in controlling disease outbreaks. 

However, the treatments most likely would have to be ongoing. 

Although MLD in WA occurs at relatively low levels compared to 

other states in Australia, the fact that the diversity of species has 

not yet stabilised is a concern. The number of new species 

isolated is steadily increasing, however, our knowledge of the 

biology and epidemiology of these organisms remains largely 

unchanged. M. cryptica and M. nubilosa are the two most 

important species found in WA. However, with the increasing 

number of species being recorded in WA, the chance of finding 

other significant pathogenic species is high. The industry should 

not remain complacent, and a concerted effort should be made 

to remain vigilant. Although field diagnosis remains problematic, 

monitoring plots across the state of varying ages should be 

established and outbreaks investigated in detail. The efficacy of 

Forest Stewardship Council accredited fungicides on MLD should 

be investigated in case of severe outbreaks in the future. 


This work was part of an ARC Linkage (LP0219585). ITC Ltd was 

the industry partner and their financial and in kind support is 

gratefully acknowledged. 

REFERENCES 

1. Maxwell A, Dell B, Neumeister‐Kemp HG and Hardy GEStJ (2003) 

Mycosphaerella species associated with Eucalyptus in southwestern 

Australia: new species, new records and a key. Mycological 

Research 107 pp. 351–359. 

2. Carnegie AJ, Keane PJ and Podger FD (1997) The impact of three 

species of Mycosphaerella newly recorded on Eucalyptus in 

Western Australia. Australasian Plant Pathology 26 pp. 71–77. 

3. Jackson SL, Maxwell A, Burgess TI, Dell B and Hardy GEStJ (2008) 

Incidence and new records of Mycosphaerella species within a 

Eucalyptus globulus plantation in Western Australia. Forest Ecology 

and Management 255 pp. 3931–3937. 

While site differences had the greatest effect on standardised 

tree volumes of blue gums between 2002 and 2004 in the 

chemical trials, there were also significant treatment effects. The 

application of fungicides and insecticide increased wood 


Posters 

8 Efficacy of pre‐seeding fungicides for control of barley loose smut 

K.W. Jayasena{ XE "Jayasena, K.W." } A , G. Thomas B , W. J. MacLeod B , K. Tanaka A and R. Loughman B 

A Department of Agriculture and Food, 444 Albany Hwy, Albany, 6330, Western Australia 

B Department of Agriculture and Food, 3 Baron‐Hay Court, South Perth, 6151, Western Australia 

INTRODUCTION 

In recent years, loose smut caused by Ustilago nuda (Jensen) 

Kellerman & Swingle has been seen widely and caused yield 

losses in barley (Hordeum vulgare L.) crops along the south coast 

of Western Australia (WA). Barley is an increasingly important 

crop in this region, which has an environment suited to spread 

and development of this disease. All the major malting barley 

varieties grown in WA, including Baudin which is widely adopted 

in this region, are susceptible to loose smut. Increased barley 

cropping area in disease favourable environments, widespread 

utilisation of susceptible varieties and changes in seeding 

fungicide usage towards fertiliser applied fungicide to manage 

diseases such as powdery mildew has raised concern amongst 

WA south coast barley producers over the re‐emergence of 

loose smut. The aim of the current study was to evaluate the 

efficacy of some pre‐seeding fungicides available in the 

Australian market for loose smut control. 


At three geographically separate locations, field trials were 

carried out using naturally infected seed of Baudin barley. The 

fungicide rates used are shown in Table 1. All trials were 

randomised block designs with four replicates. Assessments 

were made at each site of tiller counts, loose smut incidence and 

grain yield. 


Significant reductions in disease transmission were evident from 

most of the treatments, however none of the tested products 

completely eradicated transmission of loose smut (Table 1). The 

level of disease transmission and the relative efficacy of some 

fungicide products varied between experimental sites, as 

previously reported by Loughman et al. (1). Triadimenol 

(Baytan), triticonazole (Real) and tebuconazole (Raxil) based 

products significantly reduced loose smut at all sites. At the rates 

used in these experiments, fluquinconazole (Jockey) and 

difenoconazole (Dividend) gave variable responses, being 

effective at only some of the experimental sites. Triadimefon 

(Triad IF) applied to fertiliser and banded with seed was 

ineffective at all sites. Yield responses to fungicide applications 

were noted at Gibson, ranging from 4.6 to 5.1 t/ha and Mt 

Barker 3.9 to 4.4 t/ha respectively. Increased yield at these two 

sites does not appear related to loose smut control but was 

possibly due to reductions in foliar diseases such as powder 

mildew. The yield at Avondale ranging from 2.6 to 2.8 t/ha and 

treatment difference were not significant (data not shown). 

management strategies to combat loose smut and other 

diseases. Increased availability of varietal resistance to control 

loose smut would assist in the management of the disease and 

could simplify control and management options where loose 

smut has traditionally occurred with other diseases of barley. 

Table 1. Effect of seed dressing and in‐furrow fungicides on loose smut 

incidence in Baudin barley at Avondale, Mt Barker and Gibson, 2005. 

Incidence infected heads 

(% heads infected) ** 

Treatments * Avondale Mt Barker Gibson 

Untreated 0.39 (3.5) a† 0.15 (2.2) a 0.07 (1.5) a 

Dividend LO 0.30 (3.0) ab 0.08 (1.5) a 0.10 (1.8) a 

Jockey LO 0.13 (1.9) c 0.08 (1.5) a 0.06 (1.4) a 

Baytan LO 0.15 (2.2) bc 0.00 (0.0) b 0.01 (0.4) b 

Real LO 0.10 (1.7) c 0.01 (0.2) b 0.00 (0.2) b 

Raxil L 0.07 (1.4) c 0.01 (0.4) b 0.02 (0.6) b 

Triad IF O 0.42 (3.7) a 0.17 (2.2) a 0.07 (1.3) a 

p

73 The cause of the barley leaf rust in Western Australia is a typical Puccinia hordei 

Y. Anikster A , K.W. Jayasena{ XE "Jayasena, K.W." } B , T. Eilam A and J. Manisterski A 

A Institute for Cereal Crops Improvement, Tel Aviv University, Ramat Aviv, 69978, Israel 

B Department of Agriculture and Food, 444 Albany Hwy, Albany, 6330, Western Australia 

Posters 

INTRODUCTION 

Leaf rust of barley caused by Puccinia hordei exists in most areas 

in which barley is grown. The Australian populations of this rust 

fungus, especially those of Western Australia (WA), are isolated 

from mainland Asian and South African populations by 

thousands of kilometers. 

It is of great interest to compare characters (other than 

pathotypes) of the WA rust population to the Israeli, because 

Israel is located in the centre of the cultivated barley origin. The 

wild ancestor—Hordeum spontaneum and the alternate host— 

Ornithogalum spp. still exist in the area. The sexual stage of 

barley leaf rust is found annually all over the northern part of 

Israel. 


Teliospore germination and inoculation of alternate aecial host. 

Telia originated on cultivated barley fields from the southern 

region of WA and from wild barley (H. spontaneum) in central 

Israel, were used for inducing teliospore germination and 

inoculate O. eigii plants in the greenhouse (1). 

DNA content of pycniospore nuclei. Pycniospores were 

harvested from pycnial clusters on O. eigii. Stained for 2h with 

propidium iodide in TRIS‐HC1 buffer containing RNAse and 

TritonX‐100. Relative DNA content was determined by flow 

cytometer (FACS). Fluorescence intensity was measured (1). 

Teliospores morphology. Teliospores were mounted in 50% 

glycerol on glass slides. Images were obtained with a digital 

camera. Spore dimensions were analysed using image analysis 

software. 

Staining of Substomatal Vesicles (SSV). Segments taken from 

inoculated barley leaves were microwaved in 0.03% trypan‐blue 

in lactophenol‐ethanol for 60 s, cleared in chloral hydrate, and 

mounted in lactophenol for microscope examination. Images 

were taken with digital camera (1). 


Teliospore germination and inoculation of the alternate host. 

Figure 1 shows the pycnial and aecial clusters of P. hordei on O. 

eigii. The WA isolates proved to be infectable (after inducing 

teliospore germination) to the alternate host—O. eigii, pycnial 

and aecial clusters were found (Fig. 1B). The aeciospores were 

infectable on barley seedlings, giving rise to uredinial sori 

(greenhouse experiments). 

Crosses between WA and Israeli isolates. Crosses of WA isolates 

and Israeli isolates in both directions of nectar transfer could be 

achieved, and gave rise to aecial clusters (Fig. 1A). Analysis of 

differential host range of the hybrids in comparison to their 

parents is not of the scope of this abstract (2). 

Figure 1. Pycnial and aecial clusters 

of P. hordei on O. eigii, after 

artificial inoculation in the 

greenhouse (21±2 ºC). A). Single 

aecial cluster (at the center of it a 

few pycnia may be seen). 

Inoculation with Israeli isolate 

#1930, fertilisation of the pycnial 

cluster with pycniospores of WA 

isolate #22507. B). Pycnia and aecia can be seen along the rachis and fruit after 

inoculation with WA isolate #22507. 

Figure 2. Histograms showing 

number of nuclei of given 

fluorescence intensities obtained 

by flow cytometry for propidium 

iodide—stained pycniospores of 

the leaf rust isolates of A). Israeli 

#1946 B). WA #22507. About 10000 

pycniospores were measured in 

each FACS run. The similar position 

of the two histograms on the X axis 

points out a similar content of 

nuclear DNA in the pycniospores of both isolates. 

Figure 3. Teliospores of P. 

hordei isolates from A). Israeli 

#1963 and B). WA #22507 and 

dimensions. Bar = 20 µm for 

both figures. Dimensions: area 

(µm 2 ), length (µm) and width (µm); A): 774±101, 47±5 and 21±2; B): 776±96, 45±5 

and 22±2. 

Figure 4. Uredinial 

substomatal vesicles (SSV) 

formed in barley cultivar L‐94 

by: A). Israeli isolate #1930, 

and B). WA isolate #22507. 

SSV—substomatal vesicle; ms 

– median septum; h‐ hyphae; st—invaded stoma. The SSV of the two isolates are 

very similar in shape and in dimension. Bar = 20µm. 

Our results give rise to the opinion that despite geographic 

isolation, the WA population of P. hordei is taxonomically similar 

to isolates from outside Australia. It may have either reached 

Australia quite recently (in an evolutionary sense a few hundred 

years ago) with a very low rate of changes or there is some way 

of connection (winds, or another way) of the WA population and 

international populations. 


Authors wished to thank Drs. Robert Park, University of Sydney 

and Robert Loughman, Department of Agriculture and Food 

Western Australia for initial reviewing of the abstract. 

REFERENCES 

1. Anikster Y, Eilam T, Manisterski J, Leonard KJ (2003) Self‐fertility 

and other distinguishing characteristics of a new morphotype of 

Puccinia coronata pathogenic on smooth brome grass. Mycologia 

95, 87–97. 

2. Anikster Y (1984) Parasitic specialization of Puccinia hordei in Israel. 


Nuclear DNA content spore morphology and SSV. Comparison 

of the isolates from WA and Israeli by DNA content, spore 

morphology and SSV show very close similarities (Figs. 2, 3, 4). 


Posters 

27 The value of combined use of genetic resistance and fungicide application for 

management of stripe rust 

K.W. Jayasena{ XE "Jayasena, K.W." } A , G. Thomas B , R. Loughman B , K. Tanaka A and W. J. MacLeod B 

A Department of Agriculture and Food, 444 Albany Hwy, Albany, 6330, Western Australia 

B Department of Agriculture and Food, 3 Baron‐Hay Court, South Perth, 6151, Western Australia 

INTRODUCTION 

Stripe rust (yellow rust) of wheat (Triticum aestivum L.) caused 

by Puccinia striiformis f. sp. tritici was first detected in Western 

Australia (WA) in 2002. Regional outbreaks have caused 

considerable yield losses, particularly in susceptible wheat 

varieties. Wheat varieties grown in WA range from susceptible 

to resistant, with many exhibiting varying degrees of partial 

resistance. The most effective use of fungicides in combination 

with these varying levels of resistance is poorly understood. The 

aim of the present study was to determine how varieties with 

different levels of rust resistance respond to fungicide for the 

control of stripe rust. 


Varieties with a range of stripe rust resistance, EGA Bonnie Rock 

(S‐VS), Carnamah (MS‐S), Wyalkatchem (MS), Janz (MR‐MS) and 

GBA Ruby (R) were tested in combination with 3 fungicide 

treatments, being either nil, partial or full fungicide control, 

during 2007 and 2008. Trial design was split plot with four 

replications. Full control consisted of tebuconazole (Folicur 

430SC) @ 290 mL/ha applied at early stem elongation (Z31), flag 

leaf emergence (Z39/40), ear emergence (Z55) and late 

flowering (Z68) to provide maximum disease protection and 

yield potential. Partial fungicide control consisted of a single 

application at ear emergence (Z55) in 2007 or two applications 

commencing with the first sign of the stripe rust (Z32) and again 

at ear emergence (Z55) in 2008. In 2007, the trial was sown on 5 

July, adjacent to susceptible wheat (cv. Harrismith) inoculated 

twice on 30 July and 23 August to generate inoculum. In 2008 

the trial was sown 20 June adjacent to susceptible wheat (cv. 

Westonia) that was inoculated with stripe rust on 24 July. 


In both years, the stripe rust was evident between stem 

extension and flag leaf emergence. In 2007, the stripe rust 

severity ranged from 4 to 96% in untreated control plots of the 

five varieties whereas in 2008, it varied from 6 to 93% (Figure 

1a). GBA Ruby had no response to fungicide for stripe rust 

control. Application of fungicides either as single, double or 

multiple sprays reduced the stripe rust levels in all other wheat 

varieties, in both years. Under these experimental 

circumstances, where the varieties were subject to continuous 

high disease pressure from nearby infected susceptible wheat, 

partial fungicide control was less effective than full control with 

multiple fungicide sprays in Carnamah, EGA Bonnie Rock, Janz, 

and Wyalkatchem. 

Over two years, extreme yield loss (87–94%) was observed in 

EGA Bonnie Rock (Figure 1b). In Janz and Wyalkatchem, partial 

resistance reduced the impact of stripe rust however yield losses 

of 27–54% were still observed. Partial control combined with 

partial resistance reduced yield losses to 17–30%, depending on 

variety. Application of fungicides significantly increased the yield 

and hectolitre weight in all the varieties tested except for GBA 

Ruby. 

In 2007, screenings varied from 3.3 to 18.4% among the 

untreated varieties whereas in 2008, it was 0.8 to 7.9% (data not 

shown). EGA Bonnie Rock had higher screenings in both years. 

These experiments demonstrate the effect of single major gene 

resistance. Under high disease pressure, stripe rust infection in 

GBA Ruby was very low and maximum yield was achieved 

without fungicide protection. However, Australian and 

international experience is that single major gene resistance to 

stripe rust, though highly effective, is not durable while multiple 

gene resistance is more robust. GBA Ruby carries Yr27, which is 

currently fully effective in WA but recent reports indicate 

development of Yr27 virulence in the stripe rust population in 

eastern Australia. 

Under very high disease pressure, the varieties with partial 

resistance genes such as Janz and Wyalkatchem showed high 

levels of infection; however yield was significantly greater than 

in susceptible types. With the partial fungicide protection, 

significant yield benefits were obtained. In environments which 

are less conducive to stripe rust, the value of partial resistance 

would be expected to be greater. 

Major gene resistance provides maximum protection from stripe 

rust, however many of the varieties preferred by Western 

Australian grain producers utilise some level of partial resistance 

rather than single gene resistance. In general, partial resistance 

to stripe rust combined with strategic fungicide application can 

be used to minimise yield losses and restrict epidemic 

development. 

a 

% stripe rust severity 

b 

Yield (t/ha) 

(av. Fnec to av. F-1ne 

5 

4 

3 

2 

1 

0 

100 

80 

60 

40 

20 

0 

Untre ate d P ar tial C o n tr o l Fu ll C o n tro l 

V1 V2 V3 V4 V5 V1 V2 V3 V4 V5 

lsd 5% = 14 w he at varie tie s 

lsd 5% = 10 

lsd 5% = 0 .4 

2007 

2007 2008 

Untre ate d Partial Control Full Control 

2008 

V1 V2 V3 V4 V5 V1 V2 V3 V4 V5 

lsd lsd 5% 5% = 0.4 w he at varie tie s 

lsd 5% = 0.6 

lsd 5% = 0.6 

Figure 1. Response of five wheat varieties (V1—EGA Bonnie Rock; V2— 

Carnamah; V3—Wyalkatchem; V4—Janz; V5—GBA Ruby) with different 

resistance levels to fungicide application for control of stripe rust. a) 

average stripe rust severity assessed on two top leaves which showing 

necrosis due stripe rust infection at milk development stage and, b) 

yield, in 2007 and 2008 at Manjimup, WA. 


Many thanks to Mr Ian Guthridge, DAFWA, at Manjimup 

Horticulture Research Institute for help with field operations. 

This work was supported by Grains Research and Development 

Corporation (DAW00159). 


9 Specific genetic fingerprinting of Pseudomonas syringae pv. syringae strains from 

stone fruits in Iran with REP sequence and PCR 

Posters 

S. Ketabchi{ XE "Ketabchi, S." } A 

A Department of Plantpathology Shiraz Islamic Azad University, POX 71365‐364, Shiraz, Iran 

INTRODUCTION 

Bacterial canker and blast of stone fruit trees, caused by 

Pseudomonas syringae pv.syringae affects all commercially 

grown Prunus species in province of Shiraz in Iran. The 

relationship between P. syringae pv. syringae strains infecting 

Prunus species and strains that infect other crops such as, 

cereals, is unknown and needs to be elucidated Molecular 

analysis of genomic variability has been used to differentiate and 

classify bacterial strains below the level of species repetitive 

Extragenic palindromic (REP), which are short repetitive DNA 

sequences with highly conserved central inverted repeats that 

are dispersed throughout the genomes of diverse bacterial 

species (1), have been used to design universal PCR primers that 

generate highly reproducible, strain‐specific fingerprints that can 

differentiate bacterial strains below the level of species or 

subspecies. The objective of this study was to identify and 

characterise strains of P. syringae pv. syringae isolated from 

various Prunus species and other plant hosts by using Rep‐PCR 

analysis. 


Strain isolation. Samples of both healthy and diseased tissues 

from stone fruit trees were collected from different orchard of 

Iran 

Rep‐PCR. Rep primers The PCR conditions were as previously 

described (21, 32) DNA fragments in the gel were visualised by 

staining with ethidium bromide. 

RESULTS 

Twenty‐five strains of P. syringae pv. syringae collected 

from stone fruit orchard sites, wheat and sugar beet in the 

Shiraz, Tehran and another part of Iran were used in this study. 

The DNA fingerprints were determined by using PEP‐PCR. Most 

of P. syringae pv. syringae strains from stone fruits, shown 

similar pattern and are different white other hosts. Wheat and 

sugar beet strain have several common bands. 

DISCUSSION 

In this study, the P. syringae pv. syringae strains isolated from 

Prunus hosts in Iran generated similar genetic profiles in PEP‐PCR 

whereas most strains of P. syringae pv. syringae isolated from 

other hosts generated dissimilar patterns (3). This suggests a 

host specialisation of the stone fruit strains within the 

heterogeneous pathovar syringae. Specialisation of P. syringae 

pv. syringae strains toward a particular host has been observed 

in previous studies(4) REP PCR has been shown to be a rapid and 

reliable method to differentiate plant‐pathogenic bacteria at or 

below the pathovar level with highly reproducible results (5). 

Our results suggest that strains of P. syringae pv. syringae that 

are adapted to a specialised niche, such as Iran stone fruits, may 

be the result of a recent adaptation and/or genetic isolation, 

resulting in the genetically homogeneous population of 

P. syringae pv. syringae strains from stone fruits observed in this 

study, which formed a distinct group from strains isolated from 

other hosts.(3) 

REFERENCES 

1. De Bruijin, F.J. 1992. Use of repetitive (repetitive extragenic 

palindromic and enterobacteria repetitive intergenic consensus) 

sequences and the polimeras chain reaction to finger print the 

genoms of Rhizobium meliloti isolates and other soil bacteria. Appl. 

Environ. Microbiol. 8: 2180–2187 

2. Little, E.L., Bostock, R.M. and Kirkpatrick, B.C. 1998. Genetic 

characterization of Pseudomonas syringae pv syringae strain from 

stone fruits in California. Appl. Environ. Microbiol. 64: 3818–3823. 

3. Louws, F.J., Fulbright, D.W., Stephens, C.T. and De Bruiin, F.J. 1994. 

Specific genomic fingerprints of phytopathogenic Xanthomonas 

and Pseudomonas pathovars and strains generated with repetitive 

sequences and PCR. Apple. Environ. Microbiol. 80: 2286–2292. 

4. Versalovic, J., Koeuth, T., and Lupski, J.R. 1991. Distribution of 

repetitive DNA sequences in Eubacteria and application 

fingerprinting bacterial genomes. Nucleic. Acids. Res. 19: 6823– 

6831. 

Figure 1. REP fingerprints of several P. syringae pv. syringae strains 

isolated from various plant hosts, showing strain variability within the 

pathovar. Lanes: kb, the 1‐kb molecular marker; 1, Almond (pattern 1, 2); 

2, Walnut (pattern 3–5); 3, Apricot (pattern 6, 7); 4, Peach (pattern 8, 9); 

5, cherry (pattern 10_13); 7, wheat (pattern 14); 8, Sugar beet (pattern 

15); 9Negative control (pattern 16) 


Posters 

85 Non‐host resistance and pathogen virulence: an important role of toxic and 

infection‐inducing compound(s) from spore germination fluid of Botrytis cinerea 

N.N. Khanam{ XE "Khanam, N.N." }, K. Toyoda, H. Yoshioka, Y. Narusaka and T. Shiraishi 

Okayama University, Tsushima Naka1‐1‐1, Okayama shi, 700‐8530, Japan 

INTRODUCTION 

Plants are continually exposed to a vast number of potential 

pathogens and, as a result, they have evolved intricate defense 

mechanisms like hypersensitive response (HR), oxidative burst 

and increased expression of pathogenesis related protein. The 

HR appears to play a pivotal role in the success of B. cinerea. As a 

typical necotroph, it may produce multiple metabolites and 

proteins that determine its necrotrophic life style (van Kan, 

2006). One of the key mechanisms of Botrytis species is their 

ability to induce active cell death in their host plants in order to 

be pathogenic (van Baarlen et al. 2004). This study describes the 

action of spore germination fluid of B. cinerea (Bc) on 

pathogenecity and on host responses. 


Spore germination fluid (SGF) was obtained from watergerminated 

conidia from a highly virulent strain BC.02RO 

supplemented with 0.05 µg/ml glucose. An avirulent Alternaria 

alternata (15B) and a hypovirulent strain of B. cinerea 

(BC.236795) were evaluated on disease development and 

cellular response on Nicotiana benthamiana (Nb) with or 

without SGF. Disease development was monitored 

macroscopically by measuring the lesion area, and, cellular 

changes were monitored microscopically by histochemical 

staining. Freeze‐dried SGF solution was made as weight/volume. 

A 40 ug/ml was used as a standard concentration because of 

visible clear necrosis on Nb, kidney bean, barley, and so on. 

RESULTS 

A hypovirulent BC.236795 and an avirulent 15B did not infect 

and evoke visible lesion with sterilised water at 2 dpi on Nb. 

Both induced papilla formation and callose deposition. On the 

other hand, BC.236795 or 15B with SGF (40 µg/ml) from 

BC.02RO evoked lesion and cell death on Nb (Fig. 1) as BC.02RO 

did. The activities of infection‐induction and lesion formation are 

detected in a 10–30 kDa fraction of SGF. That is, BC.02RO‐SGF 

contained toxic and infection‐inducing factor(s). H 2 O 2 generation 

was observed 9 h after treatment with SGF (Fig. 1) while the 

generation was accelerated by inoculation with 15B or 

BC.236795. These effects were more significant with BC.02RO. 

The SGF alone induced cell death but not callose deposition. 

Though necrosis was induced at >20µg/ml of SGF, infection by 

15B or BC.236795 was established at >5µg/ml (Fig. 2). Proteinase 

K (PrK) negated apparently lesion formation and cell death 

induced by SGF with 15B. Prk also limited lesion formation by 

BC.02RO dose dependently. 

Figure 1. Effect of SGF (40 ug/ml) on lesion formation (5 dpi; left), cell 

death (4 dpi; middle), with or without 15B and H 2 O 2 generation (right; 9 

h upper, 12 h lower) on Nb. 

Figure 2. Effect of SGF on infection by 15B on N. benthamiana at 2 dpi. 

DISCUSSION 

As described above, we found that the SGF of a virulent strain of 

Bc induced necrosis and accessibility even to a hypovirulent Bc 

or to an avirulent 15B, and both pathogens showed similar 

activity with exogenous H 2 O 2 . The SGF also induced prominent 

accumulation of H 2 O 2 , which is required for cell death (van Kan 

2006). It was also reported that accumulated H 2 O 2 is necessary 

to achieve full virulence of Botrytis (van Baarlen et al. 2004). 

Taken together with these reports, we hypothesise that SGF 

plays a crucial role in establishment of infection or lesion 

formation by Bc or related necrotrophic fungi mediated by H 2 O 2 

generation. The preliminary experiment with PrK indicates that 

the principle for necrosis‐induction and accessibility‐induction in 

SGF seems to be a proteinous compound(s). In conclusion, SGF 

contains determinant(s) of pathogenicity of this necrptroph. 


The research was funded by Japan Society for Promotion of 

Science. 

REFERENCES 

1. Van Kan, JAL (2006) Licensed to kill the lifestyle of a necrotroph 

plant pathogen. Trends Plant Sci 11, 247–253. 

2. Van Baarlen P, Staats M, van Kan JAL (2004) Induction of 

programmed cell death in lily by the fungal pathogen Botrytis 

elliptica. Molecular Plant Pathology 5(6), 559–574. 


51 Impact of Phytophthora cinnamomi on native vegetation in South Australia 

S.F. McKay A , K.H. Kueh{ XE "Kueh, K.H." } A , A.J. Able A , R.M.A. Velzeboer C , J.M. Facelli B and E.S. Scott A 

A School of Agriculture, Food and Wine, The University of Adelaide, Waite Campus, PMB 1, Glen Osmond, South Australia, 5064 

B School of Earth and Environmental Sciences, The University of Adelaide, North Terrace Campus, South Australia, 5005 

C Department for Environment and Heritage, 41 Victoria St, Victor Harbor, South Australia, 5211 

Posters 

INTRODUCTION 

Phytophthora dieback, caused by the soil‐borne Oomycete 

Phytophthora cinnamomi Rands (Pc), has been identified by the 

Australian Government as a key threat to native ecosystems. A 

National Threat Abatement Plan (NTAP) has been developed to 

limit damage to our native flora and fauna. In spite of the threat 

that Pc represents for South Australia (SA), basic information 

about the effect of the disease on native vegetation in SA is 

lacking. This project aims to increase understanding of the 

susceptibility of threatened and key plant species and ecological 

changes in plant communities due to Phytophthora dieback in 

SA. 


Susceptibility testing of threatened and key plant species. 

Testing of selected threatened species has commenced (Table 

1). These species were chosen on the basis of availability, ease of 

seed germination and handling in the greenhouse, and 

occurrence in moderate or high “risk of Phytophthora” area(s) 

(1). Other species, abundant at our field sites, will also be tested, 

e.g. Allocasuarina, Hakea and Hibbertia spp. Three‐month old 

plants will be inoculated with Pc using a method modified from 

Butcher et al (1984) and Shearer et al (2004) and monitored for 

disease symptoms and mortality. 

Table 1. Threatened plant species to be tested for susceptibility to Pc. 

Species 

Common name 

Allocasuarina robusta 

Mount Compass oak‐bush 

Brachyscome diversifolia 

Tall daisy 

Olearia pannosa 

Silver‐leaved daisy 

Austrodanthonia carphoides Short wallaby grass 

Acacia enterocarpa 

Jumping jack wattle 

Acacia pinguifolia 

Fat‐leaf wattle 

Glycine tabacina 

Variable glycine 

Correa calycina 

SA green correa 

Pomaderris halmaturina 

Kangaroo Is. pomaderris 

Prostanthera halmaturina 

Monarto mintbush 

Oreomyrrhis eripoda 

Australian carraway 

Spyridium parvifolium 

Dusty miller 

Spyridium spathulatum 

Spoon‐leaved spyridium 

Dynamics of Pc in the field. The rate and pattern of spread of Pc 

are being studied at two sites in the Mount Lofty Ranges (Mount 

Bold reservoir reserve and Scott Creek Conservation Park). The 

sites are open woodland, are floristically similar to one another 

and the presence of Pc has been confirmed. Permanent quadrats 

have been established and the following parameters measured 

and data collected in 2008: 

• soil and fine root samples; baited for Pc 

• numbers and health of key indicator species e.g. 

Xanthorrhoea semiplana and other vascular plants 

• percentage cover by vascular plants, leaf litter and bare 

ground 

• other data e.g. soil moisture, rainfall. 

These parameters will be measured again in autumn and spring 

of 2009 and 2010. 

Effect of companion plants on susceptibility. The hypothesis 

that the plant neighbourhood influences spread and expression 

of Phytophthora dieback is being examined in a series of pot 

experiments. In the first experiment, seeds of Acacia pycnatha 

and A. myrtifolia have been sown in pots containing 1‐year‐old 

plants of X. semiplana. Pots will be inoculated with Pc when 

acacias are 3 months old and symptoms assessed. 

Microbial antagonists. Rhizosphere soil from Pc tolerant plants, 

e.g. some Acacia spp., and from sites where Pc is present but not 

causing disease will be screened in vitro for antagonists of Pc, in 

particular streptomycetes. Preliminary work has yielded several 

species strongly antagonistic to Pc. Streptomycetes will be 

tested further for antagonism in planta. Results from these 

experiments may help to explain suppression of Pc root rot in 

some native ecosystems. 


Baseline data collected from the field sites in 2008 will be 

compared with data collected in 2009 and 2010 which will 

enable documentation of the rate and pattern of spread of the 

pathogen and disease over time. Information from field 

observations and glasshouse experiments about susceptibility of 

threatened and key species will enable improved management 

decisions regarding conservation of threatened plant species. 

Knowledge of companion plant interactions will increase 

understanding of the factors that affect the spread of the 

disease. Information from this project will facilitate the adoption 

of management strategies in line with NTAP objectives. 


This research is funded by the ARC and has the following linkage 

partners: Adelaide‐Mt Lofty NRM Board, Adelaide Hills Council, 

City of Tea Tree Gully Council, Department for Environment and 

Heritage, Department of Transport, Energy and Infrastructure, 

Forestry SA, PIRSA Forestry, SA Murray Darling Basin NRM Board 

and SA Water. We thank the Sarawak State Government, 

Malaysia, for funding the PhD studies of Mr Kueh Kiong Hook. 

REFERENCES 

1. Velzeboer R, Stubbs W, West A, Bond A (2005) Threatened plant 

species at risk from Phytophthora in South Australia. (Department 

for Environment and Heritage, SA. Government of South Australia). 

2. Butcher TB, Stukely MJC, Chester GW (1984) Genetic variation in 

resistance of Pinus radiata to Phytophthora cinnamomi. Forest 

Ecology and Management 8, 197–220. 

3. Shearer BL, Crane CE, Cochrane A (2004) Quantification of the 

susceptibility of the native flora of the South‐West Botanical 

Province, Western Australia. Australian Journal of Botany 52, 435– 

443. 


Posters 

74 Genetic diversity and population structure of Australian and South African 

Pyrenophora teres isolates 

A. Lehmensiek{ XE "Lehmensiek, A." } A , R. Prins B , G. Platz C , W. Kriel D , G.F. Potgieter E and M.W. Sutherland A 

A Centre for Systems Biology, University of Southern Queensland, Toowoomba, 4350 QLD, Australia 

B CenGen (Pty) Ltd, 78 Fairbairn Street, Worcester, 6850, South Africa 

C DEEDI Primary Industries and Fisheries, Hermitage Research Station, Warwick, 4370 QLD, Australia 

D Department of Plant Sciences, University of the Free State, Bloemfontein, 9300, South Africa 

E South African Barley Breeding Institute, PO Box 27, Caledon 7230, South Africa 

INTRODUCTION 

Net blotch, caused by the fungus Pyrenophora teres, is a serious 

production problem for the barley (Hordeum vulgare L.) industry 

in Australia, South Africa and elsewhere (1, 2, 3, 4). Two forms of 

net blotch exist: one is the net form (NFNB) caused by P. teres f. 

teres (PTT) and the other is the spot form (SFNB) caused by P. 

teres f. maculata (PTM). Several Australian and international 

studies have used molecular markers, such as amplified 

fragment length polymorphisms (AFLP) to investigate the genetic 

structure of P. teres (3, 5, 6, 7). In contrast, while the incidence 

of net blotches on barley have increased recently in South Africa, 

local populations of the fungus have remained uncharacterised. 

To address this issue, PTT and PTM isolates were collected from 

the south‐western Cape region of South Africa. AFLP analysis 

was conducted on extracted DNA from these isolates and from a 

collection of Australian isolates to determine the genetic 

diversity and structure of South African populations and to 

determine their relatedness to Australian isolates. 


DNA extractions. Fungal mycelium were harvested from cultures 

grown on potato dextrose agarose plates at 25°C for one week. 

A CTAB DNA extraction method was used to extract the fungal 

DNA. 

AFLP analysis. The AFLP procedure was carried out using an 

Invitrogen AFLP Core Reagent kit. The EcoRI primers were hexlabelled. 

The samples were visualised using a Gel‐Scan 2000 

DNA fragment analyser (Corbett Life Sciences, Sydney, 

Australia). 

Scoring and data analysis. Both monomorphic and polymorphic 

bands were scored and used in the data analysis. Bands were 

scored independently by two people. The cluster analysis was 

performed using NTSYSpc V2.20f, whereas the program 

Structure V2.2 was used to determine the population structure. 

RESULTS 

AFLP analysis was conducted on DNA of 23 South African and 37 

Australian PTT isolates, 37 South African and 29 Australian PTM 

isolates, six Bipolaris sorokiniana isolates, two P. tritici‐repentis 

and two Drechslera rostrata isolates. Eight primer combinations 

were used to amplify AFLPs and on average 50 loci were 

produced with each primer combination. In total, 400 loci could 

be accurately scored across all samples and 168 of these loci 

were polymorphic in the P. teres samples. 

No genetic differentiation associated with locations within 

Australia or South Africa could be identified. 

The program Structure separated the PTT and PTM isolates into 

three and two groups, respectively. 

DISCUSSION 

Our study indicates that the genetic diversity among South 

African and Australian Pyrenophora isolates is low and that there 

is no clear geographical substructuring. These findings are similar 

to those of studies in other regions (3, 5, 6). Results produced by 

the two software packages NTSYS and Structure will be 

compared and discussed. 


The authors would like to thank Dr Hugh Wallwork and Dr Sanjiv 

Gupta for the isolate samples provided by them. We also would 

like to thank Debbie Snyman, Denise Liebenberg and Lizaan 

Rademeyer for their technical help in the Cengen laboratory. 

This project was funded by the South African Winter Cereals 

Trust. 

REFERENCES 

1. Campbell GF, Crous PW (2003) Genetic stability of net x spot hybrid 

progeny of the barley pathogen Pyrenophora teres. Australasian 

Plant Pathology 32, 283–287. 

2. Gupta S, Loughman R, Platz G, Lance RCM (2003) Resistance in 

cultivated barleys to Pyrenophora teres f. teres and prospects of its 

utilisation in marker identification and breeding. Australian Journal 

of Agricultural Research 54, 1379–1386. 

3. Leisova L, Minarikova V, Kucera L, Ovesna J (2005) Genetic diversity 

of Pyrenophora teres isolates as detected by AFLP analysis. Journal 

of Phytopathology 153, 569–578. 

4. Manninen O, Kalendar R, Robinson J, Schulman AH (2000) 

Application of BARE‐1 retrotransposon markers to the mapping of a 

major resistance gene for net blotch in barley. Molecular and 

General Genetics 264, 325–334. 

5. Bakonyi J, Justesen AF (2007) Genetic Relationship of Pyrenophora 

graminea, P‐teres f. maculata and P‐teres f. teres assessed by RAPD 

analysis. Journal of Phytopathology 155, 76–83. 

6. Jonsson R, Sall T, Bryngelsson T (2000) Genetic diversity for random 

amplified polymorphic DNA (RAPD) markers in two Swedish 

populations of Pyrenophora teres. Canadian Journal of Plant 

Pathology‐Revue Canadienne De Phytopathologie 22, 258–264. 

7. Serenius M, Manninen O, Wallwork H, Williams K (2007) Genetic 

differentiation in Pyrenophora teres populations measured with 

AFLP markers. Mycological Research 111, 213–223. 

Cluster analysis separated the NFNB and SFNB isolates into two 

strongly divergent groups (similarity coefficient = 0.6). Low 

genetic differentiation was observed within the NFNB and SFNB 

groups (similarity coefficient = 0.9). Interestingly, the South‐ 

African NFNB isolates clustered together with the Australia NFNB 

isolates whereas the South‐African SFNB isolates were grouped 

into a distinct cluster separate from the Australian SFNB isolates. 


28 Molecular identification of Pythium isolates of ginger from Fiji and Australia 

M.F. Lomavatu{ XE "Lomavatu, M.F." } A,B , J. Conroy B and E. Aitken B 

A 

Koronivia Research Station, PO Box 77, Nausori, Fiji 

B 

School of Biological Sciences, The University Of Queensland, St Lucia, Brisbane 

Posters 

INTRODUCTION 

Pythium myriotylum Drech is one of the main causal organisms 

for Pythium rhizome rot of ginger and is common worldwide. It 

was first recorded in 1907 by Butler. In a recent review (1) 

eleven species of Pythium were listed as causal agents of a 

rhizome rot of ginger. Pythium affects ginger throughout its 

growing stages and the main entry points of infection are the 

buds, roots, developing rhizomes and the collar region of the 

plant. 

In Fiji and Australia P. myriotylum is commonly associated with 

the disease and isolates of this species are capable of destroying 

ginger rhizomes in 1–2 weeks under appropriate environmental 

conditions (2). In Fiji, surveys during 2007 and 2008 found that 

Pythium rhizome rot was associated with hot, humid and high 

rainfall periods during the wet season. It was noted during the 

previous study (2) that additional species of Pythium may be 

associated with the disease in both countries. Some Fijian 

isolates grew at different rates on agar and showed variability in 

cultural characteristics, while preliminary work indicated 

variability in aggressiveness within isolates obtained from 

Australia. This abstract details further investigations into the 

molecular variability of Pythium isolates from ginger in Fiji and 

Australia. 


1. Culture isolation Diseased ginger rhizomes were collected 

from different ginger growing areas in Fiji (2) and in Queensland. 

The five Fijian isolates used in this study were imported on an 

AQIS permit and kept in an quarantine lab at the University of 

Queensland. Of the Australian Pythium isolates used, one was 

from capsicum and two isolated from diseased ginger rhizomes 

(Table 1). 

2. Molecular identification 

2.1 DNA extraction. After 5 days growth on potato dextrose 

broth, mycelia of each isolate were collected in Falcon tubes and 

lyophilised. Mycelia were ground in liquid nitrogen to fine 

powder and DNA extracted as per Lee & Taylor (3). 

2.2 Polymerase chain reaction and sequencing. The ITS region 

of the Pythium isolates were amplified using the universal 

primers ITS 1 (5’ – TCCGTAGGTGAACCTGCGG‐3’) and ITS 4 (5’‐ 

TCCTCCGCTTATTGATATGC ‐3’) described by White et al. (4) and 

were sequenced at AGRF Brisbane. 

RESULTS 

Molecular identification BLAST analysis revealed that three 

Pythium species, P. myriotylum, P. vexans and P. graminocola, 

were identified each from three different ginger growing 

localities (Veikoba, Navua and upper Naitasiri, respectively). The 

two Australian ginger isolates revealed sequence alignment with 

P. myriotylum and P. zingiberis; the capsicum isolate was 

confirmed as P. myriotylum (Table 1). 

Table 1. Pythium isolates from Fiji (KRS suffix) and Queensland (BRIP 

suffix) showing location collected, species identification based on ITS 

sequence similarity and Genbank accession number where deposited. All 

isolates from ginger except* from capsicum. 

Sample location Pythium sp. GenBank 

KRS11 Navua P.vexans 

KRS13 Muainaweni P.graminicola 

KRS14 Veikoba P.myriotylum FJ797574 

KRS15 Waibau P.graminicola 

KRS17 Veikoba P.myriotylum FJ797575 

BRIP39907* Bundaberg P.myriotylum FJ797576 

BRIP52426 Templeton P.myriotylum FJ797577 

BRIP52427 Templeton P.zingiberis. FJ797578 

DISCUSSION 

This is the first record of P. vexans and P. graminocola from 

ginger in Fiji and the first putative record of P. zingiberis in 

Australia. According to Dohroo (2005) P.graminicolum is present 

in Sri Lanka while P.vexans in India. The two species have been 

found to cause problems during rainy weather. The surveys are 

still relatively limited and there may be more species present in 

the Fijian ginger growing areas, or indeed other species present 

in Fiji and Australia with the capacity to cause rhizome rot in 

ginger. Consequently, more survey work is warranted. P. 

zingiberis has been recorded in Japan and Korea (5). In Japan, it 

has been isolated from various parts of rotten ginger, especially 

from the basal part of terrestrial stem and rhizomes regardless 

of stages of disease development and locations. It has been 

isolated from soils where ginger is growing and from areas 

where ginger has been previously grown. Morphologically, 

P.zingerberis is very similar to P.myriotylum and at the molecular 

level only a single base pair difference in the ITS2 region of the 

rDNA separates the two species (6). P.zingiberis has never been 

recorded in Australia, and to validate this record further 

morphological analysis is required. 


This work was supported in part by a John Allwright Fellowship 

provided to the presenting author. We thank G &AM Stirling and 

Mike Smith for provision of the Australian isolates and advice in 

this project. 

REFERENCES 

1. Dohroo NP (2005) Diseases of ginger. In ‘Ginger, the genus 

Zingiber’. (Eds PN Ravindran, K Nirmal Babu) pp. 305–340. (CRC 

Press: Boca Raton) 

2. Stirling GR, Turaganivalu U, Lomavatu, MF, Stirling AM, Smith MK 

(2009). Australasian Plant Pathology (in press). 

3. Lee & Taylor (1990), Isolation of DNA from fungal mycelia and 

single spores. PCR Protocols: A guide to methods and applications. 

Academic Press, Inc. 

4. White, T.J., T. Bruns, S. Lee and J. Taylor. 1990. Amplification and 

direct sequencing of fungal ribosomal RNA genes for phylogenetics. 

In: PCR protocols. Eds. M.A. Innis, D.H. Gelfand, J.J. Sninisky and T.J. 

White. Academic Press, San Diego. pp. 315–322. 

5 Ichitani T and Shinsu T (1980) Ann.Phytopath. Soc.Japan 46: 435– 

441 

6. Levesque, C.A. and de Cock A.W.A.M. (2004). Mycological Research 

108: 1363–1383 


Posters 

29 Development of techniques to measure SAR induction in broccoli for clubroot 

disease resistance 

D. Lovelock{ XE "Lovelock, D." } A , A. Agarwal B , E.C. Donald B , I.J. Porter B , R. Faggian C and D.M. Cahill A 

A School of Life and Environmental Sciences, Deakin University, Geelong, 3217, Victoria 

B Department of Primary Industries, Private Bag 15, Ferntree Gully DC, 3156, Victoria 

C Department of Primary Industries, 32 Lincoln Square, North Carlton, 3052, Victoria 

INTRODUCTION 

The phytohormone, salicylic acid, (SA) is required for a number 

of physiological processes within plants but primarily it is an 

important signalling molecule in plant defence, at both cellular 

and tissue levels but also systemically (1). Salicylic acid is 

implicated as a signal in defence against pathogens via systemic 

acquired resistance (SAR), a mechanism of induced defence that 

confers long‐lasting protection against a broad spectrum of 

microorganisms (2). An increased concentration of endogenous 

SA prior to and during SAR has been correlated with an increase 

in the production of pathogenesis‐related proteins throughout 

the plant. We are investigating SA‐induced SAR in broccoli 

following inoculation with Plasmodiophora brassicae. Molecular 

and biochemical methods are being developed to measure SAR 

induction in broccoli for the first time. A real‐time reverse 

transcriptase quantitative PCR (RT‐qPCR) has been developed to 

measure chitinase gene expression in plant tissue. Extraction 

from broccoli tissue and High Performance Liquid 

Chromatography (HPLC) analysis are being optimised to quantify 

SA levels post induction. 


Roots of broccoli (cv. Marathon) seedlings (10 to 14 day old) 

grown in trays were dipped in SA solution (1–5 mM 

concentration) for 15 minutes. Root and leaf sample pairs 

collected from the same plant were harvested 24 hours post 

treatment. Total RNA was isolated from roots and leaves of each 

sample for 3 replicates and checked by spectrophotometry for 

its quality and quantity. RNA was treated with DNase 1 and then 

reverse transcribed into cDNA and quantified by 

spectrophotometry. RT‐qPCR was conducted in duplicate for 

each sample using primers for two different genes—Actin‐8 

(house‐keeping gene) and Chitinase (gene of interest). The Delta‐ 

Delta C t method was used for calculating the relative fold change 

of chitinase gene expression in treated samples compared to the 

control. SA extraction from broccoli is currently being optimised 

based on published protocols (3) and quantified using HPLC. 


The chitinase gene was chosen for this study as it is a known 

marker gene for measuring SAR induction and secondly it was 

possible to design the primers for B. oleracea. Following 

treatment of roots with 1 mM SA chitinase gene expression was 

increased above controls and was uniform throughout the plant 

in each of the three replicates. At higher concentrations up to 5 

mM chitinase gene expression was less consistent. These results 

indicate that a low dose of SA might be enough to trigger a good 

SAR response in the whole plant. A higher dose of SA might not 

necessarily induce a higher SAR response rather it may alter the 

physiology of the plant. 

mAU 

Figure 1. A typical chromatogram of a broccoli root extract that 

illustrates the retention time of SA (arrow) based on a separation 

performed on a standard 250mm x 0.5µm C 18 HPLC column. 

These preliminary studies have confirmed that SA can be used as 

an SAR inducer in broccoli and that the molecular and 

biochemical techniques under development can be used to 

measure SAR induction. Future work will determine the link 

between SA and resistance to P. brassicae in broccoli and the 

optimum level of SA required for SAR induction and disease 

resistance. 




funds from the Australian Government. We thank Dr Xavier 

Conlan Deakin University, Geelong, for providing assistance in 

the SA analysis. We also thank Prof. Jutta Ludwig‐Muller, 

Technical University, Dresden, for her valued expertise at the 

beginning of this project. D. Lovelock is funded by a DPI‐Deakin 

University Post‐Graduate Scholarship. 

REFERENCES 

Retention time (min) 

1. Ludwig‐Muller J, Schuller A (2008) What can we learn from 

clubroots: alterations in host roots and hormone homeostasis 

caused by Plasmodiophora brassicae. European Journal of Plant 


2. Durrant WE, Dong X (2004) Systemic acquired resistance. Annual 

Review of Phytopathology 42, 185–209. 

3. Li X et al (1999) Identification and cloning of a negative regulator of 

systemic acquired resistance, SNI1, through a screen for 

suppressors of npr1‐1. Cell 98, 229–339. 

Initial HPLC analysis has revealed that SA can be detected at 

nanomolar levels in broccoli root and shoot extracts post 

treatment with 1 mM SA (Fig 1). We are now in a position to 

examine the levels of SA that are present post SAR induction and 

the response to P. brassicae. 


52 Reducing the carbon footprint in Riverland vineyards: assessing the efficacy and 

efficiency of control for powdery mildew by evaluating growers’ spray diaries 

Posters 

P.A. Magarey{ XE "Magarey, P.A." } A , R.W. Emmett B , T.S. Smythe C , M.M. Moyer D , J.R. Dixon E , A.J. Pietsch F and P.M. Burne F 

A South Australian R&D Institute, PO Box 411, Loxton, 5333, SA 

B Department of Primary Industries, PO Box 905, Mildura, Vic, 3502 

C Riverland Wine Industry Development Council, 6 Kay Avenue, Berri, SA, 5343 

D NY Ag Exp Station, Geneva, NY, USA 14456 

E SA Murray‐Darling Basin Research Information Centre, 6 Kay Avenue, Berri SA 5343 

F CCW Co‐op Ltd, PO Box 238, Berri, SA, 5343 

INTRODUCTION 

A single sulphur spray to control powdery mildew (Erysiphe 

necator) in the Riverland region, comprising ~21,000 ha of 

viticulture near Loxton, South Australia (SA), costs ~$1.2 million. 

Like many other industries, the Australian wine grape industry, 

competes in international markets. Cost efficiencies and a 

demonstrably clean and sustainable green image are required. 

Because recent SA legislation aims to ensure that carbon 

emission targets are met, the SA wine grape industry is taking 

the initiative by fostering adoption of the cheapest and 

environmentally best disease control strategies. 

In line with this, we analysed grape grower spray diaries to: 1) 

assess the efficiency of spraying practices used for powdery 

mildew control; 2) provide a benchmark for current practice; and 

3) identify the scope for introducing modified spraying practices 

for optimum control using advanced knowledge of disease 

epidemiology. 


Paper‐based spray diaries supplied by two local wineries from 

2006/07 were converted to electronic format for the rapid and 

uniform review of individual records. The records contained 

vineyard details, spray information (dates, products, application 

details etc), and winery pre‐harvest assessments of powdery 

mildew severity. A MS Access ® ‐based, vineyard spray program 

evaluator with a theoretical optimum spray strategy based on 

best practice spray timing, fungicide treatment, and application 

technique, was used to: 1) compare each spray record in relation 

to temporally adjacent sprays; and 2) calculate a disease 

management score for each record. The scores for each spray 

event in each diary were then combined for each patch to 

provide a simple but rapid means of evaluating spray programs 

used on more than 1,200 patches of Chardonnay, 1,450 of Shiraz 

and 13 of Verdelho. Of the former, 138 were examined in detail. 


Analyses of the spray diaries showed that some growers 

achieved excellent control with as few as 2–4 sprays while others 

sprayed ≥ 12 times and achieved poor control. Many applied too 

many sprays with little benefit. For instance, Chardonnay 

growers applied an average of 6–7 sprays (range 2–14)/season 

and 25% applied ≥ 8 sprays annually. Of the total number, 73% 

(81% of total area surveyed) had at pre‐harvest, insignificant 

amounts of mildew while only 6% (3% area) had levels of disease 

sufficient for the winery to reject the crop. Significantly, there 

was no correlation between the number of sprays and the 

winery’s pre‐harvest disease score (Figure 1). It was not the 

number of sprays but their timing that was critical in controlling 

disease. 

A comparison of the disease management scores with the 

theoretical optimum spray strategy indicated that about 45% of 

growers were applying well‐timed programs whereas 55% were 

performing poorly. Nearly all growers were applying the right 

fungicide treatments but a lack of spray diary data on sprayer 

calibration, and therefore the efficiency of spray coverage, 

prevented accurate assessment of spray technique as a factor in 

disease control. Similarly, the lack of records of inoculum 

reservoirs inhibited the study of the efficacy of the sprays 

applied. 

Winery’s Mildew Disease Rating 

6 

5 

4 

3 

2 

1 

Figure 1. Plot of the number sprays applied for powdery 

mildew/patch/season for cv. Chardonnay, 2007/08. 

Spatial analyses of the spray diary records indicated clustering of 

vineyards with higher disease scores suggesting that disease 

control might be improved by addressing cultural, sociological 

and/or meso‐climatic factors. In addition, higher incidences of 

powdery mildew occurred in patches with under‐vine irrigation 

compared to those with drip irrigation. 

Our analyses showed that the vineyard spray program evaluator 

could compare disease management practices from any spray 

diary of the same format to: 1) rapidly review past records of 

sprays applied in other seasons or other regions so that industry 

bench‐marks for the use of fungicides to control powdery 

mildew can be devised; 2) evaluate planned spray schedules for 

effectiveness and weakness before sprays are applied in the 

vineyard; and 3) determine which spray schedules are effective 

and which are not. From this, the minimum number of effective 

sprays needed to improve control of powdery mildew can be 

determined, reducing fuel and chemical use, lowering costs and 

reducing carbon emissions in Australian vineyards. 

CONCLUSION 

There is scope to adopt improved spray programs for better 

control of powdery mildew. The vineyard spray program 

evaluator could be developed as an online module in 

CropWatchOnline.com for growers, vineyard managers, 

consultants and others to assess their own records. 


More Sprays Don’t Give Better Control 

0 

0 2 4 6 8 10 12 14 

Total Number Sprays/Season 

This research was initiated by the Riverland Wine Industry 

Development Council and supported in part by a Grape and 

Wine Research and Development Corporation RITA grant. 


Posters 

30 Incorporating host‐plant resistance to Fusarium crown rot into bread wheat 

D.J. Herde and C.D. Malligan{ XE "Malligan, C.D." } 

Department of Employment, Economic Development and Innovation, Primary Industries and Fisheries, Leslie Research Centre, 

Toowoomba, 4350, QLD 

INTRODUCTION 

Crown rot, caused predominantly by Fusarium 

pseudograminearum (teleomorph Gibberella coronicola), is a 

major soilborne disease problem in the wheat and barley 

industries. The disease is widespread and causes losses in yield 

and quality in Queensland, New South Wales, Victoria, and South 

Australia. Losses are estimated to be up to $56M in bread wheat 

throughout Australia. In Queensland, losses have been 

estimated at up to 50% in some areas and losses of 20 to 30% 

occur regularly, while the disease can inflict yield loss of up to 

89% (1). 

Breeding for resistance to crown rot has been difficult, partly 

due to variability associated with disease measurement, but also 

due to an incomplete understanding of the nature of the 

genetics of resistance. 

Previous work (2) found complex models of inheritance 

controlling crown rot resistance. This knowledge is being used to 

direct a number of different approaches aimed at building 

disease resistance levels. 


Of the bread wheat genotypes studied, two (Puseas and 

Kennedy) are susceptible and seven (2–49, CPI133814, IRN497, 

Lang, QT10162, Sunco, and W21MMT70) have partial resistance. 

The parent 2–49 is considered one of the strongest sources of 

resistance to crown rot currently available (3). 

The seedlings were assessed for crown rot resistance in a 

glasshouse test, following a modification of the Wildermuth and 

McNamara method (4). This method is a three week duration 

experiment that closely mimics field infection, and is highly 

correlated with field results. 

The approaches we took were: 

• selection in targeted crosses with knowledge of the genetic 

model 

• selection without knowledge of the genetic model 

• gene pyramiding using half‐sib crosses 

• gene pyramiding using molecular tools (DArT). 


Having the genetic information available enables an informed 

decision to be made about the difficultly in working with 

particular crosses. 

found in a fixed line. Further work is under way to compare 

selection in crosses with different types of epistatic control. 

Selection without knowledge of the genetic control can still 

provide useful results, but until arriving at a fixed line there will 

be uncertainty about whether the disease resistance is real or 

the product of unfixable gene interactions. 

Half‐sib crosses (where the male and female have a parent in 

common) combining two different sources of resistance, in this 

case IRN497 and the synthetic wheat CPI133814, were crossed 

into a common agronomic background (Sunco). This can be a 

useful method of elevating resistance by combining diverse 

resistance genes. Resistance levels in the progeny are extremely 

high after three rounds of selection (F2 to F4), with the best 

showing ~30% less disease severity than 2–49. 

DArT markers have been used to direct intercrosses between 

resistant selections from a cross of CPI133814 and IRN497, 

which was identified as the optimal cross for strongest crown rot 

resistance (from the listed parent set). DArT genotyping can 

identify gene differences in individuals that show the same level 

of resistance, enabling crosses to be made to maximise the 

amount of resistance genes within an individual plant. This 

strategy is aiming to produce a parental line for further 

development with elevated resistance levels beyond those 

currently available, rather than a variety for release, as the 

parents lack adaptation characteristics. 

Pre‐breeding selection work has commenced with the better 

performing crosses that include an adapted parent in the cross. 

REFERENCES 

1. Klein TA, Burgess LW, Ellison FW (1991) The incidence and spatial 

patterns of wheat plants infected by Fusarium graminearum Group 

1 and the effect of crown rot on yield. Australian Journal of 


2. Herde DJ, McNamara RB, Wildermuth GB (2008) Obtaining genetic 

resistance to Fusarium crown rot in bread wheat. 11th 

International Wheat Genetics Symposium, August 24–29, 2008, 

Brisbane. 

3. Wildermuth GB, McNamara RB, Quick JS (2001) Crown depth and 

susceptibility to crown rot in wheat. Euphytica 122, 397—405. 

4. Wildermuth GB, McNamara RB (1994) Testing wheat seedlings for 


Plant Disease 78, 949–953. 

Many of the crosses in this study had complex epistatic models 

controlling crown rot resistance. A number were controlled 

through an additive gene model or additive x additive epistasis, 

which allows the resistance to be captured in a fixed line. A 

number of other crosses with strong resistance were controlled 

with dominance or dominance x dominance epistasis, meaning 

the resistance will not be able to be captured in a fixed line. 

This information is able to guide selection of populations to 

advance, and explains why resistance in parent lines or 

segregating material alone will not guarantee resistance will be 


31 Management and distribution of huanglongbing in Pakistan 

Shahid Nadeem Chohan 1,3 , Obaid Aftab 1 , Raheel Qamar 1 , Shazia Mannan{ XE "Mannan, S." } 2 , Muhammad Ibrahim 2 , Iftikhar Ahmed 4 , M. 

Kausar Nawaz Shah 1 , Paul Holford 3 , G. Andrew C. Beattie 3 

1 Department of Biosciences, COMSATS Institute of Information Technology, Chak Shahzad Campus, Islamabad, Pakistan 

2 Department of Biosciences, COMSATS Institute of Information Technology, Sahiwal Campus, 520‐B Civil Lines, Jail Road, Sahiwal, 

Pakistan 

3 Centre for Plant and Food Science, University of Western Sydney, Locked Bag 1797, Penrith South DC, NSW 1797, Australia 

4 National Agricultural Research Centre, Pakistan Agricultural Research Council, Park Road, Islamabad, Pakistan 

Posters 

INTRODUCTION 

Citrus as a crop provides living for individual farmers and foreign 

exchange for Pakistan as it is one the major agricultural export 

commodities. This fruit crop is susceptible to many biotic 

stresses including diseases of which huanglongbing is perhaps 

the most devastating of all. The presence of this disease has 

previously been reported in Pakistan, however, the molecular 

evidence that it is caused by ‘Candidatus Liberibacter asiaticus’ 

(α‐Proteobacteria) was provided only recently (1). Both the 

prevalence and severity of this disease are, however, yet to be 

ascertained. This information is imperative to devise a 

management strategy at national level for containing the losses 

sustained by the farmers. Farmers, as well as extension workers, 

also need to be made aware of the presence of, and damage 

caused by, this disease and a concerted extension campaign is 

required for this purpose. Due to the technical difficulties in the 

diagnosis of the disease, a diagnostic service should be provided 

to the farmers at more than one place in the country. To enable 

the medium equipped laboratories a testing kit can be useful. 

These points have been addressed in the present study. 

METHODOLOGY 

The Survey and Sampling Strategy. To assess the prevalence and 

severity of the disease, a survey and sampling strategy has been 

devised which we term as “triple five”, to survey the citrus 

orchards country wide and collect the suspect samples based 

upon visual symptoms. 

Pakistan is administratively divided in to four provinces (Punjab, 

Sindh, Balochistan and Sarhad or North West Frontier Province) 

and four territories (Islamabad Capital Territory, Federally 

Administered Areas (FATA), the Northern Areas (FANA), and 

Azad Kashmir). The provinces of Sarhad and Balochistan each 

have Provincially Administered Areas (PATA) as well. Each 

province or territory is further subdivided in to districts and 

tehsils. The citrus orchards are spread around the country with a 

few areas with dense plantings and others with little production. 

Based upon existing statistics, districts of Pakistan containing 

citrus orchards covering at least 100 hectares were selected for 

the survey. At least five orchards in each tehsil were surveyed to 

select five trees on the bases of visual symptoms. Five 

symptomatic leaves were collected from each tree and tested 

for the presence of the disease. Projects are also under way in 

these areas to eventually uplift the farmers’ income from citrus. 

These samples have been tested by both PCR and the iodinestarch 

test (IS (2 and 3)). 


The Incidence of HLB. Survey of over 12 districts in Punjab has 

been completed and over 400 samples tested for the presence 

of HLB. Usually, the IS and the PCR test results were in 

agreement. However, some samples showing positive IS tests 

were found to be negative by PCR. The data will be provided 

later during the presentation. 

Multiplexing of primers for ‘Ca. Liberibacter asiaticus’ with those 

for ‘Ca. L. americanus’ has been successful; however, ‘Ca. L. 

americanus’ has not been detected. 

Huanglongbing Map of Pakistan. Currently, a citrus map of 

Pakistan is being prepared based upon the available statistics 

about the fruit crop. This citrus map of Pakistan will be upgraded 

to the huanglongbing map of Pakistan based upon the resultsof 

this study. Year‐round meteorological data will be incorporated 

showing highest temperature in the areas in Pakistan. 

Extension activity. Two brochures have been published for the 

awareness of the extension workers and the local farmers each 

in English and Urdu disseminated. The same brochure is now 

planned to be expanded to include all the prevalent diseases and 

insect pests of citrus as well as agronomic and postharvest 

recommendations which will eventually lift economic 

circumstances of the individual farmers. 

Building nation‐wide diagnostic capability and capacity. The 

presence of HLB is detected by the following methods: the 

resumptive IS test and by PCR. A kit has been prepared 

containing all the ingredients required to do these tests. The Part 

A of the kit has theingredients for the IS test. Part B of the kit has 

the ingredients used for DNA release and PCR analysis including 

a 1 tube PCR method. This kit is currently in the final stages of its 

testing and will be released to the interested parties soon. Any 

laboratory with a standard thermal cycler and gel 

electrophoresis facility would be able to test the presence of 

disease using this technique. Therefore, it will be a great boost 

for diagnostic capacity building in the country. Training 

workshops are also planned for this purpose. 

Huanglongbing Testing Services. One of the main sources of the 

disease is budwood from the infected mother blocks. Most of 

the budwood is provided from the government‐owned or 

administrated citrus orchards. Screening these blocks for the 

presence of this disease will greatly help in suppressing the 

spread of HLB through infected budwood material. Therefore, 

we have established a service for the testing facility of these 

mother blocks. 

The service is also offered to general farmers and 

documentation has been prepared to educate them with the 

procedures of taking and posting samples for testing. 

These services will remain free of charge as long as funds remain 

available for this purpose. 

Seasonal Variation. Extremely high temperatures may restrict 

proliferation of the pathogen in infected trees. Data is currently 

being obtained from the Meteorological Department of Pakistan 

to find out the highest temperature range in the country. This 

information will be incorporated in to the citrus map of Pakistan. 

This map will indicate relationship between the disease and high 

temperatures in the citrus growing areas of Pakistan. 


Posters 

Effect of Temperature on the Pathogen and its Remaining DNA 

in Infected Leaves. The leaves from the same infected twig are 

being subjected to heat treatments of different temperatures 

and times, then tested for the presences of pathogen DNA using 

standard and real‐time PCR protocols to ascertain the 

concentration of DNA within the leaves. 

REFERENCES 

1. Chohan SN, Qamar R, Sadiq I, Azam M, Holford P, Beattie GAC 

(2007) Molecular evidence for the presence of huanglongbing in 

Pakistan. Australasian Plant Disease Notes 2, 37–38. 

2. Takushi T, Toyozato T, Kawano S, Taba S, Taba K, Ooshiro A, 

Numazawa M, Tokeshi M, (2007) Scratch method for simple, rapid 

diagnosis of citrus huanglongbing using iodine to detect high 

accumulation of starch in the citrus leaves. Japanese Journal of 

Phytopathology 73, pp. 3–8. 

3. Eng L (2007) A presumptive field test for huanglongbing (citrus 

greening disease). Senior Officers’ Conference, Department of 

Agriculture Sarawak, 11–14 December 2007, Kuching, Sarawak. 


75 The Fusarium oxysporum f. sp cubense tropical race 4 vectoring ability of the 

banana weevil borer (Cosmopolites sordidus) 

Posters 

R.A. Meldrum{ XE "Meldrum, R.A." } A,B,C , A.M. Daly B and L.T.T. Tran‐Nguyen B 

A Cooperative Research Centre for National Plant Biosecurity 

B Plant Industries, NT Department of Regional Development, Primary Industry, Fisheries and Resources, GPO Box 3000, Darwin, 0801, NT 

C School of Biological Sciences, The University of Queensland, St Lucia, 4072, QLD 

INTRODUCTION 

Fusarium wilt of banana is regarded as one of the most 

widespread and destructive plant diseases in the recorded 

history of agriculture (1). Fusarium wilt is caused by the soilborne 

fungus Fusarium oxysporum f. sp. cubense, Foc. Foc is 

present throughout the world where bananas are grown. A 

particularly virulent strain capable of attacking Cavendish 

bananas in the tropics and referred to as tropical race 4 (Foc 

TR4), was discovered in 1997 in the Northern Territory. It has 

since led to the closure of several banana plantations (2). To 

date, Foc TR4 does not occur in any other state of Australia. Foc 

TR4 is capable of killing plants faster than any other strain and 

disease can build up rapidly without control measures (3). There 

is no method for eradicating the fungus. Current control 

measures involve limiting the spread of the pathogen within and 

between farms. However, these measures have often been 

ineffective and disease has continued to appear in new areas. 

The reasons behind this spread have not always been easy to 

explain. 

The banana weevil borer, Cosmopolites sordidus, is present in 

most banana production areas throughout the world. It causes 

damage to banana plants by boring into the rhizome and 

pseudostem to feed and lay eggs (4). Weevils are capable of 

crawling between banana plantations. Therefore, it is important 

to know if they are capable of spreading Foc TR4. 

This project aims to determine the presence of Foc TR4 on or in 

banana weevils. This is highly important, especially if this 

pathogen is detected in areas of Australia or other countries 

where it currently is not present. Revealing whether banana 

weevils are potential vectors of Foc TR4 will provide a greater 

understanding of disease epidemiology and could assist in 

limiting spread. 


Pseudostem traps were set at a Foc TR4 infested research site, 

the Coastal Plains Banana Quarantine Station (CPBQS), as well as 

a site free from Foc TR4. A total of 50 weevils were collected 

from the traps at CPBQS, as well as ten control weevils from the 

site not infested with Foc TR4. They were individually vortexed 

for in sterile distilled water (SDW) to loosen the fungal spores on 

the external section of the weevil. After vortexing the insects 

were surface sterilised before the internal sections were 

macerated in SDW. The SDW solutions from both the ‘external’ 

and macerated ‘internal’ sections were spread onto plates of 

malachite green agar. Fungal growth was subcultured onto 

potato dextrose agar and single spore isolates were obtained. 

DNA was extracted from putative Foc TR4 fungal growth and 

analysed using Foc TR4 specific primers to confirm the fungus 

identity. 

of the ten control weevils contained Foc TR4 spores, either 

internally or externally (Table 1). 

Table 1. Presence of Foc TR4 from Cosmopolites sordidus 

Trapping site 

Foc TR4 infested 50 

Not infested 

(control) 

No. of 

weevils 

analysed 

10 

Body part(s) 

analysed 

Internal 0 

External 10 

Internal 0 

External 0 

Recovery of 

Foc TR4 (%) 

DISCUSSION 

While Foc TR4 was not successfully detected in the internal 

sections of the weevils, it was detected on the external sections. 

These preliminary results imply that C. sordidus can act as a 

carrier for Foc TR4 and possibly assist with its dispersal within 

and between plantations. C. sordidus may also vector other 

strains of Foc present in Australia and throughout the world. 


The authors would like to acknowledge The Department of 

Agriculture, Fisheries and Forestry for providing the funds for 

this project. 

REFERENCES 

1. Stover, R.H., and Simmonds, N.W. (1987). ‘Bananas, third edition’, 

Longman Scientific and Technical, UK. pp 310–314. 

2. Condé, B.D., and Pitkethley, R.N. (2001). The discovery, 

identification and management of banana fusarium wilt outbreaks 

in the Northern Territory of Australia. In: ‘Banana Fusarium wilt 

management: Towards sustainable cultivation’ (Eds. A.B. Molina, 

N.H. Masdek, and K.W. Liew,). International Network for the 

Improvement of Banana and Plantain‐Asia and the Pacific Network, 

Los Banos, Philippines. pp 260–265. 

3. Daly, A. and Walduck, G. (2006). Fusarium wilt of bananas (Panama 

disease), Department of Primary Industry, Fisheries and Mines, NT, 

Agnote number I51. 

4. Gold, C. S., Pena, J. E. and Karamura, E. B. (2001). Biology and 

integrated pest management for the banana weevil Cosmopolites 

sordidus (Germar) (Coleoptera: Curculionidae). Integrated Pest 

Management Reviews 6(2): 79–155. 

RESULTS 

All the macerated internal sections of the weevils collected from 

the CPBQS tested negative for Foc TR4 fungal growth. However, 

viable spores were detected from the suspension created by the 

external sections of five of the 50 weevils by PCR analysis. None 


Posters 

76 Genetic diversity of Pseudocercospora macadamiae populations by PCR‐RFLP 

A.K. Miles{ XE "Miles, A.K." } A , O.A. Akinsanmi A , E.A. Aitken B and A. Drenth A 

A Tree Pathology Centre, The University of Queensland and Primary Industries and Fisheries, 80 Meiers Rd Indooroopilly, Brisbane, 4068, 

Queensland 

B School of Biological Sciences, The University of Queensland, St Lucia, 4072, Queensland 

INTRODUCTION 

Pseudocercospora macadamiae is known only to exist and cause 

husk spot of macadamia in commercial orchards in Australia (1, 

2). Field trials and observations suggest that the asexual conidia 

of the fungus are the most important infective propagule in the 

disease cycle (3). The teleomorphic state of P. macadamiae is yet 

to be observed in nature or culture (4). We hypothesise that the 

husk spot disease cycle lacks a teleomorphic state of P. 

macadamiae. 

Testing the hypothesis that a teleomorph is absent from the 

husk spot disease cycle by means of direct survey of orchards or 

native vegetation is challenging. However, if the teleomorph is 

absent from commercial orchards, it is expected that the lack of 

sexual reproduction would result in predominantly clonal 

populations of the fungus. Therefore, we investigated the 

genetic diversity of field populations of P. macadamiae to test 

our hypothesis. 


In order to determine the genetic diversity of P. macadamiae 

populations, 105 isolates were collected from diseased fruit from 

trees in three orchards located at Bundaberg (Qld), Glasshouse 

Mountains (Qld), and the Northern Rivers (NSW), respectively. 

DNA was extracted and PCR‐RFLP performed in duplicate for 6 

genes (actin, β‐tubulin, calmodulin, EFA, G3P and ITS), each 

digested with three restriction enzymes. 

RESULTS 

Results of the PCR‐RFLP study showed that more than 80% of the 

isolates were of the same genotype, with the predominant 

genotype occurring at frequencies of 64, 95, and 79% at 

Bundaberg, Glasshouse Mountains and Northern Rivers, 

respectively (Fig 1). The Northern Rivers population included the 

highest number of genotypes for a single location (5). The 

number of polymorphic alleles differentiating the identified 

genotypes was low. Of the six genes studied, actin, β‐tubulin, 

and EFA were the most polymorphic, whilst no polymorphisms 

were detected in the calmodulin, G3P or ITS genes. 

DISCUSSION 

We hypothesised that the husk spot disease cycle lacks a 

teleomorphic state of P. macadamiae. Our study shows the 

genetic diversity of P. macadamiae populations to be low, and 

that a single genotype predominates at all the collection sites. 

The lack of genetic diversity is supportive of our hypothesis, and 

evidence for any significant role of a teleomorph in the husk spot 

disease cycle remains elusive. 

Figure 1. Location of Pseudocercospora macadamiae collection sites and 

pie charts representing the genotype frequency within individual, and all, 

populations. Different segments of pies represent unique genotypes. 


We gratefully acknowledge the financial support of Horticulture 

Australia Ltd., Australian Macadamia Society Ltd., and The 

University of Queensland. 

REFERENCES 

1. Beilharz V, Mayers PE, Pascoe IG, (2003) Pseudocercospora 

macadamiae sp. nov., the cause of husk spot of macadamia. 

Australasian Plant Pathology 32, pp. 279–282. 

2. Akinsanmi OA, Miles AK, Drenth A, (2007) Timing of fungicide 

application for control of husk spot caused by Pseudocercospora 

macadamiae in Macadamia. Plant Disease 91, pp. 1675–1681. 

3. Miles AK, Akinsanmi OA, Aitken EAB, Drenth A. The disease cycle of 

Pseudocercospora macadamiae on macadamia. in 16th Biennial 

Australasian Plant Pathology Society Conference 24–27 September. 

2007. Adelaide, South Australia. 

4. Akinsanmi OA, Miles AK, Drenth A, (2008) Alternative fungicides for 

controlling husk spot caused by Pseudocercospora macadamiae in 

macadamia. Australasian Plant Pathology 37, pp. 141–147. 


32 Investigating the potential of in‐field starch accumulation tests for targeted citrus 

pathogen surveillance in Australia 

Posters 

A.K. Miles{ XE "Miles, A.K." } A , N. Donovan B , P. Holford C , R. Davis D , K. Grice E , M. Smith F and A. Drenth A 

A Tree Pathology Centre, The University of Queensland and Primary Industries and Fisheries, 80 Meiers Rd Indooroopilly, Brisbane, 4068, 

Qld 

B NSW DPI Elizabeth Macarthur Agricultural Institute, PMB 8, Camden, 2567, NSW 

C Centre for Plant and Food Science, University of Western Sydney, Locked Bag 1797, Penrith South DC, 1797, NSW 

D Northern Australian Quarantine Strategy, Australian Quarantine and Inspection Service, PO Box 96, Cairns International Airport, 4870, 

Qld 

E Mareeba Centre for Tropical Agriculture, Primary Industries and Fisheries, 28 Peters St, Mareeba, 4880, Qld 

F Bundaberg Research Station, Primary Industries and Fisheries, 49 Ashfield Road, Bundaberg, 4670, Qld 

INTRODUCTION 

Australia needs to be prepared to undertake large‐scale 

surveillance for the devastating, exotic disease of citrus, 

huanglongbing (HLB) (‘Candidatus Liberibacter’ species). One 

immediate obstacle is the potential for endemic diseases to 

exhibit HLB‐like symptoms, such as Australian citrus dieback 

(ACD) (possibly phytoplasma), and tristeza (Citrus tristeza virus) 

(CTV). Similar leaf symptoms include asymmetric 

mottling/chlorosis, vein yellowing and corking. In addition, 

effects of nutrient deficiency, wounding and other maladies can 

also be similar, adding to potential confusion. Because of this, 

the number of specimens collected based on visual symptoms 

would likely overwhelm current diagnostic capacity, and a rapid, 

in‐field test to help select diagnostic samples is needed. 

Starch accumulation has been well correlated to HLB symptoms 

in some studies (1–3) and could be a useful tool to aid 

surveillance. However, starch can accumulate due to nutrient 

deficiencies, insect damage and other factors including diseases 

other than HLB. Therefore, a preliminary study was undertaken 

to: i) compare two established starch tests; and ii) postulate the 

specificity of the starch tests amongst endemic citrus diseases. 


Citrus trees (grapefruit, mandarin, lemon, pommelo) and one 

tree of Murraya sp. were surveyed in the Burnett Basin, 

Queensland. Leaves showing asymmetric mottling and/or 

chlorosis, vein yellowing and/or corking, and corresponding 

healthy leaves were sampled. Leaves were field tested for starch 

accumulation through its reaction with iodine. The iodine 

reactions were carried out using both the “scratch” (2) and “leaf 

cut” (3) methods. The leaf cut method immersed the freshly cut 

edge of a leaf into iodine solution, then required inspection of 

the cut edge with a hand lens to visualise any inky blue/black 

colour development. The scratch method involved abrading the 

leaf surface with sandpaper, and then transferred the sandpaper 

to a ziplock bag containing an iodine solution. Any colour change 

was observed in the bag. 

Leaf samples were tested in the laboratory for pathogens 

capable of causing the symptoms of interest. Direct tissue blot 

immunoassay was used to detect CTV and molecular methods 

were used to detect phytoplasmas (ACD) and ‘Ca. Liberibacter’ 

species causing HLB. 

RESULTS 

In total 31 samples (20 symptomatic and 11 healthy) were 

collected and tested. No healthy samples were positive for 

starch accumulation by either method. Positive, partial, and 

negative results were found amongst the symptomatic samples 

(Table 1). Variation between methods was least amongst 

positive samples, according to either method, with 3 out of 5 

possible samples in agreement (60%). The greatest variation 

between the two methods was in the production of ambiguous 

results, with only 1 of 13 possible samples being in agreement 

(8%). 

Table 1. Starch accumulation Number of symptomatic samples positive, 

partial or negative for starch accumulation, determined by scratch or leaf 

cut methods, and the number of samples for which the methods agree. 

Starch reaction Scratch Leaf cut Agreement 

Positive 5 4 3 

Partial 2 13 1 

Negative 13 3 3 

The six positive starch reactions (by either method) could not be 

clearly attributed to any particular pathogen. However, one leaf 

sample was taken from a wounded branch, and another noted 

as possible early symptoms of Mycosphaerella citri. The causal 

agent of HLB, Ca. Liberibacter was not detected in any samples 

using the laboratory diagnostic assays. CTV was detected in 23 

leaf samples, 7 of which were asymptomatic, healthy leaves. An 

additional 3 leaves had symptoms typical of ACD, tested positive 

for phytoplasmas, but had negative/partial starch reactions. 

DISCUSSION 

Starch accumulation was detected in Australian citrus leaf 

samples using both methods and could not be attributed to any 

of the pathogens tested for. This suggests that the test may be 

of limited use for pre‐HLB incursion surveillance. If starch 

accumulation can be demonstrated to be useful post‐incursion 

(when HLB might be responsible for the majority of starch 

accumulation), the ‘scratch’ method is preferred due to its 

delivery of clear results and practicality for field use. Individual 

sampling kits for the scratch method can be easily pre‐prepared, 

the results photographed for record keeping, and the waste selfcontained 

for removal from the survey site and disposal. 


Assistance of Cherie Gambley is gratefully acknowledged. 

REFERENCES 

1. Eng L. A presumptive field test for huanglongbing (citrus greening 

disease). in Senior Officers' Conference, Department of Agriculture 

Sarawak, 11–14 December. 2007. Kuching, Sarawak. 

2. Takushi T, Toyozato T, Kawano S, Taba S, Taba K, Ooshiro A, 

Numazawa M, Tokeshi M, (2007) Scratch method for simple, rapid 

diagnosis of citrus huanglongbing using iodine to detect high 

accumulation of starch in the citrus leaves. Japanese Journal of 

Phytopathology 73, pp. 3–8. 

3. Etxeberria E, Gonzalez P, Dawson W, Spann TM, (2007) An iodinebased 

starch test to assist in selecting leaves for HLB testing. 

UF/IFAS EDIS HS375. 


Posters 

77 Priming for resistance against pathogens: cellular responses of Arabidopsis to 

UV‐C radiation 

S.J.L. Mintoff{ XE "Mintoff, S.J.L." }, P.T. Kay and D.M. Cahill 

Deakin University, School of Life and Environmental Sciences, Geelong, Victoria 3217 

INTRODUCTION 

Plants face many biotic and abiotic challenges in the 

environment including pathogen challenge and damage due to 

energetic wavelengths of light in the ultraviolet (UV) region, 

both of which have detrimental effects on plants. 

When Arabidopsis thaliana was irradiated with doses of UV‐C 

light between 0 and 500 J/m ‐2 , leaves showed resistance towards 

compatible isolates of the Oomycete Hyaloperonospora 

arabidopsis in a dose‐dependant manner (1). Previous research 

has strongly suggested that this priming response is linked to 

DNA damage and repair, both of which are invoked after UV‐C 

irradiation (2). 

0 J/m ‐2 

500 J/m ‐2 

0 h 24 h 48 h 

It is still unclear, however, which signals and biochemical events 

regulate this induced defence response and how they may relate 

to DNA damage/repair. Also, it is still not known if the same 

phenomenon can be used to induce resistance against other 

pathogens or whether UV radiation may be having more subtle 

non‐targeted effects on host cells. This study examines the 

cellular and tissue responses of Arabidopsis leaves following 

exposure to doses of ultraviolet radiation. 


UV‐C treatments. Arabidopsis Col‐0 plants were irradiated with 

different doses of UV‐C (500 and 1000 J/m ‐2 ). Plants were then 

returned to normal growth conditions. Leaf tissue was harvested 

at 0 and 24 hours post irradiation. 

Callose and reactive oxygen species assays. Leaves were stained 

for callose deposition with aniline blue (0.5%) and visualised 

using fluorescence microscopy. The production of hydrogen 

peroxide was visualised using 3, 3 diaminobenzidine (DAB). 

0 J/m ‐2 

0 h 24 h 

1000 J/m ‐2 

Figure 2. Leaf tissue stained with aniline blue, no callose is present in 

controls but at 500 and 1000 J/m ‐2 callose was induced at 24 and 48h 

(bright areas in the figure). 


H 2 O 2 production increased following UV treatment (Figure 1). 

Lack of DAB staining in the control showed low levels of H 2 O 2 to 

be present. However, at 500 J/m ‐2 increased H 2 O 2 production at 

24 hours was observed. Increased H 2 O 2 accumulation could also 

be seen in leaves exposed to 1000 J/m ‐2 at 0 and 24 hours. H 2 O 2 

production was associated with collapsed cells that appear to 

have undergone cell death. 

UV‐C radiation stimulated the deposition of callose in cells and 

cell walls in both a time and dose dependent manner (Figure 2). 

Deposition of callose was most intense at 1000 J/m ‐2 but less so 

for treatment at 500 J/m ‐2 at both 24 and 48 hours. Future work 

aims to determine if the induced resistance seen in interactions 

of Arabidopsis with H. arabidopsis occurs in other interactions of 

pathogens with different lifestyles (eg. biotrophs, hemibiotrophs 

and necrotrophs). 


We thank the Australian Research Council for funding. 

500J/m ‐2 

REFERENCES 

1. Kunz B.A, Cahill D.M, Mohr P.G, Osmond M.J, Vonrax E.J (2006) 

Plant Responses to UV Radiation and Links to Pathogen Resistance. 

International review of cytology 225: 1–40 

2. Kunz, B.A, Dando, P.K, Grice D.M, Mohr P.G, Schenk P.M, Cahill D.M 

(2008) UV‐induced DNA damage promotes resistance to the 

biotrophic pathogen Hyaloperonospora parasitica in Arabidopsis. 

Plant Physiology 148: 1021–1031 

1000J/m ‐2 

Figure 1. UV‐C treated leaf tissue stained with DAB, dark spots indicate 

the presence of H 2 O 2 within cells (solid arrows). Dead cells can be seen as 

stained collapsed cells (unfilled arrows). 


11 Boneseed rust: a highly promising candidate for biological control 

L. Morin{ XE "Morin, L." } A and A.R. Wood B 

A CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia 

B Agricultural Research Council, Plant Protection Research Institute, P Bag X5017, Stellenbosch 7599, South Africa 

Posters 

INTRODUCTION 

The woody evergreen shrub boneseed (Chrysanthemoides 

monilifera ssp. monilifera), which originates from South Africa, is 

a major invasive plant of natural ecosystems in Victoria and 

South Australia. Small infestations also occur in Tasmania. 

Improving the effectiveness of the biological control program 

against boneseed has been identified as a high research priority 

in the National Strategy for this Weed of National Significance, 

as none of the six insect agents released so far have established 

in the field. 

The systemic South African rust fungus, Endophyllum 

osteospermi, is a highly promising biological control agent for 

boneseed because it reduces growth and reproduction of plants 

by causing extensive deformation of infected branches (witches’ 

brooms). In South Africa the rust appears to be a primary cause 

for the decline and death observed in some local boneseed 

populations (1, 2). The systemic nature of the rust is a desirable 

characteristic for biological control purposes as once the fungus 

is established within the host the infection is retained until the 

death of the witches’ brooms. The boneseed rust is only 

recorded in South Africa on a small group of related plants of the 

genera Chrysanthemoides and Osteospermum (Calenduleae: 

Asteraceae). As there are no indigenous representatives of the 

Calenduleae in Australia, the non‐target plants most at risk from 

this rust fungus are the introduced, ornamental species 

belonging to this tribe. 

A novel approach had to be taken to test the host‐specificity of 

E. osteospermi, because it develops visible symptoms only 1–3 

years after infection of its host. We present in this paper results 

from host‐specificity tests so far. 


Host‐specificity tests. Tier 1 tests were performed on detached 

leaves of plant species of the approved test list to determine, 

using microscopy techniques, whether the rust was capable of 

penetrating epidermal cells of non‐target species. Additional Tier 

1 tests were also carried out on leaves still attached to plants of 

some of the species. 

Tier 2 tests on leaves still attached to plants of the species where 

penetration occurred in Tier 1 tests were performed to 

determine if the fungus was capable of colonising tissue of these 

species in the weeks following inoculation. 

Three series of Tier 2 tests were performed in South Africa and 

in the CSIRO quarantine facility in Canberra. No leaf colonisation 

was observed on boneseed and any of the other species tested. 

These results cast doubts on the belief that the fungus colonises 

plants via young leaves. It is possible that infection of axillary 

buds is essential for further colonisation. Alternatively, 

conditions during tests may have been slightly suboptimal and 

prevented infection to occur. 

DISCUSSION 

The difficulties encountered with Tier 2 tests prompted us to 

initiate a series of Tier 3 tests, whereby whole plants are 

repeatedly inoculated with the rust fungus over a few weeks and 

maintained for up to 2–3 years until witches’ broom symptoms 

developed. These tests were conducted in late winter 2008 and 

witches’ broom symptoms have not yet developed on boneseed 

or any other species inoculated. 

Results from host‐specificity tests will be used to fully assess the 

risk of significant impact on non‐target plant species, before 

deciding if an application for the release of this rust fungus in 

Australia should be submitted to the authorities. 


We thank Ms Gwen Samuels (PPRI) and Melissa Piper (CSIRO) for 

technical assistance. Financial support from CSIRO, Australian 

and New Zealand Environment and Conservation Council 

(ANZECC) and Land and Water Australia (Defeating the Weed 

Menace R&D initiative) is gratefully acknowledged. 

REFERENCES 

1. Wood AR (2002) Infection of Chrysanthemoides monilifera by the 

rust fungus Endophyllum osteospermi is associated with a reduction 

in vegetative growth and reproduction. Australasian Plant 


2. Wood AR, Crous PW (2005) Epidemic increase of Endophyllum 

osteospermi (Uredinales, Pucciniaceae) on Chrysanthemoides 

monilifera. Biocontrol Science and Technology 15, 117–125. 

3. Wood AR (2006) Preliminary host specificity testing of Endophyllum 

osteospermi (Uredinales, Pucciniaceae), a biological control agent 

against Chrysanthemoides monilifera ssp. monilifera. Biocontrol 

Science and Technology 16, 495–507. 

RESULTS 

In Tier 1 tests, successful penetration was observed on boneseed 

and its close relative species tested within the Calenduleae tribe 

(bitou bush [C. monilifera subsp. rotundata], Osteospermum 

spp., Dimorphotheca jucundum) (3). Penetration also occurred 

on four other species outside the Calenduleae (Gazania rigens, 

Gerbera jamesonii, Bedfordia arborescens, Eucalyptus 

cladocalyx). Additional Tier 1 tests carried out on leaves still 

attached to plants confirmed accuracy of results obtained with 

detached leaves. Penetration of epidermal cells however, does 

not necessarily imply that the infection process will continue and 

be successful. 


Posters 

10 Can additional isolates of the Noogoora burr rust fungus be sourced to enhance 

biocontrol in northern Australia? 

L. Morin{ XE "Morin, L." } A , M. Piper A , R. Segura B and D. Gomez A 

A CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia 

B CSIRO Entomology, Mexican Field Station, Veracruz, Mexico 

INTRODUCTION 

Noogoora burr (Xanthium occidentale) is an invasive plant across 

northern Australia, mostly inhabiting riparian areas. The exotic 

rust fungus Puccinia xanthii, illegally or accidentally introduced 

to Australia in the mid‐1970s, has been highly effective in 

controlling Noogoora burr in south‐eastern Queensland, but has 

had limited impact in tropical northern Australia (1). The 

introduction of additional isolates of this rust fungus better 

adapted to tropical conditions has been suggested as an 

approach to improve impact of this biological control agent in far 

northern regions (2). 

We present results from 1) surveys carried out in tropical 

America, 2) pathogenicity tests with Australian and exotic 

isolates of P. xanthii performed on Australian accessions of 

Noogoora burr and other Xanthium spp. and 3) the identification 

of a diagnostic marker that differentiates between Australian 

and exotic rust isolates. 


Surveys. Surveys for exotic isolates of P. xanthii were 

undertaken in 2007 in Venezuela, Mexico and Dominican 

Republic, areas that climatically match those of northern 

Australia where the rust fungus has not been highly effective (2). 

Rust‐infected material collected was pressed and dried and then 

placed at 4°C until shipment to the CSIRO quarantine facility in 

Canberra. 

Pathogenicity tests. Noogoora burr plants (ex. Daly River, NT) 

were inoculated with telia (3) collected from each of the 

overseas sites and from two purified Australian rust isolates (ex. 

Daly River and Victoria River, NT). This trial was repeated once. 

Additional inoculations of other Australian accessions of 

Noogoora burr and other Xanthium spp. were also performed. 

Diagnostic marker. Primers were designed from characterised 

Simple Sequence Repeats (SSR) loci isolated from P. xanthii. 

Primers were screened on the DNA of 29 single‐telium isolates 

from Australia, Hungary, Brazil, Argentina, Mexico and 

Dominican Republic. 

RESULTS 

Surveys. P. xanthii was found at 9 of the 13 Xanthium‐infested 

sites surveyed in Dominican Republic, and at three of the four 

infested sites in Mexico. None of the plants of the two Xanthium 

populations found in Venezuela were infected by the fungus. 

Pathogenicity tests. None of the Australian accessions of 

Noogoora burr and other Xanthium spp. inoculated with the 

exotic rust isolates developed disease symptoms, even though 

germination tests indicated the inoculum was viable. 

Microscopic examination of cleared and stained leaf samples 

from these plants showed typical plant resistance responses 

following penetration by the rust. In all trials, plants inoculated 

with the two Australian rust isolates developed disease 

symptoms. Closer examination of Xanthium specimens collected 

in Dominican Republic and Mexico revealed that they were 

morphologically and genetically different to Australian 

accessions (data not shown). 

Diagnostic marker. Several of the eight SSR markers identified 

differentiated rust isolates from Australia, Mexico and 

Dominican Republic, with SSR px09 being the most reliable 

diagnostic marker. 

DISCUSSION 

This body of work indicated that Australian Noogoora burr 

plants, as well as other Xanthium spp., are resistant to P. xanthii 

isolates collected in Dominican Republic and Mexico. This came 

as a major surprise considering previous research showed that 

an Australian isolate of the rust was capable of infecting the four 

different Xanthium species found in the ‘Noogoora burr 

complex’ in Australia: X. occidentale, X. italicum, X. orientale and 

X. cavanillesii (3). As a result, it was not possible to establish 

cultures of the exotic rust isolates for subsequent host‐specificity 

tests. 

SSR marker px09, could be developed into a simple PCR‐based 

diagnostic tool to differentiate between exotic and Australian 

isolates of P. xanthii. Such a tool would be valuable for 

monitoring the establishment of additional isolates of P. xanthii 

from tropical America after their release in Australia, providing 

that isolates pathogenic to Australian Noogoora burr plants can 

be found in the future. 

A more extensive follow‐up project is required to deliver on the 

original goal of introducing additional isolates of P. xanthii better 

adapted to the climate of tropical northern Australia. The 

establishment of an outdoor experimental garden consisting of 

northern Australian accessions of Noogoora burr in tropical 

America would be required to source pathogenic rust isolates. 


We are grateful to collaborators in Queensland, Northern 

Territory and NSW for collecting and sending seeds from various 

Noogoora burr infestations. Financial support from CSIRO, 

DAFWA and Land and Water Australia (Defeating the Weed 

Menace R&D initiative) is gratefully acknowledged. 

REFERENCES 

1. Morin L, Auld BA, Smith HE (1996) Rust epidemics, climate and 

control of Xanthium occidentale. In ‘Proceedings of the IX 

International Symposium on Biological Control of Weeds’ (Eds VC 

Moran, JH Hoffmann) pp. 385–391. (University of Cape Town). 

2. van Klinken RD, Julien MH (2003) Learning from past attempts: 

does classical biological control of Noogoora burr (Asteraceae: 

Xanthium occidentale) have a promising future? Biocontrol Science 

and Technology 13, 139–153. 

3. Morin L, Auld BA, Brown JF (1993) Host‐range of Puccinia xanthii 

and post‐penetration development on Xanthium occidentale. 

Canadian Journal of Botany 71, 959–965. 


12 Helicotylenchus nematode contributing to turf decline in Australia 

L. Nambiar{ XE "Nambiar, L." } A , J M. Nobbs B and M. Quader A 

A Department of Primary Industries, Private Bag 15, Ferntree Gully Delivery Centre Vic 3156, Australia 

B South Australian Research and Development Institute, Plant and Soil Health, Plant Research Centre, GPO Box 397, Glen Osmond, SA 

5064, Australia 

Posters 

INTRODUCTION 

Helicotylenchus species (spiral nematodes) are the most 

commonly detected plant‐parasitic nematodes found in turf 

samples. These nematodes are generally considered as 

migratory ectoparasitic and/or migratory semi‐endoparasitic 

feeders, that is, they feed from outside the roots or partially 

embedded inside the roots. Damage caused by these nematodes 

is light to dark brown or reddish brown necrotic lesions. The aim 

of this work was to identify the spiral nematode species causing 

turf decline in Australia. 

Turf samples were submitted to the Crop Health Services, DPI 

Victoria by green keepers and turf consultant companies for the 

diagnosis and assessment of plant‐parasitic nematodes 

associated with turf decline. These samples were from all 

mainland states as well as Tasmania and collected during 1996– 

2008. 

Helicotylenchus species can be difficult to identify and require 

comparison of characters such as tail shape, body on death, 

position of vulva and shape of lip region. Morphometrics are also 

used which include body length, stylet length, tail length and 

position of phasmids in relation to the anus. 

METHOD 

Extraction and Fixing. Nematodes were extracted from 200ml 

soil samples using the Whitehead tray technique, incubated at 

room temperature about 25°C for 48 hours. The specimens were 

collected in a 38µm sieve, fixed in 4:1 formalin‐acetic acid 

fixative and then processed through an alcohol/glycerol series to 

be mounted in glycerol on permanent slides. The slides were 

deposited in the Victorian Plant Pathology Herbarium, DPI 

Victoria. 

RESULTS 

Identification. The main morphological characters on which the 

identifications are based are presented in Table 1. 3,812 samples 

were received from bowling and golf greens for counts and 

identification of plant nematodes. Figure 1 shows New South 

Wales had the most samples from identified locations compared 

to other states (Fig.1). 

average of 393–6,345 (Table 2).The specimens found in turf 

samples were identified as Helicotylenchus pseudorobustus, H. 

dihystera and H. erythrinae. The most commonly found species 

was H. pseudorobustus and also it was recorded for the first time 

on turf in Australia. There were occasions when more than one 

species of Helicotylenchus was identified in a sample. 

Table 1. Morphological characters used to identify three species of 

Helicotylenchus from turf samples. 

Helicoytlenchus 

species 

Body 

length 

(μm) 

H. pseudorobustus 706– 

822 

H. dihystera 610– 

860 

H. erythrinae 480– 

610 

Tail shape 

Tail with distinct 

smooth ventral 

projection 

Tail with 

indistinct smooth 

ventral projection 

Tail with distinct 

pointed ventral 

projection 

Lip 

Annule 

Position of 

phasmid 

4–5 5–8 annules 

anterior to 

anus 

4–5 6–12 annules 

anterior to 

anus 

6–12 2 annules 

posterior, 4 

annules 

anterior to 

anus 

Table 2. Number of identified locations, samples and average of 

Helicotylenchus spp detected from various states of Australia. 

States 

No. bowling 

and golf 

greens 

Number of 

samples 

Average number of 

Helicotylenchus per 

sample (200 ml soil) 

SA 23 139 6,345 

VIC 90 289 1,234 

NSW 146 854 870 

QLD 34 116 1,662 

WA 10 25 613 

TAS 7 11 393 

DISCUSSION 

The threshold damage caused by spiral nematodes on turf has 

been calculated as 600 nematodes per 200ml soil. Of the total 

1955 Helicotylenchus detected samples, 30% of these were 

above the damage threshold. Helicotylenchus spp were found to 

be associated with declining couch grass (Cynodon dactylon) and 

for the first time in bent grass (Agrostis tenuis). Further survey 

work is required to investigate the distribution of each identified 

species and their role in turf decline in Australia. 

Figure 1. Distribution of Helicotylenchus in Australia 

The highest numbers per 200ml soil were detected from South 

Australia and lowest from Tasmania. The numbers of 

Helicotylenchus species present in each sample varied from an 


Posters 

78 The effect of phosphonate on the accumulation of camalexin following challenge 

of Arabidopsis by Phytophthora palmivora 

Zoe‐Joy Newby{ XE "Newby, Z.J." }, Rosalie Daniel and David Guest 

Faculty of Agriculture, Food and Natural Resources, The University of Sydney, 2006, NSW, Australia 

INTRODUCTION 

Potassium phosphonate (phosphonate) is commonly used to 

prevent and treat disease caused by various species of 

Phytophthora. Phosphonate acts by enhancing the innate 

defence response of the host plant (1), although the precise 

mechanisms remain unknown. Arabidopsis thaliana provides an 

opportune model for the study of plant‐pathogen interactions 

and when inoculated with P. palmivora, as phosphonate 

application induces an incompatable defence response (2). Part 

of this interaction may include the accumulation of the 

phytoalexin camalexin, however A. thaliana mutant studies 

suggest that camalexin is not always required for resistance. By 

assessing the effect of phosphonate at individual steps of the 

camalexin biosynthesis pathway, we aim to learn more about 

the phosphonate‐induced defence response and it’s role in 

pathogen restriction. 

METHODS 

Plant Material and Inoculations. Approximately 0.2mg of A. 

thaliana seed was added to each 125mL conical flask containing 

half strength MS supplemented with 20% sucrose with or 

without 100 mg/L phosphonate,pH6.5 (Agri‐Fos 600; Agrichem). 

Each flask was stoppered then shaken (120 rpm) under 12h 

light/dark at 24°C. After 21 days seedlings were inoculated with 

zoospores of P. palmivora (2). 

Extraction and analysis. Camalexin was sampled at 0, 12, 24 and 

48h post‐inoculation (pi). Approximately 0.3g of macerated 

tissue was boiled in 80% methanol (20 min, 65°C) then stored 

overnight at 4°C. Samples were centrifuged and the liquid 

fraction removed and evaporated. The residue was extracted 

three times with chloroform and the pooled chloroform fraction 

was evaporated to dryness. The pellet was dissolved in 500uL of 

50% menthol then samples were filtered. Camalexin was 

quantified utilising a C18 column on a Dionex HPLC system and 

verified with synthetic camalexin (kindly provide by Jane 

Glazebrook, University of Minnesota). Data were transformed if 

required and analysed using ANOVA. 


Camalexin accumulation in all treatments rapidly increased 

between 12 and 24h pi, and then decreased between 24 and 48h 

(Figure 1). There were no significant differences between any of 

the treatments (p=0.058), however the greatest increase in 

camalexin accumulation followed inoculation, whether plants 

had been treated with phosphonate or not. 

The ‘peak’ in camalexin accumulation at 24h has been reported 

in several ecotypes of Arabidopsis and can result from either 

biotic or abiotic factors (3). Of all treatments, we found that 

inoculated seedlings had the highest level of camalexin 

accumulation between 24–48 h pi. This supports the 

identification of camalexin as a phytoalexin, produced in 

response to pathogen attack. 

Figure 1. Camalexin Production in Arabidopsis treated with 

phosphonate and infected with P. palmivora; n=6; bars indicate 

standard error 

Accumulation as a result of abiotic factors reported previously 

(3), may explain why camalexin was routinely detected in 

uninoculated, untreated seedlings indicating that experimental 

conditions were enough to cause a small amount of camalexin to 

accumulate. 

Phosphonate reduced camalexin accumulation in uninoculated 

seedlings at 24 and 48 h pi to levels below that of controls. 

Inoculation of phosphonate‐treated seedlings restored 

camalexin accumulation however differences were not 

significant. This reduction in camalexin accumulation following 

phosphonate application was unexpected but has been 

confirmed in subsequent experiments. 

Although phosphonate has been shown to elicit an incompatible 

interaction between Arabidopsis and P. palmivora (2), camalexin 

does not appear to play a significant role in phosphonateinduced 

resistance. This indicates that the interaction between 

phosphonate‐treated Arabidopsis and P. palmivora involves the 

activation of multiple lines of defence. The signalling pathways 

activated by phosphonate in this pathosystem still remain 

unclear, but the availability of Arabidopsis defence‐related 

mutants will aid elucidation of the interaction. 

REFERENCES 

1. Guest & Grant (1991) the complex mode of action of phosphonates 

as antifungal agents. Biological Review 66, 159–187 

2. Daniel R & Guest D (2006) Defence responses induced by 

potassium phosphonate in Phytophthora palmivora‐challenged 

Arabidopsis thaliana. Physiological and Molecular Plant Pathology 

67, 194–201 

3. Schuhegger R, Rauhut T & Glawischnig E (2007) Regulatory 

variability of camalexin biosynthesis. Journal of Plant Physiology 

164, 636–644 


79 Characterisation of Phytophthora capsici isolates from black pepper in Vietnam 

N.V. Truong{ XE "Truong, N.V." } A , L.W. Burgess B and E.C.Y. Liew C 

A School of Agriculture and Forestry, Hue University, 102 Phung Hung Street, Hue city, Vietnam 

B Faculty of Agriculture, Food and Natural Resources, The University of Sydney, NSW 2006, Australia 

C Royal Botanic Gardens Sydney, Botanic Gardens Trust, Mrs Macquaries Road, Sydney, NSW 2000, Australia 

Posters 

INTRODUCTION 

Since the establishment of Phytophthora capsici as the causal 

agent of black pepper foot rot in Vietnam (Truong et al. 2008), 

there is an urgent need to understand the population structure 

of this pathogen. The role of genetic diversity and geographic 

structuring of P. capsici foot rot epidemics of black pepper is not 

known. It is assumed that environmental effects, host 

susceptibility and cultivation practices facilitate selection 

pressures, which in turn affects the changes in the pathogen 

population structure, and subsequently the pattern of disease 

incidence. In order to make decisions regarding the direction of 

disease management strategies, the population structure of this 

pathogen needs to be explored. We begin to address these 

issues by testing two hypotheses. The first is that only one 

mating type exists in the P. capsici population from black pepper 

in Vietnam. The second is that the P. capsici population is 

genetically undifferentiated in two different climatic regions. 

consists of isolates obtained from all provinces in both regions. 

The results also indicate that isolates are not genetically 

correlated with mating type. 


Isolates origin. Phytophthora capsici was isolated from soil and 

plant samples obtained from provinces in the Southeast region 

(SE) and the North Central Coast region (NCC) (Truong et al. 

2008). 

Mating type analysis. Each isolate was paired on V8 Agar with 

known A1 and A2 testers. Test isolates producing oospores with 

both A1 and A2 were scored as A1A2. The test was replicated 3 

times. 

DNA extraction, RAMS and REP‐PCR protocol and genetic 

analysis. Fungal mycelium was grown in liquid medium, 

incubated at 25°Cin the dark for 5–6 days and DNA was 

extracted. The RAMS and REP‐PCR fingerprinting protocols were 

performed as previously described by Hantula et al. (1996) and 

Rademaker & Bruijn (1997). Cluster analysis was performed 

using the DICE similarity coefficient and UPGMA agglomeration 

in the program NTSYSpc. 

RESULTS 

Mating type analysis. Both A1 and A2 mating types were found to 

co‐exist within the same farm in 13 cases in Dong Nai (SE) and 

Quang Tri (NCC) provinces. In addition, A1 and A2 mating types 

were also observed to co‐exist on the same plant in one case in 

Quang Tri province. 

RAM and REP analysis. In order to assess the overall genetic 

diversity of the whole population and relationship between the 

two regional subpopulations, the combined data from RAMS and 

REP analyses were used to construct an UPGMA dendrogram (Fig 

1). The P. capsici isolates from black pepper are distributed in 

two main groups, I and II, which are differentiated at DICE 

similarity of 53%. Group I comprises 114 isolates with 108 

belonging to one large clonal group, two isolates in a small clonal 

group and four with unique phenotypes. Group II comprises four 

isolates, all with unique phenotypes. The genetic similarity 

analysis showed that more than 91% of all isolates were 

genetically identical and the whole population was nearly 

homogeneous. The clustering of isolates in the dendrogram does 

not correlate with geographic origin. The large clonal group 

Figure 1. UPGMA dendrograms of 118 isolates of Phytophthora capsici 

based on combined RAMS and REP data 

DISCUSSION 

The analysis of P. capsici isolates obtained from various growing 

regions revealed the presence of both mating types in two 

different climatic regions, with the A2 type detected at higher 

frequency than the A1 type. Overall the level of genetic diversity 

detected among the P. capsici isolates from black pepper was 

relatively low. One hundred and eight isolates were found to be 

identical in their RAMS and REP phenotypes. The genetic pattern 

of the P. capsici population was not found to be associated with 

geographic origin, and hence the two regional subpopulations 

were undifferentiated. The current report provides preliminary 

but useful information concerning the extent of genetic diversity 

and geographic distribution of P. capsici from black pepper in 

Vietnam. 


The authors wish to thank ACIAR for sponsoring this research. 

REFERENCES 

Truong NV, Burgess LW, Liew ECY, 2008. Prevalence and aetiology of 

Phytophthora foot rot of black pepper in Vietnam. Australasian 



Posters 

80 Characterisation of Phytophthora capsici Isolates from chilli in Vietnam 

N.V. Truong{ XE "Truong, N.V." } A , L.W. Burgess B and E.C.Y. Liew C 

A School of Agriculture and Forestry, Hue University, 102 Phung Hung Street, Hue city, Vietnam 

B Faculty of Agriculture, Food and Natural Resources, The University of Sydney, NSW 2006, Australia 

C Royal Botanic Gardens Sydney, Botanic Gardens Trust, Mrs Macquaries Road, Sydney, NSW 2000, Australia 

INTRODUCTION 

Phytophthora capsici, a pathogen of a range of tropical crops, 

such as black pepper, betel, cacao and rubber, is not managed 

effectively in developing countries due to lack of knowledge on 

the interactions between the pathogen and its many hosts 

(Drenth and Guest 2004). Although diseases of crops caused by 

P. capsici in temperate regions have been investigated in great 

detail, a lot less is known about this species in the South East 

Asian region. P. capsici is the causal agent of black pepper foot 

rot. With the need for integrated disease management in mind, 

questions arise as to the cross‐infectivity of the pathogen from 

different hosts and whether chilli could be an alternative host 

harbouring the black pepper pathogen. This study described the 

testing of three hypotheses. The first was that P. capsici isolates 

from chilli were pathogenic on black pepper and conversely 

black pepper isolates on chilli. The second was that chilli isolates 

were genetically different from black pepper isolates. The third 

was that there was genetic diversity among P. capsici isolates 

from chilli. 


Phytophthora capsici isolates. Twenty‐two isolates of P. capsici 

from chilli pepper (Capsicum frutescens L.) recovered from soil 

and diseased plants in Da Lat and Quang Nam provinces were 

used in this study. Twenty‐four isolates of P. capsici from black 

pepper were also used to compare with isolates from chilli 

pepper in the genetic analysis. In addition, an isolate each 

representing Phytophthora species P. palmivora and P. 

nicotianae was also included as species comparison in the RAMS 

and REP‐PCR analysis. 

Pathogenicity. Six leaves of black pepper or chilli were placed in 

a metal tray in 3 rows on layers of moist tissue. Leaves of black 

pepper or chilli were pricked with a sterile needle and inoculated 

with 5 µL of zoospore suspension. Uninoculated samples were 

similarly inoculated with sterilised deionised water. 

DNA extraction, RAMS and REP‐PCR protocol and genetic 

analysis. Fungal mycelium was grown in liquid medium, 

incubated at 25℃ in the dark for 5–6 days and DNA was 

extracted. The RAMS and REP‐PCR fingerprinting protocols were 

performed as previously described by Hantula et al. (1996) and 

Rademaker & Bruijn (1997). Cluster analysis was performed 

using the DICE similarity coefficient and UPGMA agglomeration 

in the program NTSYSpc. 

RESULTS 

Pathogenicity test. Chilli leaves inoculated with isolates from 

black pepper developed ‘water‐soaked lesions’, whereas the 

isolates from chilli tested on black pepper leaves showed lesions 

with fimbriate margins. 

RAM and REP analysis. The data from RAMS and REP‐PCR were 

combined to construct an UPGMA dendrogram (Figure. 1). A 

total of 7 phenotypes were detected, of which 4 were unique 

and 3 represented clonal groups. The first clonal group 

comprised 4 chilli isolates from Dalat. The second contained 18 

chilli isolates from Quang Nam. The third was 20 isolates from 

black pepper. The four unique isolates were from black pepper. 

The isolates from black pepper were separated from the chilli 

isolates at a similarity level of

53 The inhibitory effect of sumac stem extract on some fungal plant pathogens 

N. Panjehkeh{ XE "Panjehkeh, N." } A , M. Abdolmaleki A , M. Salari A , S. Bahraminejad B 

A University of Zabol, Sistan and Baluchestan, Zabol, Iran 

B University of Razi, Kermanshah, Iran 

Posters 

INTRODUCTION 

Plants produce more than 10000 secondary metabolites with 

low molecular weights, many of which prevent plant infections 

to diseases and pests (2). Methanolic extract of sumac rich in 

hydrolysable tannins and proanthocyanidins (5) has 

demonstrated high inhibitory activity to Bacillus, Staphylococcus 

aureus and Enterobacter phlei (6). 


Plant material. Sumac (Rhus coriaria) stems at the final stage of 

growth were collected from their natural habitat in Hamedan, 

Iran, in September 2007. The stems were dried at ambient 

temperature in shade at a laboratory. They were ground using a 

mill, and passed through a 1‐mm mesh metal sieve. 

Extraction method. Soluble compounds were extracted in 

methanol (1). Five grams of powdered stem was placed into a 

bottle containing 100 ml absolute methanol. The bottles were 

capped and shaken in a rotary shaker at 350 rpm at 20 ° C for 24 

hours. Then, 75 ml of the solution from each bottle was removed 

and poured separately into another bottle. To each bottle was 

added 25 ml of sterilised distilled water and 100 ml hexane. The 

bottles were capped and shaken at 350 rpm for 2 hours. 

Subsequently, the aqueous phase was separated. The 

methanolic extracts were placed into a hood to evaporate the 

methanol. 

Pathogens. Phytophthora drechsleri and Rhizoctonia solani were 

isolated from beet roots, and Fusarium oxysporum and Bipolaris 

sorokiniana were isolated from chickpea and wheat roots, 

respectively. The pathogenicity of the pathogens confirmed on 

their hosts. 

Poison food technique. Based on the method of Hagerman and 

Butler (4), the inhibitory effect of 500, 1000, 1500, and 2000 

ppm from the extract was examined using a completely 

randomised design with four replicates. The zero level (just 

solvent) was used as control. The calculated extract for each 

concentration required to poison 100 ml PDA was dissolved in 

1.5 ml of methanol, and added to the autoclaved PDA when 

cooled down to 40 ° C. The poisoned PDA was dispensed in 25 ml 

aliquots into 9 cm Petri plates and allowed to cool. The plates 

were inoculated with 6 mm diameter discs from cultures of the 

fungi. The inoculated plates were incubated at 25 ° C. Colony 

diameters were measured frequently until the fungal growth in 

the control plates completely covered the plates. The 

experiment was repeated twice. 

Calculation of inhibitory percentage. The inhibitory effect of 

different extract concentrations was calculated using the 

following formula (3): 

IP = 100(C‐T)/C 


The inhibitory effects of extracts increased as the extract 

concentration increased. The effectiveness of the extract against 

R. solani and B. sorokiniana was more than against F. oxysporum 

and P. drechsleri (Table 1). Complete inhibition of growth of R. 

solani took place at 1500 ppm, while 2000 ppm of extract had 

81% inhibitory effect on B. sorokiniana. It is likely that by 

increasing extract concentration against this and the other two 

fungal species, the inhibitory effect could be increased to 100%. 

Table 1. Growth inhibition (%) of four fungi by different concentrations 

(ppm) of methanolic extract from sumac. 

Extract 

conc F. oxysporm R. solani P. drechsleri B. sorokiniana 

500 

1000 

1500 

2000 

28.12 

48.04 

51.01 

59.08 

84.46 

89.64 

100 

100 

1.08 

1.90 

8.15 

59.51 

68.56 

72.15 

74.26 

81.22 

The crude methanolic extract and isolated constituents of 

another member of this genus, Rhus glabra, was effective 

against 11 gram negative and positive bacteria (7) and nine 

pathogenic fungi (6). The research result was in conformity with 

previous findings regarding antifungal activity of sumac extract. 

In conclusion, the crude methanolic extract of sumac can be 

used as an antifungal agent against the examined fungi, 

particularly R. solani and B. sorokiniana. 

REFERNCES 

1. Bahraminejad S, Asenntorfer RE, Riley IT, Zwer P, Schultz CJ, 

Schmidt O 2006 Genetic variation of flavonoid defence compound 

concentration in Oat (Avena sativa L.) entries and testing of their 

biological activity. Proceedings of the 13th Australasian Plant 

Breeding Conference pp. 1127–1132. 

2. Cowan MM 1999 Plant products as antimicrobial agents. Clinical 

Microbioligy Reviews 12, 564–582. 

3. Hadian JS, Fakhr Tabatabaei M, Salehi P, Hajieghrari B, Ghorban 

Pour M 2006 A phytochemical study of Cymbopogon parkeri 

essential oil, and its biological activity against some 

phytopathogenic fungi. Iranian Journal of Agricultural Sciences 37, 

425–431. 

4. Hagerman AE, Butler LG 1989 Choosing appropriate methods and 

standards for assaying tannin. Journal of Chemical Ecology 15, 

1795–1810. 

5. Kosar K, Bozan B, Temelli F, Baser KHC 2007 Antioxidant activity 

and phenolic composition of sumac (Rhus coriaria L.) extracts. Food 

Chemistry 103, 952–959. 

6. McCutcheon AR, Ellis, SM, Hancock, REW, Towers, GHN 1994 

Antifungal screening of medicinal plants of British Columbian native 

peoples. Journal of Ethnopharmacology 44, 157–169 

7. Saxena G, McCutcheon AR, Farmer S, Towers GHN, Hancock REW 

1994 Antimicrobial constituents of Rhus glabra. Journal of 

Ethnopharmacology 42, 95–99. 

where IP is inhibitory percentage; C is the colony diameter of the 

control; and T is the colony diameter of the treatment. 


Posters 

33 Aerial photography—a tool to monitor Mallee onion stunt 

S.J. Pederick{ XE "Pederick, S.J." }, J.W. Heap, T.J. Wicks, S. Anstis and G.E. Walker 

South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001 South Australia 

INTRODUCTION 

Mallee onion stunt (MOS) is a widespread disease that was 

identified in the Murray Mallee of South Australia in 2005 (1). It 

is associated with specific strains of Rhizoctonia solani which 

cause stunted patches of economic significance. Rhizoctonia 

bare patch (AG 8) is a common disease of both cereals and 

onions. Cereal crops are often rotated with onions. Monitoring 

this disease over large areas is time consuming and complex. In 

this research aerial imagery was evaluated as a tool for MOS 

mapping and monitoring. 


High resolution aerial imagery was captured using two digital 

cameras mounted on an unmanned aerial vehicle (UAV). 

Normalised Difference Vegetation Index (NDVI = Red‐ 

NIR/Red+NIR) was used to estimate relative biomass. Colour 

images of complete onion pivots were constructed by mosaicing 

multiple images. Images and maps were geo‐referenced using 

DGPS ground control points. Low NDVI areas were identified as 

putative disease patches, and paired soil samples were collected 

from within the disease patches and in adjacent normal areas. 

DNA was extracted from soil and assayed for Rhizoctonia using 

PCR (2). 


MOS patches are shown in an example colour image of an onion 

pivot (Fig. 1), and an NDVI (relative biomass) map from the same 

pivot is shown in Fig. 2. An example of a mosaiced complete 

pivot image is shown in Fig. 3. Levels of Rhizoctonia DNA (AG 8) 

in soil from stunted patches were significantly higher (396.4 pg 

DNA/g soil) than those from adjacent normal patches (26.1). 

Aerial imagery using a UAV is a rapid, cheap and effective tool 

for monitoring and mapping onion diseases. Raw images were 

viewed on a field computer within 15 minutes of 

commencement of the UAV flight. These were used to identify 

general areas of interest for immediate disease scouting, and 

geo‐referenced NDVI maps allowed sampling points to be 

located within 1m on the ground. The imagery was particularly 

useful and interesting for growers, who were often able to 

contribute valuable interpretation of biomass patterns. Further 

research to collect more data from sampling points identified 

from biomass maps is planned. 

Figure 2. NDVI (relative biomass) map. MOS patches (low biomass) are 

light tone patches. 

Figure 3. Complete mosaiced onion pivot image. 


This project was facilitated by Horticulture Australia Limited in 

partnership with AUSVEG and was funded by the Onion Levy. 

The Australian Government provides matched funding for all 

HAL Research and Development activities, and onion growers in 

the Mallee region are thanked for their support. Thank you to 

the SARDI Diagnostic laboratory for PCR assays, and thank you to 

Angela Lush for laboratory support. 

REFERENCES 

1. Pederick SJ, Wicks TJ, Walker GE, Hall BH, Walter A (2007) Studies 

on the cause of Mallee Onion Stunt in South Australia. In: 

‘Proceedings of the 16th Biennial Australasian Plant Pathology 

Society Conference’ South Australia, page 59. 

2. Ophel Keller K et al. (2006) DNA monitoring tools for soilborne 

diseases of potato. In: ‘Proceedings of the 4th Australasian 

soilborne diseases symposium’, New Zealand, page 66. 

Figure 1. Colour image showing MOS bare patches. 


81 Survey of viruses infecting sweet potato crops in New Zealand 

Z.C. Perez‐Egusquiza{ XE "Perez‐Egusquiza, Z.C." } 3 , L.I. Ward 1 , J.D. Fletcher 2 and G.R.G. Clover 1 

1 Plant Health and Environment Lab, MAF Biosecurity New Zealand 

2 Plant and Food Research, Christchurch 

Posters 

INTRODUCTION 

Sweet potato or kumara (Ipomoea batatas) is important 

culturally and as a food source in New Zealand. The annual 

production of about 20,000 tonnes is grown mainly in the 

districts of Auckland, Bay of Plenty and Kaipara in the North 

Island. In January 2008, virus symptoms that included chlorotic 

spots, ring spots, vein clearing and mottling were observed on 

the leaves of commercial sweet potato crops (mainly cvs. 

Beauregard, Owairaka Red and Toka Toka Gold) growing in the 

three main production areas. A survey was done to determine 

the extent of virus infection affecting these crops. 


Samples. Fifty to 100 leaves were collected randomly from each 

of 26 different fields, five in Pukekohe (Auckland), nine in 

Gisborne (Bay of Plenty) and twelve in Dargaville (Kaipara). 

Leaves from each field were bulked into groups of 10, giving a 

total of 173 composite samples. 

Real‐time PCR. Total nucleic acid was extracted from all 173 

composite samples, and used in real‐time PCR assays specific for 

Sweet potato leaf curl virus (SPLCV) and real‐time reverse 

transcription (RT)‐PCR assays specific for Sweet potato chlorotic 

stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV), 

Sweet potato virus G (SPVG), and Sweet potato virus 2 (SPV2; 

synonym Sweet potato virus Y). 

Graft inoculation. Representative plants from each field were 

grafted onto 3–4 week old Ipomoea setosa plants. Symptoms 

were monitored for 3–5 weeks and leaves were collected for 

testing. 

NCM‐ELISA. Nitrocellulose membrane enzyme‐linked 

immunosorbent assays (International Potato Center‐CIP, Lima, 

Peru) were done on the original sweet potato samples and 

grafted I. setosa. The following viruses were tested for: 

Cucumber mosaic virus (CMV), C‐6 virus, Sweet potato caulimolike 

virus (SPCaLV), Sweet potato chlorotic fleck virus (SPCFV), 

SPCSV, Sweet potato latent virus (SwPLV) and Sweet potato mild 

specking virus (SPMSV). 

RESULTS AND DISCUSION 

Real‐time RT‐PCR detected the potyviruses SPVG, SPFMV and 

SPV2 in many of the samples. Table 1 presents results showing 

these three viruses are common in the three areas surveyed. 

Figure 1 shows symptoms in two different cultivars infected with 

the three viruses. SPFMV and SPVG have been reported in New 

Zealand (1, 2) but SPV2 had not been reported previously (3). 

Samples infected with SPV2, were found as single infections, in 

co‐infection with SPVG and SPFMV, or with SPVG but not SPFMV, 

but no samples were co‐infected with SPV2 and SPFMV when 

SPVG was absent. No samples were infected with SPLCV. 

None of the original kumara samples were positive for CMV, C‐6 

virus, SPCSV, SPCaLV, SPCFV, SwPLV or SPMSV by NCM‐ELISA. No 

samples tested positive for SPCSV by real‐time PCR or NCM‐ 

ELISA. 

Symptoms on grafted I. setosa were typical of potyvirus infection 

and no additional viruses were detected when they were tested 

by NCM‐ELISA. 

Table 1. Viruses in sweet potato in New Zealand. 

No. of fields 

tested 

No. of infected fields 

(No. of infected samples) 

(No. of 

samples 

tested) SPV2 SPFMV SPVG 

Dargaville 12 (103) 6 (35) 12 (70) 11(82) 

Pukekohe 5 (40) 4 (17) 2 (12) 5 (27) 

Gisborne 9 (30) 7 (18) 9 (30) 9 (30) 

Total 26 (173) 17(70) 23(112) 25(139) 

A 

Figure 1. Two sweet potato cultivars showing A) chlorotic spots and B) 

ring spots. Both samples were infected with SPVG, SPFMV and SPV2. 

Single potyvirus infections cause mild or no symptoms in sweet 

potato, and consequently yield is not significantly reduced. 

However, co‐infection with other viruses such as SPCSV 

produces a synergistic effect and more severe disease symptoms 

(4). 

SPCaLV, SPCFV, SwPLV have been reported in New Zealand 

previously (1) but they were not detected during this survey. 

ACKNOWLEDGMENT 

We would like to thank the Kumara growers who supported this 

work by allowing us to sample their crops, and without whose 

co‐operation this survey would not have been possible. 

REFERENCES 

1. Pearson MN, Clover GRG, Guy PL, Fletcher JD, Beever RE (2006) A 

review of the plant virus, viroid and mollicute records for New 

Zealand. Australasian Plant Pathology 35: 217–252. 

2. Rännäli M, Czekaj V (2008) Molecular genetic characterization of 

Sweet potato virus G (SPVG) isolates from areas of the Pacific 

Ocean and Southern Africa. Plant Disease 92: 1313–1320. 

3. Perez‐Egusquiza Z, Ward LI, Fletcher JD, Clover GRG (2009) 

Detection of Sweet potato virus 2 in sweet potato in New Zealand. 

Plant Disease 93: 427. 

4. Untiveros M, Fuentes S, Salazar LF (2007) Synergistic interaction of 

Sweet potato chlorotic stunt virus (Crinivirus) with carla‐, cucumo‐, 

ipomo‐, and potyviruses infecting sweet potato Plant Disease 91: 

669–676. 

B 


Posters 

54 Evaluation of commercial cultivars for control of white blister rust in Brassica rapa 

and Brassica oleracea vegetables 

J.E. Petkowski{ XE "Petkowski, J.E." } A , F. Thomson B , E.J.Minchinton A and C. Akem C 

A Biosciences Research Division, Department of Primary Industries, Private Bag 15, Ferntree Gully DC 3156, Victoria, Australia 

B Biometrics Unit, Department of Primary Industries, Private Bag 15, Ferntree Gully DC 3156, Victoria, Australia 

C Ayr Research Station, Department of Primary Industries and Fisheries, PO Box 5, Ayr 4807, Queensland, Australia 

INTRODUCTION 

White blister rust of Brassicaceae is caused by an oomycete 

Albugo candida. The disease affects many economically 

important crops including Brassica oleracea and B. rapa 

vegetables in Australia and around the world (Petkowski 2008). 

White or creamy pustules filled with zoosporangia on leaves, 

stems and heads as well as hypertrophy and hyperplasia of plant 

organs downgrade the aesthetics and marketability of the 

produce. In vegetable production, white blister rust is commonly 

controlled with fungicides. Planting resistant cultivars, however, 

is the most cost‐effective and desirable disease control method 

(Li et al 2007). A number of commercial cultivars of B. oleracea 

and B. rapa are sold as “tolerant” to A. candida pathotypes 

occurring on these species in Australia. 

We report on the evaluation of commercial cvs of B. oleracea 

and B. rapa in glasshouse screening trials. 


In two glasshouse experiments, seedlings of 10 cvs of B. rapa 

and 12 cvs of B. oleracea were tested for resistance to A. 

candida collections from Chinese cabbage and broccoli, 

respectively. Each experiment included hosts with reported 

susceptibility or resistance as controls. In each experiment, 

seeds were sown in seed‐raising mix in plastic multipot trays of 

144 pots per tray. Seedlings were irrigated twice a day for 1 

minute by overhead sprinklers. Plants in both experiments were 

fertilised weekly with Aquasol. 

Inocula were prepared by suspending zoosporangia in sterile 

distilled water at the concentration of 1x10 5 zoosporangia per 

mL. Prior to inoculation, the suspensions were incubated for four 

hours at 13 ºC to induce zoospore release. Inocula were applied 

twice in each of the experiments using a trigger atomiser on 

seedlings previously misted with sterile distilled water. The first 

inoculation was at the fully developed cotyledon stage and the 

second at the first true leaf growth stage. Seedlings were 

covered with plastic sheets after each inoculation for 24 hours to 

ensure sufficient leaf wetness for infection. White blister 

incidence and severity on hosts was assessed on 4 week‐old and 

on 5 week‐old seedlings in experiments with B. rapa and B. 

oleracea, respectively. Incidence was expressed as a percentage 

of the seedlings with symptoms. Disease severity was rated on 

seedlings with sori using a 0–4 scale. Experiments were designed 

as randomised complete blocks of treatments (12 hosts) with 8 

replications. Data were analysed using ANOVA. 


All varieties of B. rapa vegetables tested were either very of 

moderately susceptible to white blister (Table 1). Miyako and 

Walz were significantly more susceptible than other cultivars 

tested. Pak choi cv Seven Gates had smaller blisters surrounded 

by discoloured rings of leaf tissues, indicating some level of 

resistance to the A. candida collection tested. 

glasshouse conditions. Means followed by different letters are 

significantly different at the 5% level. 

B. rapa 

Cultivar 

n=96 

Mean 

Incidence 

(%) 

Mean 

Severity 

Scale 

(0–4) 

B. oleracea 

Cultivar 

n=96 

Mean 

Incidence 

(%) 

Mean 

Severity 

Scale 

(0–4) 

Miyako 91.3 a 2.2 a Greenbelt* 79.8 a 1.6 a 

Walz 80.1 a 1.3 b Forte* 76.6 a 1.7 a 

Mei Qoing 72.9 b 1.3 b Highfield 53.6 b 1.1 b 

Cv 001 70.6 b 1.1 b Brittany 44.5 bc 0.9 b 

Matilda 66.9 b 1.0 b Millenium 35.7 cd 0.6 bc 

Seven Gates 60.5 b 0.9 b Summer Love 35.6 cd 0.8 bc 

Manoko 60.4 b 0.8 b Sting 25.3 d 0.3 c 

Reward* 58.0 b 1.0 b Cyrus 4.2 e 0.1 c 

Torch* 55.3 b 1.4 b Avalanche 0.0 0.0 

Joi Choi 56.3 b 0.7 b Abacus 0.0 0.0 

Kailaan* 5.6 c 0.0 c Romulus 0.0 0.0 

Regent* 0.0 c 0.0 c NIZ17‐1091 0.0 0.0 

*) Cultivars incorporated either as positive or negative controls. Cultivars Regent (B. 

napus) and Kailaan (B. oleracea) are negative controls. 

Brussels sprouts cultivars Abacus and Romulus had no white 

blister, cv Cyrus had a very low incidence (4.2%) of seedlings 

with blisters and cv Millenium was susceptible (36% of seedling 

affected). All but one cauliflower cultivar, Avalanche, were 

susceptible (Table 1). Cabbage cv Sting, which is susceptible to 

European A, candida, was moderately susceptible to the 

Australian A. candida. The moderately susceptible cv NIZ17‐ 

1091, however, was resistant to the collection tested. White 

blister rust was the most severe on cauliflower cv Forte followed 

by broccoli Greenbelt. White blister rust control can be 

improved by planting less susceptible cvs combined with 

fungicide sprays timed by using the Brassica Spot disease risk 

predictive model (Petkowski 2008). 

AKNOWLEDGEMENTS 

The authors thank seed companies for supplying seeds and HAL, 

AusVeg, the State Government of Victoria and the Federal 

Government for financial support. 

REFERENCES 

1. Li CX, Sivasithamparam K, Walton G, Salisbury P, Burton W, Banga 

SS, Banga S, Chattopadhyay C, Kumar A, Singh R, Singh D, Agnohotri 

A, Liu YC, Fu TD, Wang YF and Barbetti MJ (2007) Expression and 

relationships of resistance to white rust (Albugo candida) at 

cotyledonary, seedling, and flowering stages in Brassica juncea 

germplasm from Australia, China, and India. Australian Journal of 

Agricultural Research, 58: 259–264. 

2. Petkowski JE (2008) Biology and control of white blister rust of 

Brassicaceae vegetables. PhD Thesis, Deakin University, Australia. 

Table 1. Incidence and severity of white bister rust on seedlings of 

commercial cultivars of B. rapa and B. oleracea vegetables inoculated 

with A. candida collections from Chinese cabbage and broccoli in 


34 Diatrypaceae species associated with grapevines and other hosts in New 

South Wales 

Posters 

W.M. Pitt{ XE "Pitt, W.M." }, R. Huang, C.C. Steel and S. Savocchia 

National Wine and Grape Industry Centre, School of Agricultural and Wine Sciences, Charles Sturt University, Locked Bag 588, Wagga 

Wagga, NSW 2678, Australia 

INTRODUCTION 

The fungus Eutypa lata is responsible for the canker disease of 

grapevines known as Eutypa dieback. Entry of the fungus via 

pruning wounds and the formation of cankers in the vascular 

tissue of grapevines results in a slow decline and dieback that 

reduces vigour, yield and vineyard productivity (1). Symptoms 

may include stunted shoots with shortened internodes, and a 

characteristic wedge shaped lesion in the trunks and canes of 

infected vines. In addition to E. lata, a number of other species 

belonging to the Diatrypaceae can be found on grapevines and 

other hosts in and around vineyards. To date, the role of many of 

the diatrypaceous species in grapevine decline is unknown. The 

incidence and distribution of species in the Diatrypaceae was 

documented during a recent survey of vineyards throughout 

New South Wales (NSW). 


Surveys were conducted from 73 vineyards throughout NSW 

between November 2006 and April 2008 to study fungi 

associated with grapevine trunk diseases. Wood samples were 

taken from 1789 grapevines displaying foliar symptoms typical of 

Eutypa dieback or evidence of dead spurs, cankers, or bleached 

and discoloured tissue. Isolations of fungi were made by directly 

plating out pieces of diseased tissue onto PDA after surface 

sterilisation in 1% sodium hypochlorite. Samples were incubated 

at 25ºC and monitored for the appearance of fungi. 

Diatrypaceous species were tentatively identified based on gross 

cultural morphology. In December 2008, additional surveys and 

collections were conducted from grapevines and other hosts, 

both in the Hunter Valley and Tumbarumba. Isolations of 

diatrypaceous fungi from these samples were made directly 

from ascospores, with species tentatively identified based on 

morphology of the teleomorph and confirmed via sequencing 

and analysis of ribosomal DNA regions. 


Morphological and molecular analyses of fungi isolated from 

diseased wood and cultured from fruiting bodies revealed the 

presence of five species belonging to the Diatrypaceae. In 

addition to E. lata, Eutypa leptoplaca, Cryptovalsa ampelina and 

species of both Diatrypella and Eutypella were isolated. In total, 

79 isolates were collected, 12 of E. lata, 23 of C. ampelina, 1 

isolate of E. leptoplaca, 19 of Eutypella and 24 of Diatrypella 

(Table 1), although isolates from the latter genera could not be 

identified to species. 

These surveys have shown that Eutypa dieback is more 

widespread than first thought and may be increasing in 

prominence, especially in cooler climates where lower 

temperatures and high rainfall favour the growth of E. lata (2). 

Additionally, several other species within the Diatrypaceae are 

present not only on grapevines, but on a number of other hosts 

in and around vineyards. Many of these species are widely 

distributed in NSW and have been shown to have wider 

geographic ranges and occur in greater numbers than E. lata. 

species that are commonly found both on grapevines and other 

hosts. Additional studies are required to determine the 

pathogenicity of the diatrypaceous species on grapevines. The 

impact of these species and their role in grapevine decline is 

under investigation. 

Table 1. Incidence and distribution of Diatrypaceous fungi associated 

with grapevines and other hosts in New South Wales. 

Region Host Fungi 

Big Rivers Vitis vinifera Diatrypella 

Eutypa lata 

Cryptovalsa ampelina 

Central Ranges Vitis vinifera Eutypella 

Diatrypella 

E. lata 

C. ampelina 

Southern NSW Vitis vinifera Eutypella 

Diatrypella 

E. lata 

C. ampelina 

Populus nigra‐italica Eutypa leptoplaca 

Ulmus procera 

C. ampelina 

Northern Rivers Vitis vinifera C. ampelina 

Northern Slopes Vitis vinifera Eutypella 

Diatrypella 

Hunter Valley Vitis vinifera Eutypella 

C. ampelina 

Citrus paradise 

Eutypella 

Diatrypella 

Citrus sinensis 

Eutypella 

Ficus carica 

Eutypella 

Fraxinus excelsior Diatrypella 


This work was supported by the Winegrowing Futures Program, 

a joint initiative of the Grape and Wine Research and 

Development Corporation and the National Wine and Grape 

Industry Centre. The authors wish to thank Florent Trouillas (UC 

Davis) and Mark Sosnowski (SARDI) for technical assistance. 

REFERENCES 

1. Sosnowski MR, Creaser ML, Wicks TJ, Lardner R, Scott E (2008) 

Protection of grapevines pruning wounds from infection by Eutypa 

lata. Australian Journal of Grape and Wine Research 14, 134–142. 

2. Pitt WM, Huang R, Savocchia S, Steel CC (2008) Increasing evidence 

that Eutypa dieback of grapevines is widespread in New South 

Wales. 6th International Workshop on Grapevine Trunk Diseases, 

Florence, Italy, 1–3 September. 

3. Mostert L, Halleen F, Creaser ML, Crous PW (2004) Cryptovalsa 

ampelina, a forgotten shoot and cane pathogen of grapevines. 

Australasian Plant Pathology 33, 295–299. 

While E. lata, and the lesser‐known C. ampelina are recognised 

pathogens of grapevines (3), little is known about the other 


Posters 

13 Biological control of Uncinula necator by mycophagous mites 

N. Panjehkeh A , S. Ramroodi{ XE "Ramroodi, S." } A and A.R. Arjmandinezhad B 

A University of Zabol,, Zabol, Sistan and Baluchestan, Iran 

B Agricultural and Natural Resources Research Centre of Sistan 

INTRODUCTION 

A number of abiotic and biotic factors influence the incidence, 

severity, and spatial scale of diseases in natural and managed 

plant systems (2, 3). Although the function of such factors as 

temperature, humidity, and host plant resistance traits have 

been relatively well‐studied, the impact of natural enemies on 

interactions between plants and pathogens has received less 

attention. Plant pathologists have investigated various 

microorganisms as potential biological control agents of 

microbial plant pathogens (1, 8). The ability of arthropods to 

regulate plant pathogens is poorly understood. Leaf‐inhabiting 

mites that are thought to feed on fungi (mycophagous mites) 

and other microbes are extremely common on many woody 

perennial plant species (9, 10) and represent a potentially 

significant group of natural enemies of fungal plant pathogens 

that attack leaves and fruit. Erysiphe necator, the causal agent of 

grape powdery mildew, is a worldwide pathogen (6). The disease 

imposes considerable damages to grapes by reduction of the 

quality and quantity of the product in Sistan region. The 

powdery mildew agent has a great capacity to develop 

resistance to synthetic fungicides (4). Therefore, it seems that 

biological control is the best control approach of the disease. 

The objective of the project was to identify mycophagous mites 

that inhabit grape leaves infected and uninfected by Erysiphe 

necator. 


Plenty of mites were collected from grape leaves infected and 

uninfected by Erysiphe necator. A faunistic survey was 

conducted in August 2007 to collect and identify mites living on 

the grapevine cultivar Yaghoti in Sistan region, Iran. Six species 

belonging to six families were collected and identified from 

infected leaves (Table 1). Two species were collected and 

identified from uninfected leaves (Table 1). 

population dynamics (8). English‐Loeb et al. (5) have suggested 

that Orthotydeus lambi (Acari: Tydeidae) could be useful as a 

biological control agent of powdery mildew on cultivated grapes 

under vineyard conditions. Erysiphe necator is obligately 

parasitic, and with the exception of absorptive haustoria within 

epidermal cells of the host, the body of the pathogen resides on 

the plant surface (6). This characteristic makes it vulnerable to 

grazing by mycophagous mites. 

REFERENCES 

1. Baker KF, Cook RJ 1974 Biological control of plant pathogens. 

Freeman, San Francisco. 

2. Burdon JJ 1987 Diseases and plant population biology. Cambridge 

University Press, New York. 

3. Burdon JJ 1993 The structure of pathogen populations in natural 

plant communities. Annual Review of Phytopathology 31, 305–324. 

4. Erickson EO, Wilcox WF 1997 Distributions of sensitivities to three 

sterol demethylation inhibitor fungicides among populations of 

Uncinula necator sensitive and resistant to triadimefon. 


5. English‐Loeb G, Norton AP, Gadoury DM, Seem RC, Wilcox WF 1999 

Control of powdery mildew in wild and cultivated grapes by tydeid 

mite. Biological Control 14, 97–103. 

6. Pearson RC, Gadoury DM 1991 Powdery mildew of grape. In `Plant 

diseases of international importance: diseases of fruit crops`. (Eds J 

Kumar, HS Chaube, US Singh, AN Mukhopadhyay) pp. 129–146. 

(Prentice Hall, Englewood Cliffs, NJ.) 

7. Shaw PJA. 1992 Fungi, fungivores, and fungal food webs. In `The 

Fungal Community: its organisation and role in the ecosystem`. 

(Eds GC Carroll, DT Wicklow). pp. 295–310.(Dekker, New York). 

8. Sutton JC, Peng G 1993 Manipulation and vectoring of biocontrol 

organisms to manage foliage and fruit diseases in cropping 

systems. Annual Review of Phytopathology 31, 473–494. 

9. Walter DE 1996 Living on leaves: mites, tomenta, and leaf domatia. 

Annual Review of Entomology 41, 101–114. 

10. Walter DE, O’Dowd DJ 1995 Life on the forest phylloplane: hairs, 

little houses, and myriad mites. In `The forest canopy: aspects of 

research on this biological frontier`. (Eds ME Lowman, N Nadkarni) 

pp 325–352. (Academic Press, New York). 

Presence on leaves 

Mite species Mite diet Infected Uninfected 

Lasioseius mcgregori 

(Ascidae) 

Typhlodromus sp. 

(Phytoseiidae) 

Tyrophagus 

putrescenteae Schrank 

(Acaridae) 

Rhizoglyphus robini 

(Acaridae) 

Anystis baccarum 

(Anystidae) 

Tydeus sp. (Tydeidae) 

Predatory/ 

mycophagous 

Predatory/ 

mycophagous 

+ 

+ + 

Mycophagous + + 

Mycophagous + 

Predatory/ 

mycophagous 

Predatory/ 

mycophagous 

+ 

+ 

DISCUSSION 

The experiment revealed that the population of mycophagous 

mites in grape leaves infected with E. necator was significantly 

higher than uninfected leaves. It is well recognised that some 

arthropods including mites use fungi as a food resource, 

although it is less understood how this influences fungal 


35 First report of a eucalypt yellowing disease in Syria and its similarity to 

Mundulla yellows 

Posters 

D. Hanold A , B. Kawas B and J.W. Randles{ XE "Randles, J.W." } A 

A University of Adelaide, Waite Campus, Glen Osmond, 5064, South Australia 

B ICARDA, PO Box 5466, Aleppo, Syria 

INTRODUCTION 

Eucalyptus camaldulensis is widely grown in Syria for land 

rehabilitation, amenity, and as roadside trees. Seed was 

imported repeatedly on a large scale from different locations in 

Australia up to the 1970s (I. Nahal, L. Makki pers comm). This has 

resulted in a national population of E. camaldulensis including 

both subspecies camaldulensis and obtusa, as well as local 

hybrids of the two. Around 500 000 eucalypt seedlings are being 

produced annually from Syrian seed by 11 government nurseries 

for distribution around the different regions. 

Syria has developed a large, isolated population of E. 

camaldulensis over the last century. Little insect or fungal 

damage has been observed suggesting that many pathogens 

affecting the species in Australia are absent. Nevertheless MYlike 

symptoms virtually identical to the syndrome in Australia are 

present. Further epidemiological and phenotypic, as well as 

molecular comparison of Syrian and Australian symptomatic E. 

camaldulensis is needed and may provide information on 

aetiology and possibly origin of the disease. 

During a visit to ICARDA by D. Hanold in October 2008, yellowing 

symptoms similar to the Mundulla Yellows (MY) syndrome (1) 

were noted. The MY‐like symptoms appeared to be widespread 

in some locations, and preliminary surveys of several sites were 

carried out to obtain further information about its distribution. 

While a witches' broom disease without associated yellowing 

symptoms had been described earlier from Syrian eucalypts (2), 

this is the first report of a eucalypt yellowing disease from that 

country. 


Based on the description of MY distribution in Australia (1), trees 

not adjacent to roads as well as roadside trees were 

characterised. Survey sites in the regions around Aleppo, Tel 

Hadya, Ein Dara, Idleb, Tabaqah, along the road to the coast 

west of Homs, and along the Damascus‐Aleppo highway were 

mapped (Fig. 1). 

Photographs were taken of trees at each site and additional 

information recorded as available. Individual trees on the 

ICARDA station (Tel Hadya) were also numbered for future 

reference and leaf samples were taken to Adelaide and stored 

frozen for molecular analysis. Symptomatic seedlings identified 

in a nursery were planted at ICARDA together with 

asymptomatic controls to observe disease progress. 

RESULTS 

Eucalypts with symptoms resembling the descriptors of MY 

(Table 1) and including interveinal chlorosis, epicormic shoots 

and asymmetric yellowing of the crown were observed in all 

areas except west of Homs where only asymptomatic eucalypts 

were observed. E. camaldulensis both in single and mixed 

species plantings on roadsides, in paddocks, soil rehabilitation 

areas, seed gardens and nurseries were affected. Symptoms 

occurred on single trees adjacent to asymptomatic ones, in 

clusters, and as disease gradients similar to the distribution of 

MY in Australia (1). 

DISCUSSION 

MY is defined by characteristic descriptors distinguishing it from 

yellowing disorders due to environmental factors. Its cause is 

unknown, but a biotic, contagious agent has been implicated (1). 

Yellowing diseases of eucalypts closely resembling the Australian 

MY have also been reported from Spain and South America (1). 

This is the first report of a similar syndrome from Syria and the 

Middle East. 

Figure 1. Map of Syria. 

Table 1. Comparison of the Syrian eucalypt yellowing disease (SEY) with 

descriptors of MY (1). 

Descriptors SEY MY 

Leaf symptoms: 

interveinal chlorosis 

distortion of leaf margins 

necrotic pin spots 

no dead leaves on twigs 

Epicormic shoots + + 

Twig dieback + + 

Disease stages: 

early (yellow patches in foliage) 

medium (yellow epicormic shoots) 

late (overall tree dieback) 

Affected trees next to healthy ones 

Trees of all ages affected 

No recovery observed 

Not cured by pruning 

Symptoms in paddocks and roadsides 


We gratefully acknowledge the support of I. Nahal and B. Bayaa, 

Aleppo University; L. Makki, Syrian Department of Agriculture; A. 

El‐Ahmed, R. Brettell, S. Kumari and the staff and management 

of ICARDA. 

REFERENCES 

1. Hanold D, Gowanlock D, Stukely MJC, Habili N, Randles JW (2006) 

Mundulla Yellows disease of eucalypts: descriptors and preliminary 

studies on distribution and etiology. Australasian Plant Pathology 

35, 199–215. 

2. Bos LM, Makkouk KM, Bayaa B (1990) Witches' broom and decline 

of Eucalyptus, a serious disease in Syria, likely caused by 

mycoplasma. Arab Journal of Plant Protection 8, 135–133. 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 

+ 


Posters 

36 New host records for ‘Candidatus Phytoplasma aurantifolia’ in Australia 

J.D. Ray{ XE "Ray, J.D." } 

Australian Quarantine and Inspection Service, Marrara, NT, 0812 

INTRODUCTION 

Phytoplasmas are unculturable wall‐less prokaryotes within the 

class Mollicutes that infect plant phloem vessels and are 

transmitted by phloem feeding insects (2). They are implicated in 

diseases of a wide range of plant species. Symptoms of 

phytoplasma infection include reduced leaf size ‘little leaf’, 

yellowing of leaves, proliferation of stems leaves and flowers 

(witches’ broom) and floral abnormalities (1, 3). 

Plant health surveys were carried out by the Australian 

Quarantine and Inspection Service (AQIS) in northern Western 

Australia (northern WA) and the Northern Territory (NT) from 

2006 to 2008. This paper reports on the new host records of 

phytoplasma collected during these surveys. 


Plants exhibiting symptoms of phytoplasma infection (little leaf 

or witches’ broom) during plant health surveys in northern WA 

and the NT from 2006 to 2008 were collected for diagnostic 

confirmation. Plant parts with symptomatic new growth were 

collected into plastic bags and kept cool. Within 2 days of 

collection leaf petioles and midribs were excised from the 

symptomatic material, dehydrated over anhydrous CaCl 2 and 

stored at 4°C where possible. 

Samples were forwarded to Bioscience North Australia, Charles 

Darwin University for molecular analysis. Sample analysis 

included polymerase chain reaction (PCR) assays using universal 

phytoplasma specific primers. Strain analysis was performed by 

restriction fragment length polymorphism (JR153, KN11) or by 

sequencing (JR428, JR429). 


‘Candidatus Phytoplasma aurantifolia’ is reported for the first 

time associated with disease of Ipomea aquatica, Jatropha 

gossypifolia, Ocimum basilicum and Canavalia rosea (Table 1). 

These new records were all detected in WA whilst no new 

records were detected in the NT during this time. These 

phytoplasma records represent a diverse host range. 

Table 1. Details of new host records for ‘Ca. .P. aurantifolia’ in Australia. 

Species, Common name Location Strain Coll. No. 

Ipomea aquatica, 

Kangkung 

Jatropha gossypifolia, 

Bellyache bush 

Ocimum basilicum, 

Lemon basil 

Canavalia rosea, 

Beach bean 

Broome, WA TBB JR153 

Cable Beach, WA SPLL‐V4 JR428 

Wattle Downs, WA TBB JR429 

Lombadina Beach, 

WA 

SPLL‐V4 

KN11 


Thanks to Karen Gibb, Anna Padovan and Claire Streten of 

Bioscience North Australia, Charles Darwin University for 

diagnostics. Andrew Mitchell and Kirsty Neaylon (AQIS) are 

gratefully acknowledged for some collections, and A. Mitchell for 

identifying plant specimens. 

REFERENCES 

1. Davis RI, Jacobson SC, De La Rue SJ, Tran‐Nguyen L, Gunua TG, 

Rahamma S (2003) Phytoplasma disease surveys in the extreme 

north of Queensland, Australia, and the island of New Guinea. 

Australasian Plant Pathology. 32; 269–277. 

2. IRPCM Phytoplasma/ Spiroplasma Working Team—Phytoplasma 

taxonomy group (2004) ‘Candidatus Phytoplasma’, a taxon for the 

wall‐less, non‐helical prokaryotes that colonize plant phloem and 

insects. International Journal of Systematic and Evolutionary 

Microbiology. 54: 1243‐ 1255. 

3. Schneider B, Padovan A, De La Rue S, Eichner R, Davis R, Bernuetz 

A, Gibb K (1999) Detection and differentiation of phytoplasmas in 

Australia: an update. Australian Journal of Agricultural Research. 

50; 33–42. 

‘Ca. .P. aurantifolia’ has a wide host range across a diverse group 

of plant families and is widespread throughout Australia. The 

suggested Australasian/Asian origin of this phytoplasma may in 

part explain its success in harsh environments and wide host 

range (1, 3). 

All new records were obtained in northern WA which has a 

particularly harsh climate. During surveillance it was observed 

that some species of annual plants infected with phytoplasma do 

not produce seed and remain green for longer than the same uninfected 

hosts (Ray, personal observation). Perhaps the 

occurrence of a diverse host range for ‘Ca. .P. aurantifolia’ is a 

survival mechanism for both the phytoplasma and the leaf 

hopper vectors by providing live host material during periods 

when other hosts have died, the creation of a green bridge. 


37 A comparative study of methods for screening chickpea and wheat for resistance 

to root‐lesion nematode Pratylenchus thornei 

Posters 

R.A. Reen{ XE "Reen, R.A." }, J.P. Thompson 

DEEDI, Qld Primary Industries and Fisheries, Leslie Research Centre, GPO Box 2282, Toowoomba, 4350, Queensland 

© State of Queensland, Department of Employment, Economic Development and Innovation, 2009 

INTRODUCTION 

Several quantitative methods are available for testing resistance 

of crops to root‐lesion nematode (Pratylenchus thornei) under 

controlled environments. This study aimed to compare growth 

times for wheat and chickpea cultivars and the nematode 

extraction procedure of Whitehead tray, (Whitehead and 

Hemming 1965) with shake‐elution (Moore et al 1992) and 

misting (Hooper 1986) methods. The objective was to optimise 

differences between susceptible and resistant chickpea lines for 

plant breeding purposes. 

P. thornei / kg soil 

25000 

(a) 

20000 

15000 

10000 

5000 

0 

10 12 14 16 18 20 22 

W 7 days 

W 4 days 

M 7 days 

M 4 days 

MATERIAL AND METHODS 

Five chickpea and two wheat lines covering a range of resistance 

to P. thornei were selected for testing. The design consisted of 3 

replicates in randomised blocks with 6 harvest times and 3 

extraction methods. For each time x variety x replicate 

combination there were 2 pots to enable nematode comparison 

from one half of each pot using standard Whitehead tray 

method, while roots were extracted from the other half for 

either shake‐elution or misting. Single plants were grown in pots 

of 330 g of steam–sterilised vertosol maintained between 22– 

25°C in a glasshouse on a 2 cm tension bottom–watering system. 

A 15 ml suspension to provide 10,000 P. thornei/kg soil was 

pipetted around the seed at planting. At each harvest of 12, 14, 

16, 18 and 20 weeks, soil with roots from pots was sectioned 

longitudinally into halves for nematode extractions. For all 3 

extraction procedures room temperatures were in the range of 

22–26°C and nematodes were collected on a 20 µm sieve. 

Whitehead and shake‐elution extractions were assessed at 1, 2, 

3, 4 and 7 days while misting extractions were assessed at 4 and 

7 days. Nematodes were counted in a 1‐mL Hawksley slide and 

expressed as number of P. thornei/kg soil (oven‐dry equivalent) 

or P. thornei/g root (fresh weight). A multi–factorial data analysis 

was performed using ln(x+c) where x = nematodes/kg soil and c 

= constant. 

RESULTS AND DISCUSSION. 

The Whitehead tray method extracted significantly (P < 0.001) 

more P. thornei than either misting or shake‐elution (Fig. 1 a and 

b). Growing chickpeas for a longer period (18–20 weeks) than 

wheat (16–18 weeks) gave maximum discrimination of 

resistance/susceptibility in cultivars (Fig. 2). The extraction 

efficiency for 2 days was 70% of that at 7 days when using 

Whitehead trays. All the above results showed similar 

differences between treatments whether expressed as P. 

thornei/kg soil or as P. thornei/g root. The Whitehead trays were 

found to be less labour intensive than misting and shake‐elution 

procedures, and more practical for assessing large numbers of 

plants for resistance. 


18000 

15000 

12000 

9000 

6000 

3000 

(b) 

0 

10 12 14 16 18 20 22 

Plant growth weeks 

W 2 days 

W 4 days 

W 7 days 

S-e 2 days 

S-e 4 days 

S-e 7 days 

Figure 1. For each harvest the total number of P. thornei extracted from 

wheat and chickpea with Whitehead trays (W) was significantly higher (P 

< 0.001) than misting (M; Fig. 1a) and shake‐elution (S‐e; Fig. 1b). 


13 

12 

11 

10 

9 

8 

7 

6 

10 12 14 16 18 20 22 

Plant growth weeks 

Batavia (W) 

Sona (CP) 

Desavic (CP) 

QT8343 (W) 

Norwin (CP) 

Amethyst (CP) 

ILWC 246 (WC) 

Figure 2. Longer growth periods allowed better discrimination among 

chickpea cultivars. Value of l.s.d. at 18 weeks and 20 weeks (P = 0.05) = 

0.82 and 1.32 respectively. W=wheat, CP=chickpea, WC=wild chickpea. 


Kerry Bell for statistical analysis and Indooroopilly Research 

laboratories for use of their misting facilities. 

REFERENCES 

Whitehead AG, Hemming JR (1965) A comparison of some quantitative 

methods of extracting small vermiform nematodes from soil. 

Annals of Applied Biology 55,25–38. 

Hooper DJ, (1986) Extraction of nematodes from plant m aterial. In 

‘Laboratory methods for work with Plant and Soil Nematodes’. (Ed 

JF Southey) pp. 51–81. (Her Majesty’s Stationary Office:London) 

Moore KJ, Southwell RJ, Schwinghamer MW, Murison RD (1992) A rapid 

shake‐elution procedure for quantifiying root lesion nematodes 

(Pratylenchus thornei) in chickpea and wheat. Australasian Plant 



Posters 

82 Multi‐locus sequence typing of isolates of Pseudomonas syringae pv. actinidiae, a 

biosecurity risk pathogen 

J. Rees‐George{ XE "Rees‐George, J." }, I.P.S. Pushparajah and K.R. Everett 

The New Zealand Institute for Plant and Food Research Limited, PB 92169, Mt Albert, Auckland, New Zealand 

INTRODUCTION 

Pseudomonas syringae pv. actinidiae (P.s.a.) is a bacterium that 

was first recorded in Japan (1), caus‐ing a trunk canker on 

kiwifruit (Actinidia deliciosa ‘Hayward’). This disease has not 

been recorded on kiwifruit in New Zealand. PCR primers were 

designed to detect this pathogen to prevent importation into 

New Zealand on germplasm. To prove specificity of these 

primers isolates from different geographic locations were tested. 


Cultures. Cultures for DNA extraction were sourced from the 

International Collection of Micro‐organisms from Plants (ICMP), 

New Zealand; Korean Agricul‐tural Culture Collection (KACC), 

Republic of Korea; National Institute of Agrobiological Sciences 

(NIAS), Japan,; National Collection of Plant Patho‐genic Bacteria 

(NCPPB), UK; and the Culture Collection of Plant Pathogenic 

Bacteria (PD), The Netherlands. 

PCR detection. Primers were designed and tested against 20 

strains of P.s.a. from international culture collections. Six strains 

were not detected by these primers (Table 1), and multi‐locus 

sequence typing (MLST) was conducted to study these strains in 

more detail. Sequence was included of three bacteria found on 

kiwifruit orchards (2), Pseudomonas sp., P. fluorescens (P.f.) and 

P. syringae (P.s.) and four representatives from Group 1 (3), P.s. 

maculicola, P.s. tomato, P.s. theae, and P.s.a. P. s. is in Group 2, 

and P. f. is an outgroup. 

Multi‐locus sequence typing. Five housekeeping genes were 

sequenced: those encoding sigma factor 70, aconitate hydratase 

B, citrate synthase, phosph‐orglucoisomerase, and gyrase. The 

16S–23S rDNA intergenic spacer (IGS) region was also 

sequenced. 

Phylogenetic analysis. Analyses were performed on individual 

gene sequences as well as on the concatenated data set using 

maximum parsimony. 

RESULTS 

By BLAST analysis, the sequence of the IGS region of KAAC 10660 

was most similar to Rahnella aquatilis, an unrelated saprotroph. 

Isolates KAAC 10582, ISPAVE‐B‐020, ISPAVE‐B‐019, PD2766 and 

PD2774 were most similar to P. syringae, and the type strain Kw‐ 

11 to P.s.a. DNA from KAAC 10660 was not amplified by any 

MLST primers. All MLST gene phylogenies yielded similar results: 

PD2766 was most similar to P. f., KAAC 10582 to Pseudomonas 

sp., ISPAVE‐B‐020, ISPAVE‐B‐019 and PD2774 to P.s. syringae. 

None of the isolates not detected by PCR primers F1/R2 and 

F3/R4 was closely associated with the type strain Kw‐11, or other 

Group 1 pathovars. 

Table 1. Isolates of Pseudomonas syringae pv. actinidiae detected by 

primer sets F1/R2 and F3/R4 

Isolate name Collection Origin Detected 

Kw‐11 ICMP Japan + 

Kw‐1 Japan + 



KAAC 10582 KAAC Korea ‐ 

KAAC 10584 Korea + 


KAAC 10659 Japan + 

KAAC 10660 Korea ‐ 


FTRS L1 NIAS Japan + 

Sar1 Japan + 

Sar2 Japan + 

Kiw4 Japan + 

Wa1 Japan + 

Wa2 Japan + 

ISPAVE‐B‐020 NCPPB Italy ‐ 

ISPAVE‐B‐019 Italy ‐ 

PD 2766 PD USA ‐ 

PD 2774 USA ‐ 


This work was funded by FfRST contract CO2X0501. DNA was 

provided by L. Liefting, and advice by R. Newcomb. 

REFERENCES 

1. Takikawa Y, Serizawa S, Ichikawa T, Tsuyumu S, and Goto M (1989). 

Pseudomonas syringae pv. actinidiae pv. nov.: the causal bacterium 

of canker of kiwifruit in Japan. Ann. Phytopath. Soc. Japan 55, 437– 

444. 

2. Everett KR and Henshall WR (1994). Population ecology and 

epidemiology of kiwifruit blossom blight. Plant Pathology 43, 

824–830. 

3. Sarkar SF and Guttman DS (2004) Evolution of the core 

genome of Pseudomonas syringae, a highly clonal, endemic 

plant pathogen. App. Env. Microbiology 70, 1999–2012. 

DISCUSSION 

These results indicate that isolate KAAC 10660 is an unrelated 

saprotroph that has been misidentified. Because the other five 

sequenced atypical isolates were not genetically related to 

Group 1 pathovars of P. syringae, these are also 

misidentifications. 


95 DNA barcoding to support biosecurity decisions 

K. Pan, G.F. Bills, M.K. Romberg{ XE "Romberg, M.K." }, W.H. Ho, and B.J.R. Alexander 

Plant Health and Environment Laboratory, MAF Biosecurity New Zealand, PO Box 2095, Auckland 1140, New Zealand 

Posters 

INTRODUCTION 

Precise pathogen identifications in the biosecurity context must 

be accurate and timely, as identification delays can affect trade, 

as well as response efforts to invasive exotic species. The need 

to rapidly identify cryptic fungi by traditional morphological 

techniques presents a distinct challenge to plant diagnostic 

laboratories. The use of DNA barcoding techniques to identify 

morphologically cryptic species addresses this challenge and has 

gained momentum recently, with the establishment of the 

International Consortium for the Barcode of Life. 

The MAFBNZ Plant Health and Environment Laboratory (PHEL) is 

currently developing a DNA barcoding platform to resolve 

diagnostic cases for which other methods are unable to provide 

timely and accurate results. An example of the usefulness of this 

tool is presented here. 

However, the barcoding approach could challenge or conflict 

with phytosanitary regulation. For instance some isolates were 

found consistently mis‐identified at species and higher 

taxonomic levels, and these organisms could be new to the 

country. 

DNA barcoding will likely be an international standard for plant 

pathogen identification, with the caveat that this powerful tool 

relies upon sequences generated from well‐characterised 

voucher specimens (preferably including the type species) in 

order for DNA barcode results to be well supported. 

The genus Diaporthe includes plant pathogens, plant endophytes 

and species associated with dying and dead vegetation that are 

usually observed as their Phomopsis anamorphs. These fungi are 

associated with disease symptoms on a wide range of species, 

including many economically important plants. Our objective 

was to develop capability to utilise barcoding to precisely and 

quickly identify fungal species, in order to assist in the 

determination of the regulatory status of intercepted organisms, 

and to allow more informed biosecurity decisions. 

METHODS 

Isolates from surveillance of fungi on plants in New Zealand and 

all strains deposited as either Diaporthe or Phomopsis from the 

International Collection of Microorganisms (ICMP) were 

included. A portion of the mycelia for all samples was stored in 

20% glycerol at minus 80°C and DNA for sequencing was 

extracted from the remaining mycelia. Sequences of the ITS 

region were generated using primer pair ITS1/ITS4 (1). The ITS 

sequences of authoritatively identified Diaporthe and Phomopsis 

strains were selected from recent revisionary studies. Sequences 

were stored and analysed with the software program Geneious 

(Biomatters Ltd, Auckland, New Zealand) 

RESULTS 

To date, the Diaporthe/Phomopsis barcode database consists of 

22 sequences from PHEL, 68 New Zealand strains from ICMP 

culture collection, and 92 from reference strains (Fig. 1). 

Continued survey work and addition of strains from other 

collections will expand and contribute new branches to the tree. 

The barcode database has proven to be a powerful tool to 

rapidly and accurately identify unknown strains. For instance, 

strains from surveillance (PHEL09‐2009‐2132) and the culture 

collection (ICMP2141) were identified to species level (Fig. 1), 

providing an initial identification in the first case, and 

clarification in the second. 

Isolates without a species name in this project (e.g. Groups A‐E) 

will be confirmed by further taxonomic work. 

Figure 1. Phylogenetic tree of Diaporthe and Phomopsis derived from 

Neighbour‐joining analysis. Expanded data set of P. viticola clade is 

presented in more detail. 

REFERENCE 

1. White, T.J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and 

direct sequencing of fungal ribosomal RNA genes for phylogenetics. 

In: PCR Protocols: A Guide to Methods and Applications. 

DISCUSSION 

Development of a DNA barcoding platform can lead to resolution 

of many questions, including rapid determination if certain 

species, including undescribed taxa, are present in a country. 


Posters 

14 In vitro screening of potential antagonists of Xanthomonas translucens infecting 

pistachio 

A. Salowi{ XE "Salowi, A." }, D. Giblot Ducray and E.S. Scott 

School of Agriculture, Food and Wine, University of Adelaide, PMB1, Glen Osmond, 5064, South Australia 

INTRODUCTION 

X. translucens is the causal agent of dieback disease of pistachio. 

The bacterium infects the vascular tissues of the trees, causing 

discolouration of the xylem, lesions on the trunk and major 

limbs, decline and, in some cases, death (1). Although hygiene 

and application of quaternary ammonium disinfectant to pruning 

wounds have been recommended to limit the spread of the 

disease (2), effective control methods are lacking. Biological 

control offers potential in managing this disease. The aim of this 

research is to assess the ability of bacteria to antagonise X. 

translucens in vitro, and thus explore the potential of biological 

control in managing pistachio dieback. 


Pathogen. Isolate KI of X. translucens (Xtp_KI), obtained from a 

commercial orchard in Kyalite, NSW was used (3). The isolate 

was resuscitated from storage in sucrose peptone broth (SPB) 

and glycerol at ‐80°C. 

Potential antagonists. Eight isolates of bacteria obtained from 

pistachio wood were tested, along with one isolate of Bacillus 

subtilis. Seven of the pistachio isolates were courtesy of E. Facelli 

and C. Taylor. 

Although most of the bacterial isolates inhibited Xtp_KI in dual 

culture, there was no evidence of antibiotic activity in culture 

filtrates. B. subtilis was expected to produce diffusible 

antibiotics, but most reports concern antifungal activity. 

Methods for assessing production of diffusible antibiotics are 

being refined. Selected isolates are being tested for ability to 

colonise pistachio wood and to reduce colonisation of the wood 

by Xtp_KI. 

REFERENCES 

1. Facelli E, Taylor C, Scott E, Emmett B, Fegan M, Sedgley M (2002) 

Bacterial dieback of pistachio in Australia. Australasian Plant 


2. Sedgley M, Scott E, Facelli E, Anderson N, Emmett B, Taylor C 

(2006) Pistachio canker epidemiology. Final Report to Horticulture 

Australia Ltd (Project PS04015). 

3. Facelli E, Taylor C, Scott E, Fegan M, Huys G, Noble R D, Swings J, 

Sedgley M (2005) Identification of the causal agent of pistachio 

dieback in Australia. European Journal of Plant Pathology 112, 155– 

165. 

4. Parente E, Brienza C, Moles M, Ricciardi A (1994) A comparison of 

methods for the measurement of bacteriocin activity. Journal of 

Microbiological Methods 22, 95–108. 

5. Mari M, Guizzardi M, Pratella G C (1996) Biological control of gray 

mold in pears by antagonistic bacteria. Biological Control 7, 30–37. 

Preliminary screening. A protocol to assess the antagonistic 

ability of the above bacteria was modified from Parente et al. 

(4). One hundred µl of a suspension of 10 6 CFU/ml of Xtp_KI was 

spread on either sucrose peptone agar (SPA) or nutrient agar 

(NA). After drying, a 6‐mm diameter well was punched into the 

agar, aseptically, and filled with 20 µl of 3 day‐old culture of the 

chosen antagonist. At this stage, the concentration of the 

antagonist suspension was not determined. Each antagonist 

treatment was replicated five times and sterile distilled water 

was used for controls. Antagonism was assessed by measuring 

the inhibition zone around the wells 48 hours after treatment. 

Antibiotic activity of the antagonists. Production of diffusible 

antibiotics inhibitory to Xtp_KI was investigated using a 

procedure modified from Mari et al. (5). The bacterial isolates 

were cultured in SPB, at 28°C on a rotary shaker. After 48 hours, 

the suspensions were centrifuged at 10,000g for 20 minutes and 

the supernatants filtered through 0.45 µm membrane filters. 

Following the protocol described above, 20 µl of culture filtrate 

was placed into each well. Antibiotic activity was assessed by 

measuring inhibition zones around wells 48 hours after 

treatment. 


One isolate (64161‐7) efficiently inhibited the growth of Xtp_KI, 

both on SPA and NA, with clear inhibition zones of >10mm 

radius. Four isolates (SUPP, PC397, PC506 and PC507) caused 

moderate inhibition of growth of Xtp_KI on SPA and NA 

(inhibition zones

83 Uniform distribution of powdery mildew conidia using an improved spore settling 

tower 

Posters 

Z. Sapak{ XE "Sapak, Z." } 1 , V. Galea 1 , D. Joyce 1 and E. Minchinton 2 

1 School of Land, Crop and Food Sciences, The University of Queensland, Gatton, 4343, QLD 

2 Department of Primary Industries, Biosciences Research Division, Knoxfield Centre, Knoxfield Victoria 

INTRODUCTION 

Powdery mildew of cucurbits (Podosphaera fusca (Fr.) S. Blumer) 

is an obligate parasite, unable to be cultured and maintained on 

agar media. Thereby, it provides a challenge to researchers 

studying the infection processes in the laboratory. More 

problematic is that the pathogen is sensitive to free water. 

Water damages conidia by negatively affecting viability and 

infectivity (Sivapalan, 1993). Thus, conidia cannot be applied to 

plants using water suspensions. Use of dry conidia applied by 

dusting or blowing from infected leaves onto test plants is 

commonly used in artificially inoculating plants. This approach 

allows for deposition of conidia onto plant surfaces, but with 

little uniformity of distribution (Reifschneider and Boiteux, 

1988). Techniques such as the use of paint brushes and cotton 

swabs provide improved uniformity of conidial distribution, but 

are lacking in convenience and accuracy. A spore‐settling tower 

applying Stoke’s law of sedimentation as proposed by 

Reifschneider and Boiteux (1988) has provided a more 

convenient and repeatable method for inoculation of powdery 

mildews. These authors constructed a plywood tower and 

demonstrated successful use of a low vacuum induced air inrush 

to dislodge conidia from infected leaves, and to disperse them 

effectively over test plants. This design was improved by the 

authors to enhance useability for inoculation of powdery 

mildews onto test plants. 


The spore settling tower was constructed from a flanged 

Perspex cylinder (100 cm in height, 50 cm diameter, 20 mm 

thick). The complete tower comprised of the cylinder, a top 

cover, and a base plate. The top cover incorporates a vacuum 

line and air valve, a vacuum gauge, a small removable lid with a 

25mm inlet valve leading to an internal inoculum platform 

suspended below. The vacuum line and air valve is used to 

connect the tower to a vacuum pump, and the internal vacuum 

applied is measured by the attached gauge. The inlet valve in the 

removable lid is used to sharply break the vacuum inside the 

tower dislodging conidia from the inoculum source (freshly 

harvested infected leaves). The internal inoculum platform (12 

cm diameter) was constructed under the top cover with three 

holes, each with a 9.0 cm diameter in its side walls (20 cm deep) 

to allow inoculum to be expelled and shower the test plants 

placed on the base plate at the bottom of the tower. The whole 

construction was designed and fabricated to maintain an 

internal vacuum by the use of rubber gaskets and sealants. 

The distribution of conidia dispersed through the operation of 

the spore settling tower was examined using water agar (2%) 

trap plates. The base of the trap plates were marked with a 1.0 

cm grid using a marker pen. Three open trap plates were used as 

replicates per inoculation run, and arranged on the base plate of 

the spore settling tower. Powdery mildew (P. fusca) maintained 

on cucurbit plants in the glasshouse, was used as the inoculum 

source. Leaves were cut into disks 2.0 cm 2 in diameter. In each 

inoculation run, 20 leaf disks (~ 2.5 g f.w.) were placed in an 

open Petri plate and covered with a layer of tape‐fastened open 

plastic mesh (1 cm 2 pore size). The inoculum was placed on the 

inoculum platform, the water agar trap plates placed on the 

base plate and the unit sealed. A vacuum of 20 kPa (taking ~ 10 

sec) was applied followed by closing of the air valve. Sudden 

opening of the inlet valve in the removable lid resulted in a sharp 

break in the vacuum causing a sudden inrush air onto the 

inoculum source and dislodgment of conidia. The trap plates at 

the base of the unit plate were then exposed to the resulting 

shower of conidia. The unit was left undisturbed for a minimum 

of 120 seconds after breaking of vacuum to optimise conidial 

distribution (Reifschneider and Boiteux, 1988). After each 

inoculation run, the media in the water agar trap plates was cut 

into 1 cm squares and fifteen randomly selected sections placed 

on glass microscope slides, stained with lactophenol cotton blue 

and observed under a light microscope to evaluate the 

distribution of conidia by counting. The data were analysed using 

a statistical analysis system (SAS). 


The spore settling tower developed in this study is relatively 

easy to operate for inoculation of plants with powdery mildew 

pathogens. The transparent Perspex construction allows users to 

monitor the process inside the tower. Provision of a vacuum 

gauge allows for more consistent conditions to be achieved, 

resulting in higher repeatability among inoculation runs. The 

incorporation of an air inlet valve (not present in the unit 

designed by Reifschneider and Boiteux, 1988) allows for easy 

breaking of vacuum, while modifications to the inoculum 

platform further improved useability. 

The distribution of conidia observed in this study was uniform 

with no significant difference between the numbers observed 

within and between trap plates P

Posters 

84 The effect of high nutrient loads on disease severity due to Phytophthora 

cinnamomi in urban bushland 

Kelly Scarlett{ XE "Scarlett, K." }, Zoe‐Joy Newby, David Guest and Rosalie Daniel 

Faculty of Agriculture, Food and Natural Resources, University of Sydney, 2006 NSW 

INTRODUCTION 

The soilborne pathogen Phytophthora cinnamomi has become 

infamous for its destruction of native Australian vegetation 

communities, particularly in Western Australia and Victoria. 

More recently, the pathogen has been reported to occur widely 

around NSW. Phytophthora has been indicted with dieback of 

iconic species including Angophora costata, Eucalyptus 

botryoides, E. piperita and Corymbia gummifera around Sydney 

Harbour. However, bushland reserves in which these trees occur 

are also often subject to high nutrient loads from urban runoff. 

Environmental abiotic factors can play a major role in either 

enhancing or suppressing the disease severity on a susceptible 

host. Seedlings of E. maculata and E. pilularis grown with lower 

amounts of nitrogen and phosphorus express more severe 

disease symptoms (1). Conversely, disease severity increased 

with increasing levels of inorganic, but not organic, nitrogen 

application in durian and papaya inoculated with P. palmivora 

(2). 

This study investigates the relationship between soil nutrient 

loads and the severity of disease due to Phytophthora in four 

tree species found in bushland and parks around Sydney 

Harbour. 


Site selection. Four 20 x 20 m quadrats were set up in the Lawry 

Plunkett Reserve in Mosman, NSW. Sites were identified based 

on drainage runoff and the level of disturbance (invasive weeds) 

(Table 1). Ten soil samples were taken from each of the four 

sites for analysis. Samples were collected from the root zone of 

A. costata, E. botryoides, E. piperita and C. gummifera. 

Table 1. Sites in the Lawry Plunkett Reserve from which soil was sampled 

for analysis of nutrient levels, microbial activity and Phytophthora. 

Site 

Description 

1 Highly disturbed, Phytophthora isolated 

2 Highly disturbed, Phytophthora isolated 

3 Moderately disturbed, Phytophthora isolated 

4 Moderately disturbed, Phytophthora isolated 

Soil analysis. All 40 soil samples were analysed for the presence 

of Phytophthora by lupin baiting (3). The concentration of 

nitrogen (N), phosphorus (P) and other minerals were 

determined for three of the 10 samples taken from each site. 

Microbial activity was measured for all soil samples using the 

FDA assay (4). 

Glasshouse trials. The effect of N on the severity of disease due 

to P. cinnamomi is being assessed in a glasshouse trial. A. 

costata, E. piperita, E. botryoides, C. gummifera and Pinus 

radiata (susceptible control) seedlings were inoculated with P. 

cinnamomi are treated with 0 mg/ml and 100 mg/mL 

ammonium nitrate every two weeks. Plant health is being 

assessed over time, and root and shoot weight will be measured 

at the end of the experiment. 


The occurrence of Phytophthora. P. cinnamomi was isolated 

from all four sites sampled. A second species of Phytophthora 

was isolated from Sites 1 and 2 and is being identified. 

Nutrient analysis. The nutrient levels varied significantly within 

and between sites. Site 2 had higher levels of total soil N (due to 

higher levels of NH 4 + ) than the other three sites (Fig 1). A 

drainage channel may account for the high N load observed in 

soil sampled from Site 2. Soil P levels were not significantly 

different between sites. Magnesium levels were highest in soil 

samples from Site 4. Aluminium was present at extreme levels at 

Site 3. The effect of excess nitrogen on disease severity in the 

four tree species is currently being assessed in a glasshouse 

study. 

Concentration 

(mg/kg) 

100 

50 

0 

1 2 3 4 

Sit e 

N (mg/kg) 

P (mg/kg) 

Figure 1. Levels of soil nitrogen and phosphorus at the four sites in the 

Lawry Plunkett Reserve. 

Microbial activity. At 3.5 µg FDA g ‐1 min ‐1 , microbial activity was 

greatest in Site 4, although this was not statistically significant (p 

= 0.11). Site 3 had the lowest microbial activity at 2.2 µg FDA g ‐ 

1 min ‐1 (Figure 2). 

Microbial Activity 

(ug FDA/g soil/min) 

5 

4 

3 

2 

1 

0 

1 2 3 4 

Sit e 

Figure 2. Microbial activity at the four sites in the Lawry Plunkett Reserve 

as determined by the FDA assay. 

In urban areas, nutrients available in the soil can fluctuate due to 

run off. High amounts of run off resulting in soil nutrient loading 

may play a significant role in either the severity or suppression of 

dieback disease associated with P. cinnamomi. A greater 

understanding of the interaction between dieback and nutrient 

loads will enable effective management decisions for urban 

areas where nutrient loads are usually prominent and 

Phytophthora is present. 


We gratefully acknowledge the support of Mosman Council in 

the supply of seedlings and the soil analysis in this study. 

REFERENCES 

1. Halsall et al. (1983) Australian Journal of Botany 31 341–355 

2. Chee & Newhook (1965) New Zealand Journal of Agricultural 

Research 8, 88–95. 

3. Schnurer & Rosswall (1982) Applied Environmental Microbiology 

43, 1256–1261. 


15 Characterisation of the causal agent of pistachio dieback as a new pathovar of 

Xanthomonas translucens, x. Translucens pv. pistaciae pv. nov. 

Posters 

D. Giblot Ducray A , A. Marefat A# , N.M. Parkinson B , J.P. Bowman C , K. Ophel‐Keller D , E.S. Scott{ XE "Scott, E.S." } A 

A School of Agriculture Food and Wine, The University of Adelaide, Waite Campus, Glen Osmond, 5064 SA 

B Central Science Laboratory, Sand Hutton, York YO41 1LZ, UK 

C University of Tasmania, School of Agricultural Science, Hobart, 7001 TAS 

D South Australian Research and Development Institute, Adelaide, 5000 SA 

# Current address: Department of Plant Protection, Zanjan University, Zanjan, Iran 

INTRODUCTION 

Pistachio dieback has limited the expansion of the pistachio 

industry in Australia over the past 15 years. It is caused by two 

genetically distinct groups of strains of X. translucens (1, 2). 

However, the pistachio pathogen is atypical because it has a 

dicotyledonous woody host, in contrast to typical X. translucens 

that cause disease in monocotyledonous hosts in the Poaceae. 

Also, the characterisation of integrons, which are known to have 

played a key role in genetic diversification of Xanthomonas, 

suggested that the pistachio pathogen represented a new 

pathovar of the species (3). Here, we report use of DNA‐DNA 

hybridisation and gyrB gene sequencing to further clarify the 

taxonomic position of the pistachio pathogen and establish its 

phylogeny among other Xanthomonas. 


DNA‐DNA hybridisation. DNA/DNA hybridisation analyses were 

conducted to determine the DNA similarity of the reference 

strains of the two groups of the pistachio pathogen (ICMP 16316 

and ICMP 16317) (2) to the pathotype strains of three X. 

translucens pathovars, namely X. translucens pv. translucens 

(LMG 876), X. translucens pv. poae (LMG 728) and X. translucens 

pv. graminis (LMG 726). The type strains of X. theicola (LMG 

8764) and X. hyacinthi (LMG 739) were included as outgroups. 

Each hybridisation was conducted two‐four times. 

gyrB phylogeny. DNA extraction, PCR and sequence analysis of 

the gyrB gene were performed as described by Parkinson et al. 

(4). Sequences were determined for the reference strains ICMP 

16316 and ICMP 16317 of the pistachio pathogen, and compared 

to that of other Xanthomonas available in the database (4). 

RESULTS 

DNA‐DNA hybridisation. DNA‐DNA hybridisation between the 

two strains of the pistachio pathogen was 84%. When compared 

to X. translucens pathovars, one group had the highest 

homology with X. translucens pv. poae, with 84% hybridisation, 

whereas the other group had the highest homology with X. 

translucens pv. graminis, with 90% hybridisation. Hybridisation 

values of both pistachio strains with X. theicola and X. hyacinthi 

averaged no more than 54%. 

DISCUSSION 

DNA.‐DNA hybridisation is considered to provide definitive 

species‐level identification: strains from the same species have 

above 70% homology, whereas strains from different species 

show homology values averaging 40–50%. Therefore, our results 

confirmed the classification of the pistachio pathogen as an X. 

translucens. 

The clustering of the pistachio pathogen among X. translucens 

pathovars in the gyrB phylogeny further confirms the DNA‐DNA 

hybridisation results and suggests that the pistachio pathogen 

has originated through host switching of one of the 

Xanthomonas ancestors that had a monocotyledonous host. 

These results, together with the distinct pathogenicity to 

pistachio and the consistent discrimination of the pistachio 

pathogen from other X. translucens (2, 3), support its 

designation as a new pathovar of the species, for which we 

propose the name Xanthomonas translucens pv. pistaciae pv. 

nov. 

REFERENCES 

1. Facelli E, Taylor C, Scott E, Fegan M, Huys G, Emmett R, Noble D, 

Swings J, Sedgley M (2005) Identification of the causal agent of 

pistachio dieback in Australia. European Journal of Plant Pathology 

112, 155–165. 

2. Marefat A, Scott E, Ophel‐Keller K, Sedgley M (2006) Genetic, 

phenotypic and pathogenic diversity among Xanthomonads 

pathogenic on pistachio (Pistacia vera) in Australia. Plant Pathology 

55, 639–49. 

3. Giblot Ducray D, Gillings MR, Marefat A, Ophel‐Keller K, Scott ES 

(2007) Characterisation of integrons in Xanthomonas translucens 

infecting pistachio in Australia. Proceedings of the 16th 

Australasian Plant Pathology Society Conference, Adelaide. P 37. 

4. Parkinson NM, Cowie C, Heeney J, Stead D (2009) Phylogenetic 

structure of Xanthomonas determined by comparison of gyrB 

sequences. International Journal of Systematic and Evolutionary 

Microbiology 59, 264–274. 

gyrB phylogeny. In sequence alignments, the two groups of the 

pistachio pathogen showed 96% homology. When compared 

with other Xanthomonas, the highest similarity was to pathovars 

of X. translucens, with percentages ranging from 95 to 99%, 

whereas the similarity to other Xanthomonas species and their 

pathovars ranged from 81 to 86%. The two exceptions were X. 

theicola and X. hyacinthi, which showed similarity values of 92 

and 93%, respectively, both with strains of the two groups. In 

the phylogenetic tree, both groups clustered among X. 

translucens pathovars, but as distinct lineages. 


Posters 

38 Interactions between Leptosphaeria maculans and fungi associated with canola 

stubble 

B. Naseri A,C , J.A. Davidson B and E.S. Scott{ XE "Scott, E.S." } A 

A School of Agriculture, Food and Wine, The University of Adelaide, PMB1, Glen Osmond, South Australia, 5064 

B South Australian Research and Development Institute, GPO Box 397, Adelaide, South Australia, 5001 

C Department of Plant Protection, Agricultural Research Institute, PO Box 45195‐1474, Zanjan, Iran 

INTRODUCTION 

Blackleg, caused by Leptosphaeria maculans, is of major 

economic importance in the canola‐growing areas of Australia. 

The pathogen survives on stubble and releases ascospores from 

pseudothecia. 

Antagonistic activity of fungi against L. maculans has been 

documented (1, 2). Antagonism, competition, stimulation of 

growth and decomposition of the stubble may affect survival 

and sporulation of L. maculans. A better understanding of the 

interactions between L. maculans and potentially antagonistic 

fungi on canola stubble could facilitate the development of 

strategies to reduce inoculum of the pathogen and contribute to 

the control of blackleg. 


In total, 35 species of fungi, including L. maculans, were isolated 

from canola stubble or associated soil collected in South 

Australia. 

Dual culture on agar plates. L. maculans and potential 

antagonists were co‐inoculated in triplicate on potato dextrose 

agar (PDA) in Petri dishes and incubated at room temperature 

for up to 3 weeks. Changes in colony appearance, hyphal growth 

and sporulation of L. maculans were examined. 

Dual culture on agar‐coated slides. Three replicate water agarcoated 

slides were inoculated for each test species and 

incubated at room temperature for up to 2 weeks. Interactions 

between hyphae of L. maculans and each test fungus were 

examined microscopically at 4‐day intervals. 

Inoculation of blackleg‐affected stubble. Blackleg‐affected 

stubble, three segments on moist sand in each of four Petri 

dishes, was inoculated with each test species and incubated at 

15ºC in a 12 h photoperiod. After 6 weeks, the density of 

pseudothecia (number in a 0.5 × 1 cm area) was assessed for 

each stubble segment. Germination of ascospores collected from 

stubble inoculated with each test fungus was assessed. 

Effect of fungi on decay of canola stubble. Disease‐free stubble 

inoculated with Stachybotrys chartarum and Coprinus sp. was 

incubated at 20ºC in a 12 h photoperiod for 2 months and 

weight loss determined. 

Statistical analysis. Data were subjected to ANOVA. 

RESULTS 

Macroscopic and microscopic observations of plates and agarcoated 

slides, respectively, showed lysis, deformation, overgrowth 

of hyphae and inhibition of growth and sporulation of L. 

maculans by Alternaria spp., Arthrobotrys sp., Aspergillus sp., 

Fusarium equiseti, Gliocladium roseum, Myrothecium sp., 

Trichoderma aureoviride, Sordaria sp., S. chartarum and an 

unknown Coelomycete. 

reduced by over 67% compared with pathogen‐alone controls 

following inoculation with F. equiseti, G. roseum, T. aureoviride, 

Sordaria sp. or the Coelomycete. Over 70% of L. maculans 

ascospores obtained from the stubble germinated after 24 h at 

20ºC, irrespective of the co‐inoculated fungus. 

The mass of canola stubble inoculated with S. chartarum and 

Coprinus sp. was reduced almost 2‐fold compared with that of 

uninoculated controls (Table 1). 

Table 1. The effect of Coprinus sp. and Stachybotrys chartarum on 

weight of canola stubble after 2 months at 20ºC. 

Mean decrease of stubble weight (mg) 1 

Test fungus Fresh weight Air‐dry weight 

Control 2 5.1 12.1 

Coprinus sp. 9.6 20.1 

Stachybotrys chartarum 13.4 26.3 

1 

Mean of the difference of weight before inoculation and after incubation. 

2 

Each control stubble segment received 2 ml sterile distilled water, whereas each 

treated stubble segment was inoculated with two plugs of PDA culture of Coprinus 

sp. (plus 2 ml of sterile distilled water) or 2 ml of spore suspension of S. chartarum. 

DISCUSSION 

This study provides information on interactions between L. 

maculans and a wide range of fungal species, isolated from 

canola stubble or associated soil, on agar media and on canola 

stubble. Several stubble‐associated fungi both antagonised the 

pathogen in vitro and reduced pseudothecium formation on 

canola stubble. In particular, Coprinus sp. and S. chartarum, as 

antagonists of L. maculans and effective decomposers of canola 

stubble in this study, have potential to reduce pathogen 

inoculum on stubble in the field. This warrants further 

investigation, including longer‐term field studies, to assess the 

suitability of fungal antagonists as a biological means of 

controlling blackleg. 


We thank T. Potter, SARDI, for supplying stubble. 

REFERENCES 

1. Hysek J, Vach M, Brozova J, Sychrova E, Civinova M, Nedelnik J, 

Hruby J (2002) The influence of the application of mineral fertilizers 

with the biopreparation supresivit (Trichoderma harzianum) on the 

health and the yield of different crops. Archives of Phytopathology 

and Plant Protection 35, 115–24. 

2. Maksymiak MS, Hall AM (2000) Biological control of Leptosphaeria 

maculans (anamorph Phoma lingam) causal agent of blackleg 

canker on oilseed rape by Cyathus striatus, a bird's nest fungus. 

Proceedings of the British Crop Protection Council Conference: Pest 

and Diseases. Brighton, UK, 13–6 November. 

None of the 21 species tested eliminated L. maculans from 

stubble. Density of pseudothecia of L. maculans on stubble was 


86 First report of tomato yellow leaf curl virus in pepper (Capsicum annum) fields 

in Iran 

Posters 

M. Shirazi{ XE "Shirazi, M." } 1,2 , J. Mozafari 1 , F. Rakhshandehroo 2 and M. Shams‐Bakhsh 3 

1 Department of Genetics and National Plant Gene‐ Bank, Seed and Plant Improvement Institute, Mahdasht RD,Karaj, Iran 

2 Plant Pathology Department, Faculty of Agriculture, Islamic Azad University Science and Research Campus, Tehran, Iran 

3 Plant Pathology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran 

mhishirazi@yahoo.com 

INTRODUCTION 

Tomato yellow leaf curl virus (TYLCV) is one of the most 

devastating pathogens affecting tomato (Solanum lycopersicum) 

worldwide and is very important in Iran. TYLCV is transmitted by 

Bemisia tabaci in persistent and circulative manner. Tomato is 

the most important host for TYLCV. Symptoms on hosts except 

pepper include stunting, yellowing, leaf curl and flower 

senescence, whereas no distinct symptoms has been reported 

on pepper and those which occasionally observed, are caused by 

vector feeding (4). There are conflicting reports regarding the 

susceptibility of peppers (Capsicum spp.) to TYLCV and in Spain, 

C. annuum was reported as a host of an uncharacterised strain 

of TYLCV (5). 


In order to detection of TYLCV in Southern Iran, samples were 

collected from tomato and pepper fields in Bandar Abbas region 

including Rezvan and Sarkhun areas and jiroft region in 2007. 

Attention to disease symptoms including stunting, leaf curling, 

yellowing and deformation of stem end, 38 samples from 

Sarkhun, 80 samples from Rezvan and 10 samples from jiroft 

were collected. DNA extraction was performed with Dellaporta 

protocol (2). Virus detection was conducted by PCR with specific 

primers (3) and also by DAS‐ELISA (1). 


After DNA extraction and specific PCR, 2 samples of pepper and 

6 samples of tomato from 11 samples of pepper and 27 samples 

of tomato in Sarkhun, 68 samples from 80 samples of tomato in 

Rezvan and 4 samples of tomato and 2 samples of pepper from 4 

samples of tomato and 6 samples of pepper in jiroft were 

infected by PCR (Table 1), while DAS‐ELISA couldn’t detect any 

infection. Indeed a viral DNA fragment of 670 bp including a part 

of coat protein and movement protein genes was amplified in 

positive samples (Figure 1). Infection of 85% of Rezvan samples 

and about 21% of Sarkhun samples and 60% of jiroft samples 

indicate the most incidence of TYLCV in Rezvan area and also 

detection of virus in pepper samples indicate presence of TYLCV 

in pepper fields in southern Iran. This is the first report of pepper 

plants infected by Tomato yellow leaf curl virus in Iran. 

750 bp 

500 bp 

Figure 1. A viral DNA fragment of 670 bp was amplified in positive 

samples. 

(M): 1 Kb ladder‐ (1,2,3): Tomato positive samples‐(C‐): Negative control‐ (4): 

Pepper positive sample and (C+): positive control 

REFERENCES 

–M–—1–— 2 –— 3 –— C–—4 — C+ 

670 bp 

1. Clark, M. R. and Adams, A. N. I977. Characteristics of the 

microplate method of enzyme‐linked immunosorbent assay for the 

detection of plant viruses. Journal of General Virology, 34: 475– 

483. 

2. Dellaporta, S.L.; Wood, J. y Hicks, J.B. 1983. A plant DNA 

minipreparation: version II. Plant. Mol.Biol. Rep. 1(4): 19–21 

3. Pico, B., Diez, M.J., Nuez, F. 1998. Evaluation of whitefly‐mediated 

inoculation techniques to screen Lycopersicon esculentum and wild 

relatives for resistance to tomato yellow leaf curl virus. Euphytica. 

101: 259–271 

4. Polston, J. E., Cohen, L., Sherwood, T. A., Ben‐Joseph, R., and 

Lapidot, M. 2006. Capsicum species: Symptomless hosts and 

reservoirs of Tomato yellow leaf curl virus. Phytopathology 96:447– 

452 

5. Reina, J., Morilla, G., Bejarano, E.R., Rodríguez,M.D., Janssen, D. Y. 

Cuadrado, I.M. 1999. First Report of Capsicum annuum Plants 

Infected by Tomato Yellow Leaf Curl Virus. Plant Dis. 83: 1176 

Table 1. sampling regions and number of collected and positive samples 

Regions 

Collected 

samples 

(Tomato) 

Collected 

samples 

(Pepper) 

Positive 

samples 

(Tomato) 

Rezvan 80 0 69 0 

Sarkhun 25 13 5 4 

Jiroft 6 4 4 2 

Positive 

samples 

(Pepper) 


Posters 

39 Seed‐borne concerns with wheat streak mosaic virus in 2008 

S. Simpfendorfer{ XE "Simpfendorfer, S." } A and D. Nehl B 

A NSW Department of Primary Industries, 4 Marsden Park Rd, Tamworth, 2340, NSW 

B NSW Department of Primary Industries, PMB 8, Camden, 2570, NSW 

INTRODUCTION 

Wheat streak mosaic virus (WSMV), is a sap‐borne viral disease 

transmitted by the wheat curl mite (WCM). Western Australian 

research reported globally for the first time in 2005 that low 

levels of seed transmission (

87 Effect of white rust infection, bion and phosphonate on glucosinolates in brassica 

crops 

Posters 

Astha Singh{ XE "Singh, A." }, Les Copeland and David Guest 

University of Sydney 

INTRODUCTION 

Broccoli, Rocket and Indian mustard are Brassica crops 

consumed throughout the world. The major class of secondary 

metabolites formed in these crops are glucosinolates, many of 

which affect human health positively or negatively. White rust, 

caused by Albugo candida, is the most common disease affecting 

brassicas, although there is no information on the effect of 

disease on levels of beneficial and harmful glucosinolates, or 

their impacts on human health. In this research we describe the 

effect of white rust, on glucosinolate levels in leaves of these 

brassica crops. In addition, we investigate the effects of two 

activators of plant defence, Bion and phosphonate, on disease 

and glucosinolate levels. 


Plants. Seeds (10 per pot) of Broccoli (Brassica olearacea) cv. 

‘Greenbelt’ from Terranova Seed Company and Rocket (Eruca 

sativa) obtained from Yates Seed Company were sown in 10 cm 

diameter pots filled with Standard UC Mix + 10 g/kg Osmocote 

(Scott’s Australia Pty. ltd). 

Plants were grown in Growth Cabinets, with relative humidity of 

90% daytime and 70% night, light intensity of 710 µmoles, 

temperature of 15°C with daily irrigation for 1 min for broccoli 

and Glasshouse with 20°C temperature and daily irrigation with 

overhead sprinklers twice for rocket. Chemical treatments were 

sprayed 10 days before inoculation. Plants were inoculated 30 

days after sowing. 

Pathogen. Albugo candida obtained from DPI Victoria (Elizabeth 

Minchinton) from broccoli as sporangia on fresh leaves, and 

from rocket from a domestic garden. The pathogens were 

transferred onto healthy broccoli or rocket plants every 14 days. 

Chemical treatments. Twenty day old plants were sprayed with 

Bion (10, 25 or 100 mg/L acibenzolar‐S‐methyl; Syngenta) or 

phosphonate (0.5, 1.0 or 2.0 g/L a.i. Agrifos Supa 600; Agrichem 

Manufacturing Industries) until runoff, requiring approximately 

25 mL/pot. 

Inoculation technique. Spores were scraped off leaf pustules 

into sterile distilled water. After vortexing and centrifuging 

@2000 rpm for 5 minutes the pellet was discarded. The 

supernatant was incubated at 16°C for 3 h to induce zoospore 

release and adjusted to 10 4 zoospores/mL, and sprayed onto all 

leaves of 30 day old broccoli and 20 day old rocket plants. 

Inoculated plants were held at 16°C and 90% RH in the growth 

cabinet. White powdery blisters appeared on lower surfaces of 

inoculated leaves 7–10 days after inoculation. 

HPLC Analysis. Leaves and stems were detached and frozen in 

liquid nitrogen then freeze dried. The sample was then ground 

and 0.2 g was heated in a 90°C water bath for 10 min, then 10 

mL boiling water was added to the tube and heated in the water 

bath for another 10 min. The samples were centrifuged for 10 

min @ 3000 rpm. The supernatant was collected and the pellet 

was resuspended in 10 mL water, vortexed and centrifuged for 

another 10 minutes. The supernatants were pooled and 1 mL 

was filtered through 0.45 µm nylon filters into auto sampler 

vials. 

Samples were analysed using reverse‐phase HPLC (West et al. 

2002, modified by R. Jones, DPI Victoria, pers. comm.). Sinigrin 

was used as the internal standard and other glucosinolates 

(progoitrin, glucoiberin, glucoraphanin, gliucobrassinin and 

neoglucobrassin) were identified according to their relative 

retention times. 

RESULTS 

Table 1. Disease development on rocket 

Treatment 

Conc. 

Days for first 

symptom 

Uninoculated, untreated 11 Nil 

Inoculated + Bion 10 mg/L 10 Nil 

Inoculated + 

Phosphonate 

Inoculated + Bion + 

Phosphonate 

25 mg/L 12 Nil 

100 mg/L Nil 11 

0.5 g/L 15 Nil 

1.0 g/L 12 Nil 

2.0 g/L Nil Nil 

25 mg/L + 

1.0 g/L 

11 Nil 

Uninoculated + Bion 10 mg/L Nil Nil 

Uninoculated + 

Phosphonate 

Uninoculated + Bion + 

Phosphonate 

25 mg/L Nil Nil 

100 mg/L Nil 11 




25 mg/L + 

1.0 g/L 

Yellowing 

The results implied that the optimum concentrations to be used 

in further experiments were 25 mg/L Bion and 1.0 g/L 

phosphonate. 

GLUCOSINOLATE STUDY IN BROCCOLI 

Infected leaves and roots were collected at 5 day intervals 

before spraying, after spraying, pre and post infection. Plants 

were sprayed with Bion (25 mg/L), phosphonate (1.0 g/L) or 

combined Bion (25 mg/L) plus phosphonate (1.0 g/L). Results 

that indicate differences in levels of different glucosinolates at 

different stages of disease and chemical applications. There 

were no significant differences between glucosinolates in 

infected and uninfected leaves on inoculated plants. 

DISCUSSION 

Results clearly show that there is effect of the defence activators 

on the symptom development. Forthcoming results will describe 

the effect of disease as well as the defence activators on the 

levels of glucosinolates. 


Rodney Jones, Michael Imsic, Liz Minchinton (DPI Vic). 

REFERENCE 

1. West L, Tsui I, Haas G. (2002). Single column approach for the liquid 

chromatographic separation of polar and non‐polar glucosinolates 

from broccoli sprouts and seeds. Journal of Chromatography 966, 

227–232. 

Nil 

Nil 


Posters 

55 Fertilisation with N, P and K above critical values required for adequate plant 

growth influences plant establishment of cotton varieties in fusarium infested soil 

L.J. Smith{ XE "Smith, L.J." } A and J.K. Lehane B 

A Queensland Primary Industries and Fisheries, 80 Meiers Road, Indooroopilly, 4068, Qld 

B Queensland Primary Industries and Fisheries, PO Box 102, Toowoomba, 4350, Qld 

INTRODUCTION 

Fertiliser recommendations are developed to optimise nutrient 

uptake and provide the crop with adequate nutrients for normal 

growth and yield. Once critical levels of nutrients are met, no 

response to yield is expected from further nutrient application, 

but there may be other benefits. In some instances, nutrient 

applications higher than those needed for optimum growth may 

result in improved disease resistance. The overall aim of this 

work is to determine the effect of N, P and K fertilisation on 

nutrient uptake, plant establishment, disease severity and yield 

on two cotton varieties grown in Fusarium infested soil. In this 

paper the effect of nutrient application on plant establishment 

of two varieties differing in Fusarium wilt resistance will be 

discussed. 


A field experiment was conducted from November 2008 to May 

2009 near Cecil Plains, QLD, in soil naturally infested with the 

Fusarium wilt pathogen. Soil cores were collected and analysed 

for nutrient availability. Two cotton varieties differing in 

Fusarium wilt resistance were investigated: Sicala 45 BRF (F‐rank 

126) and Sicala 60 BRF (F‐rank 102). The experimental design 

was factorial with 16 treatments in randomised blocks, 6 blocks 

per treatment. Triple Superphosphate was applied at 0, 20, 40 

and 80 kg/ha; Urea with Entec at 0 and 150 kg/ha; and Muriate 

of Potash at 0 and 100 kg/ha. Calcium sulphate (200 kg/ha) was 

applied to every plot. Fertiliser treatments were applied by 

hand, broadcast to each plot. Hills were reformed following 

application. Seeds were sown at a depth of 10 cm. The 

experiment was irrigated and managed commercially. 


Nutrient availability. Availability of N, P and K of field soil 

exceeded the critical values required for adequate plant growth 

(Table 1). Therefore, application of N, P and K was considered 

above that required for adequate plant growth and optimal 

yields. 

Table 1. Nutrient and pH analysis of field soil 

Measurement 0–15 cm 

15–60 

cm 60–120 cm 

Critical 

value 

pH 8.01 8.28 8.45 ‐ 

N mg/kg 22 40 30 20–30 

P mg/kg‐Bicarb 29 9 7 6 

K mg/kg 331 199 276 100–150 

Varietal difference. Significantly more plants established for 

Sicala 45 BRF than for Sicala 60 BRF, highlighting the importance 

of planting varieties with higher F‐rank in Fusarium infested soils. 

N, P and K effects. Application of N at 150 kg/ha, significantly 

increased the number of plants established for both varieties 

(Table 2). N application has been associated with reduced 

Fusarium wilt disease in cotton. This may be due to an effect of 

form of N on the pathogen population in the soil. 

Table 2. The effect of nitrogen (N) fertilisation on establishment of 

varieties Sicala 45 BRF (V1) and Sicala 60 BRF (V2) 

N kg/ha V1 F‐rank 126 V2 F‐rank 102 

0 67 a 51 a 

150 73 b 59 b 

Data followed by different letters are significantly different from one another 

Application of P at the highest rate, significantly increased 

seedling death of Sicala 60 BRF due to Fusarium wilt compared 

to plants that had 0 and 40 kg/ha of P applied (Table 3). There 

are reports in the literature of increasing P levels both increasing 

and decreasing severity of Fusarium wilt. Unfortunately little is 

understood about how P influences disease severity. 

Table 3. The effect of P fertilisation on emergence and establishment of 

varieties Sicala 45 BRF and Sicala 60 BRF 

P Kg/ha V1 F‐rank 126 V2 F‐rank 102 

0 69 a 58 b 

20 73 a 54 ab 

40 68 a 56 b 

80 69 a 51 a 


Cotton wilt is commonly found to be more destructive to the 

crop when grown on potassium deficient soils, and the 

application of high potash fertilisers has real value in the 

reduction of wilt, particularly when used on resistant varieties. In 

this trial K was abundant, however despite this, addition at 100 

kg/ha significantly increased plant establishment of Sicala 45 BRF 

(Table 4). 

Table 4. The effect of K fertilisation on establishment of varieties Sicala 

45 BRF (V1) and Sicala 60 BRF (V2) 

K kg/ha V1 F‐rank 126 V2 F‐rank 102 

0 68 a 54 a 

100 72 b 56 a 


Interactive effects. When neither N nor K fertiliser was applied, 

the number of plants established was significantly reduced 

compared to other NK treatment combinations. For Sicala 45 

BRF, when N was applied at 150 kg/ha and P at 20 kg/ha, plant 

establishment was significantly increased compared to all other 

NP treatments (data not shown). These results highlight the 

importance of a balanced nutrition which is required for the 

functioning of inherent pathogen defence mechanisms. 

In conclusion, even when nutrient availability is adequate, plant 

establishment in Fusarium infested soil can be influenced by the 

application of N, P and K. 


We thank the Cotton Research and Development Corporation 



56 Eradication of Elsinoe ampelina by burning infected grapevine material 

M.R. Sosnowski{ XE "Sosnowski, M.R." } A,D , R.W. Emmett B,D , T.A. Vu Thanh C , T.J. Wicks A,D and E.S. Scott C,D 

A South Australian Research and Development Institute, GPO Box 397, Adelaide, South Australia 5001 

B Department of Primary Industries Victoria, PO Box 905, Mildura, Victoria 3502 

C School of Agriculture, Food and Wine, The University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064 

D Cooperative Research Centre for National Plant Biosecurity, LPO Box 5012, Bruce ACT 2617 

Posters 

INTRODUCTION 

Burning infected plant material is widely used in the control and 

eradication of endemic and exotic pathogens. However, there is 

little scientific evidence to confirm that pathogens are 

eliminated during this process (1). We report experiments to 

assess the efficacy of burning as a means of eradicating 

pathogens from woody plants. 

Black spot (anthracnose), caused by Elsinoe ampelina, is an 

important disease of grapevines worldwide (2). The fungus 

infects leaves, stems, petioles and berries. This pathogen was 

chosen as a model to develop an eradication strategy for the 

exotic disease black rot, caused by Guignardia bidwellii. Black rot 

has similar biology and epidemiology to black spot and could 

have a severe economic impact on the wine industry if it became 

endemic (3). 


An experiment was conducted in the Sunraysia district of 

Victoria. Vines (cvs Red Globe, Christmas Rose, Blush Seedless 

and Fantasy Seedless) were inoculated in spring 2007 by 

spraying a suspension of E. ampelina conidia on new shoots with 

2–4 unfolded leaves. The shoots were covered with polyethylene 

bags overnight to provide high humidity to promote spore 

germination and infection. 

In July 2008, vines were drastically pruned in an experiment to 

eradicate the disease. On treated vines, all plant material above 

the crown was removed and placed in a pit (5 x 3.5 x 0.5 m). In 

August 2008, six steel poles were placed upright at random 

within the pit. Steel mesh bags, containing infected vine canes 

(approx 30 g each) and temperature crayons (Tempilstik) in glass 

Petri dishes were attached to the poles at 20 and 50 cm above 

the pit floor. Another set of mesh bags was buried 5 cm below 

the soil surface on the floor of the pit. After the vine material 

was burnt, the mesh bags were collected and the ash was 

transferred to plastic tubes. Unburnt canes from untreated 

control material and buried samples were grated using a cheese 

grater. All samples were stored at 3–4°C until they were used. 

A bioassay was conducted in a glasshouse at 22–28°C in 

December 2008 using potted grapevines (cv. Thompson 

Seedless). The three youngest expanded leaves on each shoot 

were sprayed with deionised water and dusted with the ash or 

grated vine material. Each treatment was applied to 3–4 shoots 

per vine and the inoculated shoots were covered with 

polyethylene bags. After 48 hours, the bags were removed, the 

leaves were sprayed again with deionised water and the bags 

were replaced and left overnight. The experiment was arranged 

as a completely randomised design with two replicate vines per 

treatment. 

Twelve days after inoculation, the vines were assessed for 

symptoms of black spot. A Mann‐Whitney U‐test was used to 

analyse data. 

RESULTS 

The temperature crayons indicated that the fire reached in 

excess of 250°C and variable temperatures up to 60°C occurred 5 

cm below the soil surface. No leaf symptoms developed on 

plants inoculated with ash whereas significant symptoms were 

observed on plants inoculated with grated material from the 

controls and less severe symptoms occurred on plants 

inoculated with buried cane material (Fig. 1). 

Mean disease score 

3 

2 

1 

0 

Leaf 1 

Leaf 2 

Leaf 3 

control -5cm 20cm 50cm 

Figure 1. Mean disease score on the three newest leaves on grapevine 

shoots (cv. Thompson Seedless) inoculated with ash from burnt vine 

material positioned 20 and 50 cm above the floor of the bonfire, buried 5 

cm below the soil surface under the fire or untreated (control). Samples 

of grapevine canes infected with E. ampelina in steel mesh bags were 

positioned at 20 and 50 cm above the ground or buried 5 cm below the 

surface. Data are presented for each leaf individually, with Leaf 1 being 

the oldest. 

DISCUSSION 

These results confirm the efficacy of burning infected vine 

material, as temperatures exceeded those that are lethal to the 

fungus and the bioassay verified that this was the case. 

However, any pathogen on debris which penetrates the soil may 

not be eliminated. Further research is under way to evaluate 

burning for eradication of the bacterium Xanthomonas 

translucens from pistachio trees. 


We thank Chris Dyson (SARDI) for statistical support, members 

of the Department of Sustainability and Environment Victoria for 

assisting with the fire and the CRC for National Plant Biosecurity 


REFERENCES 

1. Sosnowski MR, Fletcher JD, Daly AM, Rodoni BC and Viljanen‐ 

Rollinson SLH (2009) Techniques for the treatment, removal and 

disposal of host material during programmes for plant pathogen 

eradication. Plant Pathology, Early view online DOI: 

10.1111/j.1365‐3059.2009.02042.x 

2. Magarey RD, Coffey BE and Emmett RW (1993) Anthracnose of 

grapevines, a review. Plant Protection Quarterly 8, 106–110. 

3. Wilcox W (2003) Grapes: Black rot (Guignardia bidwelli (Ellis) Viala 

and Ravaz.). Cornell Cooperative Extension Disease Identification 

Sheet No. 102GFSG‐D4, Cornell University. 


Posters 

88 Recent plant virus incursions into Australia 

J.E. Thomas A , V. Steele{ XE "Steele, V." } A , A.D.W. Geering A , D.M. Persley A , C.F. Gambley A , and B.H. Hall B 

A Queensland Primary Industries and Fisheries, DEEDI, 80 Meiers Rd, Indooroopilly, 4068, Queensland 

B SARDI,GPO Box 397, Adelaide, 5001,SA 

INTRODUCTION 

The continuing improvement in diagnostic methods combined 

with the increased frequency of international travel and reduced 

trade barriers have all probably contributed to the upsurge in 

new virus records. A number of plant viruses have recently been 

detected in Australia for the first time. These include; Colombian 

datura virus from Brugmansia sp., High plains virus from wheat 

(Triticum aestivum), Panicum mosaic virus from buffalo grass 

(Stenotaphrum secundatum), Tomato torrado virus from tomato 

(Lycopersicon esculentum) and Tomato yellow leafcurl virus from 

tomato. 


Colombian datura virus (CDV). A sample of Brugmansia sp. 

(angel’s trumpets) with leaf mosaic symptoms was obtained 

from Bomaderry, NSW, in August 2007. The plant contained 

flexuous filamentous particles about 840 nm long and gave a 

positive reaction in ELISA with AGDIA potyvirus group 

antibodies. The C‐terminal region of the coat protein and the 3’ 

UTR were amplified by RT‐PCR from an RNA extract (Qiagen 

RNeasy) and the products cloned and sequenced [1]. By 

comparison with CDV sequences on the GenBank database, the 

Australian sequence was 99.6–100% identical in the 3’ UTR, and 

the amino acid sequence of the 3’ portion of the coat protein 

was 100% identical. The consensus sequence of the Australian 

CDV isolate 2079 has been deposited in the GenBank database 

under accession FJ821796. 

Panicum mosaic virus (PMV). In June, 2008, a sample of 

Stenotaphrum secundatum (buffalo grass) showing mosaic 

symptoms was obtained from the Sydney basin, New South 

Wales. The plant contained isometric virions ca. 25–30 nm 

diameter which were trapped by immunosorbent electron 

microscopy and decorated, using an antiserum to the St 

Augustine decline strain of Panicum mosaic virus (PMV). Specific 

PCR primers were designed to amplify the complete coat protein 

(CP) gene sequence of PMV. The CP of the Australian sample 

(PMV isolate 2349) was 90% and 85% identical to PMV GenBank 

Accession PMU55002 at the amino acid and nucleotide levels, 

respectively. 

Tomato yellow leafcurl virus (TYLCV). Cherry tomato crops 

displaying symptoms of leaf curling, chlorosis and stunting were 

first reported from Pallara, Brisbane in March, 2006. Subsequent 

surveys indicated that the disease was common in the periurban 

areas of Brisbane, and incidences of nearly 100% were not 

uncommon. Infected plants gave a positive ELISA reaction with 

antibodies to African cassava mosaic virus (AGDIA), indicating 

the presence of a begomovirus. ELISA‐positive samples were also 

obtained from the Lockyer Valley, Caboolture and Bundaberg 

areas of south‐east Queensland during March to May, 2006. The 

TYLCV‐specific PCR primers, TYLCV‐F1 and TYLCV‐R1 were 

designed to produce a 336 bp amplicon from the Rep gene. The 

nucleotide sequences of these amplicons from three 

representative isolates were ca 99% identical to those of TYLCV 

accessions from GenBank. 

and occasionally necrotic lesions on leaves, stunting and leaf 

distortion and were associated with high greenhouse whitefly 

populations. A low concentration of isometric virions was 

observed in sap preparations by electron microscopy. PCR using 

the TToV specific primer pairs TR1F/R and TR2F/R, designed to 

RNA‐1 and RNA‐2 respectively [2], gave amplicons of the 

expected size from isolate 1883 (collected in 2006) and isolate 

2136 (collected in 2008). Both Australian isolates shared ca 99% 

nucleotide sequence identity with each other and with overseas 

isolates on both RNA components. 

High Plains virus (HPV). HPV is a presently‐unclassified, mitetransmitted 

virus which often occurs as mixed infections with 

Wheat streak mosaic virus (WSMV). The latter virus was 

recorded for the first time in Australia in 2003 [3]. Total RNA 

extracts of samples from the 2003 WSMV surveys were used to 

test for the presence of HPV. RT‐PCR primers were designed to 

amplify part of the putative nucleocapsid gene of HPV (GenBank 

accession U60141). RT‐PCR was done using a one‐step RT‐PCR kit 

(Qiagen). Amplicons of the expected size (483 bp) were 

amplified from some but not all WSMV‐infected plants, 

indicating dual infection of some plants with HPV. The 

nucleotide sequences of these products were 100% identical to 

the published HPV sequence. HPV‐infected wheat samples were 

obtained from experimental field plots at Roseworthy and 

Adelaide in South Australia and Horsham in Victoria and from a 

commercial crop near Moonie in Queensland. 

Isolates of all the above viruses have been deposited in the 

Queensland Primary Industries and Fisheries Plant Virus 

Collection. 


We thank G Ellis and E Colson for WSMV survey samples, 

Biosecuity Queensland staff for TYLCV survey samples and P 

Pezzaniti for assistance with collecting samples of TToV. 

REFERENCES 

1. Schwinghamer MW, Thomas JE, Parry JN Schilg MA, Dann EK (2007) 

First record of natural infection of chickpea by Turnip mosaic virus. 

Australasian Plant Disease Notes 2, 41–43. 

2. Pospieszny H, Borodynko N, Obrepalska‐Steplowska A, Hasiow B 

(2007) The First Report of Tomato torrado virus in Poland. Plant 

Disease 91, 1364–1364. 

3. Ellis MH, Rebetzke GJ, Chu P (2003) First report of Wheat streak 

mosaic virus in Australia. Plant Pathology 52, 808. 

Tomato torrado virus (TToV). Since 2005, a new disease of 

greenhouse tomatoes has been present in the Northern 

Adelaide Plains, South Australia. Symptoms included chlorosis 


16 Investigation of the effect of three essential oils, alone and in combination, on the 

in vitro growth of Botrytis cinerea 

Posters 

S.M. Stewart‐Wade{ XE "Stewart‐Wade, S.M." } 

Melbourne School of Land and Environment, The University of Melbourne, Burnley Campus, Richmond, 3121, Victoria 

INTRODUCTION 

Many essential oils have been screened individually for their 

antifungal properties, but little work has been done on the 

combination of these oils and their potential synergistic effect 

on fungal plant pathogens (1). The fungus Botrytis cinerea Pers. 

ex. Fr. causes the disease grey mould worldwide on more than 

100 plant species including fruit, vegetables, ornamentals and 

field crops, under field, glasshouse and postharvest storage 

conditions (2). Three essential oils, derived from clove buds, 

cinnamon leaves and red thyme leaves, showed the greatest 

inhibition of in vitro growth of B. cinerea in previous studies (2, 

3). The aim of this research is to examine the effect of the 

essential oils clove, cinnamon and red thyme, alone and in 

combination, at varying concentrations, on in vitro growth of 

Botrytis cinerea. 

Mean Colony Diameter (mm) 

30 

Cv 

Cn 

25 

T 

CvCn 

20 

CvT 

CnT 

15 

CvCnT 

10 

5 

0 

0 125 250 500 1000 

Oil Concentration (ppm) 


Stocks of three pure essential oils, namely clove bud (Syzygium 

aromaticum (L.) Merr. & Perry) oil, cinnamon leaf (Cinnamomum 

zeylanicum J. Presl.) oil and red thyme leaf (Thymus vulgaris L.) 

oil (Auroma Pty Ltd, Hallam, Vic.) were prepared with 0.1% v/v 

(final) Tween 80 used as an emulsifier. Essential oils and Tween 

80 were filter sterilised into cooled molten sterilised PDA. Each 

oil was added, either alone or in combination in equal amounts 

with each other oil (two and three oil combinations), at the 

following concentrations: 0 (nil control), 125, 250, 500 or 1000 

ppm. Mycelial plugs (6mm diameter) from the margins of 

actively growing, 3–4 day old B. cinerea cultures were inoculated 

centrally onto PDA plates containing the essential oils and the 

plates were sealed with Parafilm. Seven replicate plates were 

used per treatment and cultures were incubated at room 

temperature (~18–22°C) under natural light conditions. Mean 

colony diameter (mm) was measured 24 and 48 h after 

inoculation. The experiment was repeated. Data were analysed 

with an ANOVA using GenStat and means were separated using 

LSDs at P=0.001. 

RESULTS 

Presence of essential oils was a significant factor (P

Posters 

42 A single plant test for resistance in wheat to crown rot and root‐lesion nematode 

(Pratylenchus thornei) 

J.P. Thompson{ XE "Thompson, J.P." } and R.B. McNamara 

A DEEDI, Qld Primary Industries and Fisheries, Leslie Research Centre, PO Box 2282, Toowoomba, 4350, Queensland 

INTRODUCTION 

Fusarium pseudograminearum, the cause of crown rot, and rootlesion 

nematode (Pratylenchus thornei) are the most serious soilborne 

pathogens of wheat in the Australian northern grain 

region. Only one cultivar (EGA Wylie) is both tolerant to P. 

thornei and moderately resistant to crown rot. Glasshouse 

methods have been developed to test wheat for resistance to 

crown rot (Wildermuth and McNamara 1994) and root‐lesion 

nematode (Thompson 2008) separately. This paper reports an 

experiment aimed to develop a single‐plant method for 

assessing resistance to both crown rot and P. thornei, which 

would be very valuable for accelerated wheat breeding. 


Eleven reference wheat cultivars for crown rot (susceptible 

Puseas and Vasco, moderately susceptible Hartog, and partially 

resistant Gala and 2–49), and for P. thornei (susceptible Gatcher, 

Batavia and Cunningham, and partially resistant GS50a, QT9048 

and Yallaroi) were tested. Five replicate 67 mm square pots 

received 430 g of steam‐sterilised clay‐loam soil moistened to 

37.5% moisture (‐0.1 bar), and 10 seeds of each cultivar were 

placed on top. Seed was covered with 100 g dry soil (5% 

moisture), then 0.3 g of ground barley/wheat seed colonised 

with F. pseudograminearum was added followed by 30 g dry soil. 

After 7 days in a glasshouse at 25°C, top watering of the pots to 

37.5% moisture was commenced. After 3 weeks, soil was 

washed away from the seedlings and the first three leaf sheaths 

were rated for crown rot symptoms on a 1 to 4 scale and 

summed (max score = 12). 

After the crown rot test, four plants from each pot, with roots 

trimmed to 3 cm, were planted individually in pots of 330 g 

steamed vertosolic soil (Irving Series), watered and inoculated 

with a suspension of P. thornei to provide 10,000/kg soil. The 

plants were placed in a growth room for 4 days after which 

permanently wilted leaf tissue was cut off. Plants were then 

grown in a glasshouse with temperature at 22°C and constant 2 

cm soil water tension (85% moisture). The pots received three 

drenches with 0.1% (w/v) benlate over 6 weeks to prevent 

crown rot developing further. After 16 weeks, a 150 g subsample 

of soil and roots from the bottom half of the pots was extracted 

for nematodes in Whitehead trays. P. thornei were counted in a 

1‐ml Hawksley slide under a compound microscope and 

expressed as number/kg soil and transformed by ln(x+c) for 

analysis of variance. 

RESULTS 

The crown rot standard cultivars performed as expected, with 2– 

49 and Gala relatively resistant, and Hartog, Vasco and Puseas of 

increasing susceptibility (Fig. 1). All P. thornei standard cultivars 

were relatively susceptible to crown rot. Results for P. thornei 

are given in Fig. 2 in log units. Backtransformed values ranged 

from 16,150 P. thornei/kg soil for QT9048 to 136,380 for Puseas. 

The standard cultivars for P. thornei performed as expected with 

GS50a, QT9048 and Yallaroi being relatively resistant, and 

Batavia, Gatcher and Cunningham being relatively susceptible to 

P. thornei. Hartog produced intermediate numbers of P. thornei 

as expected from previous experiments. All of the other crown 

rot standard cultivars were relatively susceptible to P. thornei. 

Figure 1. Crown rot ratings of seedlings 

Figure 2. Number of Pratylenchus thornei after 16 weeks 

DISCUSSION 

This initial experiment shows it is possible to screen individual 

plants for resistance to both crown rot and P. thornei. The 

approach taken was first to test plants for crown rot by a 

standard method, then transplant them for a nematode 

resistance test. This was not ideal in that the plants suffered 

considerable transplanting stress and the method was labour 

intensive. Despite this, meaningful results were obtained for 

resistance to P. thornei. Modification of the methods should be 

possible to obtain an effective single plant test for resistance to 

both crown rot and P. thornei without the need to transplant. 


We thank M. Brady, T. Bull, T. Clewett, S. Coverdale, M. Davis, M. 

Harris, N. Seymour, J. Sheedy, K. Trackson, G. Wildermuth and J. 

Wood for their input to this study. 

REFERENCES 

Thompson JP (2008) Resistance to root‐lesion nematodes (Pratylenchus 

thornei and P. neglectus) in synthetic hexaploid wheats and their 

durum and Aegilops tauschii parents. Australian Journal of 


Wildermuth GB, McNamara RB (1994) Testing wheat seedlings for 

resistance to crown rot caused by Fusarium graminearum Group I. 

Plant Disease 78, 949–953. 

© State of Queensland, Department of Employment, Economic 

Development and Innovation, 2009 


40 A single plant test for resistance to two species of root‐lesion nematodes and 

yellow spot in wheat 

Posters 

J.P. Thompson{ XE "Thompson, J.P." } A , T.G. Clewett A , J.G. Sheedy A, , S.H. Jones A and P.M. Williamson B 

A DEEDI, Primary Industries and Fisheries, Leslie Research Centre, GPO Box 2282, Toowoomba, 4350, Queensland 

B 30 Rhyde Street, Mount Lofty, Toowoomba, 4350, Queensland 

INTRODUCTION 

Root‐lesion nematodes (Pratylenchus thornei and P. neglectus) 

and the stubble‐borne fungal disease yellow spot (Pyrenophora 

tritici‐repentis) cause substantial loss of wheat production in the 

Australian northern grain region. While some wheat varieties 

have partial resistance or tolerance to some of these diseases 

none has resistance to all. If varieties could be produced that 

combine resistance to all these diseases then the savings to the 

wheat industry would be very great. 

rating of wheat lines. It was probably due to the changed growth 

conditions for conducting the yellow spot test resulting in less 

reproduction compared with the plants kept in the glasshouse. 

Phenotyping for multiple diseases on a single plant could be a 

valuable method for rapidly breeding multiple disease resistant 

wheat varieties. A method has been developed to test for 

resistance to P. thornei and P. neglectus simultaneously (Huang 

et al. 2005) and in this study we extend it to include yellow spot. 


Forty‐one wheat cultivars were subjected to three inoculation 

treatments (i) root‐lesion nematodes (P. thornei and P. 

neglectus), (ii) yellow spot, and (iii) root‐lesion nematodes and 

yellow spot together. Five replicates were grown as single plants 

in individual pots of 330 g of steam‐sterilised vertosolic soil. 

Nematode inoculum of the two species was produced 

separately, and mixed in suspension prior to inoculating 

5,000/kg soil of each species at sowing. The plants were grown 

in a glasshouse with soil maintained at 22°C and 2 cm water 

tension. At the 2‐leaf stage, the seedlings of the yellow spot 

treatment were spray inoculated with field‐collected Pyr. triticirepentis 

conidia (0.45 mg conidia/mL). Inoculated seedlings were 

held in a mist chamber for 40 h, and then another 4 days in a 

growth room with sprinklers operating for 3 mins every 12 hrs, 

and temperature at 23.5°C. The plants were rated for combined 

chlorosis and necrosis of the leaves on a 1 (susceptible) to 9 

(resistant) scale. All pots were returned to the glasshouse and 

laid out in a split block design. After 16 weeks from sowing, 

nematodes were extracted from the soil and roots by the 

Whitehead tray method. Pratylenchus thornei and P. neglectus 

were identified on morphology and counted under a compound 

microscope. Nematode numbers [after transformation by 

ln(x+c)] and yellow spot ratings were analysed by ANOVA. Mean 

values of the 41 wheat lines were used in regression analyses. 


There was good discrimination between wheat lines for yellow 

spot ratings (P < 0.001) and a highly significant regression 

relationship (P < 0.001) between yellow spot ratings in the 

presence and absence of Pratylenchus inoculum (Fig. 1). This 

indicated that a systemic resistance was not induced and that 

yellow spot resistant and susceptible wheats could be reliably 

identified in the presence of the nematodes. 

The wheat cultivars inoculated with yellow spot or not were 

ranked similarly for P. thornei resistance (R 2 = 0.7756 , , P < 0.001) 

or P. neglectus (R 2 = 0.484, P < 0.001) or for total Pratylenchus 

(R 2 = 0.7738, P < 0.001) (Fig. 2). Numbers of P. thornei and P. 

neglectus in the treatment also tested for yellow spot resistance 

were significantly lower than in the nematode only treatment. 

This effect was not correlated with the yellow spot resistance 

Figure 1. Highly significant regression relationship between ratings for 

yellow spot of 41 wheat lines when tested either without (x axis) or with 

Pratylenchus (y axis). 

Figure 2. Highly significant regression relationship between number of 

Pratylenchus produced by 41 wheat lines when tested either without (x 

axis) or with yellow spot (y axis) 

These results indicate that simultaneous testing of single plants 

for resistance to P. thornei, P. neglectus and yellow spot is 

feasible. With further refinement this method could improve the 

efficiency of breeding multiple‐disease resistant wheats which 

would be of great value to Australia. 


We thank Megan Brady for technical assistance. 

REFERENCES 

Huang, R, Thompson, JP, Sheedy, JS, Reen, RA and Brady, MJ (2005) Dual 

phenotyping of wheat breeding lines for resistance to root‐lesion 

nematodes. 15th Biennial Plant Pathology Conference Handbook’, 

Geelong. p. 110. 




Posters 

90 Role of nematodes and zoosporic fungi in poor growth of winter cereals in the 

northern grain region 

J.P. Thompson{ XE "Thompson, J.P." }, T.G. Clewett , J.G. Sheedy and K.J. Owen 

DEEDI, Qld Primary Industries and Fisheries, Leslie Research Centre, PO Box 2282, Toowoomba, 4350, Qld 

INTRODUCTION 

The endoparasitic root‐lesion nematodes Pratylenchus thornei 

and P. neglectus and the ectoparasitic stunt nematode Merlinius 

brevidens occur widely in the northern grain region of Australia. 

Grain loss in wheat has been well characterised for P. thornei in 

the northern region (Thompson et al 2008) and for P. neglectus 

in the southern and western regions (Vanstone et al, 2008). 

Information on the role of Merlinius brevidens is sparse although 

it has been shown to cause yield loss of wheat in the USA (Smiley 

et al. (2006), particularly when associated with the zoosporic 

fungus Olpidium brassicae (Langdon et al.1961). Following 

diagnosis of high populations of M. brevidens associated with 

poor crops of winter cereals in 2007 a glasshouse experiment 

was conducted in 2008 to explore further the reasons for the 

poor growth 


About 50 kg of soil was collected (on a grid of 36 positions within 

a 1,920 m 2 area) from each of nine fields in the northern grain 

region located from Garah in northern NSW to Wondai in Qld. 

These sites were selected on the basis that M. brevidens and/or 

Olpidium sp. had been detected in poorly growing cereals in the 

field or on the farm previously. The soil from each site was 

mixed, sieved and about half was partially sterilised by steam at 

70ºC for 45 min. Quantities of each soil (330 g OD equivalent) 

were mixed with 1 g of Osmocote® [Native Gardens plus 

micronutrients (17–1.6–8.7 NPK)] slow‐release fertiliser and 

placed in 5 cm‐square plastic pots suitable for bottom watering. 

Eighteen pots of each of sterilised and unsterilised soil were 

prepared to allow for growing 3 replicates of 3 cereals (wheat cv. 

Strzelecki, barley cv. Grout and oats cv. Coolibah) at 2 moisture 

tensions (2 cm and 7 cm) and 2 harvest times (8 and 16 wks). 

The pots were placed on strips of capillary matting for each soil 

type and on separate benches for sterilised and unsterilised soil 

and for the two water tensions. A single plant per pot was 

grown, with the glasshouse temperature kept below 25ºC by 

evaporative coolers. At each harvest, plant tops were dried at 

85ºC for 4 days and weighed. Soil and roots were removed from 

the pots, photographed and split longitudinally. Roots were 

extracted from one half of the pots, blotted, weighed, and a 

subsample stained with trypan blue. Soil and roots from the 

other half were broken into pieces

41 Sources of resistance to root‐lesion nematode (Pratylenchus thornei) in wheat 

from West Asia and North Africa 

Posters 

J.P. Thompson{ XE "Thompson, J.P." }, T.G. Clewett and M.M. O’Reilly 

DEEDI, Primary Industries and Fisheries, Leslie Research Centre, GPO Box 2282, Toowoomba, 4350, Queensland 

INTRODUCTION 

The root‐lesion nematode Pratylenchus thornei occurs widely in 

the northern grain region (northern NSW and southern and 

central Qld) causing considerable economic loss in wheat 

production. Current management tools are hygiene with farm 

machinery to prevent transfer of infested soil, crop rotation and 

growing tolerant wheat varieties (Thompson et al. 2008). More 

effective control of the nematode populations could be achieved 

if resistant cultivars were available. 

Experiment 3. Thirteen WANA bread wheats (Fig. 1) and 10 

durum wheats (data not shown) had P. thornei numbers that did 

not differ from GS50a in two experiments. All Australian bread 

wheats were susceptible whereas the two Australian durums 

were as resistant as GS50a. 

To obtain novel sources of resistance we tested two collections 

of wheat from the West Asia and North Africa (WANA) region. 

The A.E. Watkins Collection was made in Cambridge, UK, in the 

late 1920s and early 1930s with landrace wheats from many 

countries of the world (Miller et al. 2001). The R.A. McIntosh 

Collection was made in 1993 at University of Sydney with wheats 

from WANA countries for studies on rusts and flag smut 


Wheat Accessions. The WANA wheats tested comprised 148 

bread wheat (Triticum aestivum) and 139 durum wheat (Triticum 

turgidum spp. durum) accessions from the Watkins Collection 

and 59 bread and 43 durum accessions from the McIntosh 

Collection. 

Resistance Experiments. Initially each of the above collections 

was tested for resistance to P. thornei in two separate 

glasshouse experiments that included the reference standards 

GS50a (a partially resistant bread wheat) and three susceptible 

wheat varieties Gatcher, Suneca and Potam. A number of bread 

and durum wheat accessions that produced nematode numbers 

not significantly different from GS50a were retested for 

resistance in a third experiment. 

Resistance test methods. The wheat accessions were grown as 3 

replicates in pots of steamed vertosolic soil (1 kg soil in 

Experiments 1 and 2 and 650 g in Experiment 3), inoculated with 

P. thornei at a rate of 2,500/kg soil. The soil was fertilised to 

provide N, P, K, S, Ca and Zn and was watered to pF2 (56% 

moisture). The experiments were laid out in randomised blocks 

in an evaporatively cooled glasshouse. In Experiment 3, the soil 

and root temperature was kept at 22°C with pots in glasshouse 

waterbaths. After 16 weeks growth, one half of the soil and 

roots was removed, broken to < 1 cm manually and 150 g 

extracted for nematodes in Whitehead trays. Nematodes were 

counted under a microscope and expressed as P. thornei/kg soil 

(oven dry equivalent). Data were transformed by ln(x+1) for 

ANOVA and calculation of Fl.s.d. Backtransformed means and 

reproduction factors (RF = final number of P. thornei/ initial 

number) were calculated. 

Figure 1. Reproduction factor of WANA bread wheats (black bars) that 

did not differ significantly from GS50a in comparison with reference 

standard wheats (open bars) from the northern grain region. The letters 

B and D after names indicate bread and durum wheats respectively. 

The identification of additional sources of resistance in bread 

wheat to P. thornei provides greater options for producing 

Australian wheat varieties with greater levels of resistance to P. 

thornei than in current varieties. 


We thank Michael Mackay and Greg Grimes of Australian Winter 

Cereals Collection, and Professor Bob McIntosh University of 

Sydney or provision of seed 

REFERENCES 

1. Thompson JP, Owen KJ, Stirling GR, Bell MJ (2008) Root‐lesion 

nematodes (Pratylenchus thornei and P. neglectus): a review of 

recent progress in managing a significant pest of grain crops in 

northern Australia. Australasian Plant Pathology 37, 235–242. 

2. Miller TE, Ambrose MJ, Reader SM (2001) The Watkins Collection. 

In ‘Wheat Taxonomy: The Legacy of John Percival’. (Ed. PDS Caligari 

and PE Brandham) pp. 113–120. (Academic Press London). 




Experiments 1 and 2. As a group, the bread wheats were 

significantly (P < 0.001) more susceptible to P. thornei than the 

durum wheats with backtransformed means for P. thornei/kg 

soil of 52,051 for bread wheats and 38,560 for durum wheats in 

the Watkins Collection, and 34,200 for bread wheats and 21,268 

for durum wheats in the McIntosh Collection. 


Posters 

89 Sugarcane downy mildew: development of molecular diagnostics 

N. Thompson{ XE "Thompson, N." } and B.J. Croft 

BSES Limited, PO Box 86, Indooroopilly, 4068, QLD 

INTRODUCTION 

Sugarcane downy mildew (SDM) is currently one of the most 

serious diseases at the Ramu sugarcane plantation in Papua New 

Guinea. SDM is rated as a high priority pathogen for the 

Australian sugar industry. 

SDM can be caused by several fungal species in the genus 

Peronosclerospora including P. sacchari, P. spontanea and P. 

philippinensis (1). P. sacchari was eradicated from Australia 

during the 1950s by resistant varieties and roguing of remaining 

infected plants (2). It is estimated that 60% of current 

commercial sugarcane varieties in Australia are intermediate or 

susceptible to SDM. 

The species of Peronosclerospora are difficult to distinguish by 

traditional taxonomy, so molecular diagnostics would be useful 

to conclusively identify the species during a disease incursion. 

Peronosclerospora diagnostics using both hybridisation (3) and 

PCR (4) have been developed in the USA; however the number 

of isolates available was limited in these studies (D. Luster, pers. 

comm.). Therefore molecular diagnostics need to be verified on 

a larger sample size of Peronosclerospora, including Australian 

domestic and exotic species. 


Target genes and isolates. DNA sequences from isolates held at 

USDA‐ARS (Ft Detrick, MD) were used to develop primers for 

regions that showed variation (Table 1). Species used to design 

and test the primers are shown in Table 2. 

Table 1. Peronosclerospora genes used as primer targets 

Gene 

ITS1* 

Actin* 

EF1* 

Beta‐tubulin 

COX‐1 

Predicted outcome 

General primers; should amplify all 

Designed to amplify all Oomycetes 

Variation within and between species; may not be 

good for diagnostics 

High variation; unsure as to efficacy of primers. 

Size differential between species, may not amplify 

some species 

* designed by Dr Clint Magill, Texas A&M University 

(ITS1: ribosomal DNA first internal transcribed region; EF1: Transcription Elongation 

Factor 1 alpha; COX‐1: Cytochrome oxidase‐1) 

Table 2. Peronosclerospora species used in this study 

Species 

Detail 

P. sacchari Sequence from up to 3 isolates 

P. philippinensis Sequence from up to 3 isolates 

P. sorghi Sequence from up to 3 isolates 

P. maydis Sequence from up to 6 isolates 

P. sacchari 2 herbarium isolates 

P. sorghi 1 herbarium isolate. 

P. eriachloae 1 herbarium isolate 

P. noblei 1 herbarium isolate 

P sp. 

2 unknown herbarium isolates 

ARS. Peronosclerospora isolates from the QDPI&F Plant 

Pathology Herbarium were used to test efficacy of primers. 

Analysis. DNA was extracted from isolates using QIAGEN DNeasy 

kit. PCR was done using primers developed for the genes of 

interest, and the results analysed on agarose gels. 


Amplification with ITS‐1 was used as a positive control to ensure 

that amplifiable DNA was obtained after extraction. 

Unfortunately, one of the P. sacchari herbarium isolates was not 

amplifiable. Further investigation is needed to test this isolate. 

The general Oomycete primers (actin) gave amplified products in 

some, but not all species. This is unexpected, because this 

primer set was designed to amplify products from all 

Oomycetes. 

The primers for EF1 were tested and a high degree of variation 

observed, with complex banding patterns between all species 

tested. This primer set is likely to not be useful for diagnostics 

unless further sequencing reveals diagnostic differences. 

Beta‐tubulin primers showed differential amplification between 

species, however some unexpected complex banding was 

observed. Further investigation of this primer set is also 

required. 

The Cox‐1 primer set was designed to show differences between 

species, and it showed promise as a diagnostic, however the 

amplification of P. sacchari remains inconsistent. 

Future work is planned to obtain more isolates of the causal 

agents of SDM to troubleshoot and refine the molecular 

diagnostic test. 


Thanks to: Dr Clint Magill, Dr Ram Perumal (Texas A&M 

University) and Dr Doug Luster (USDA‐ARS, Ft Detrick) for initial 

sequencing information; to Dr Roger Shivas (QDPI&F Plant 

Pathology Herbarium) for isolates and collaboration. This project 

was partially funded by an SRDC Travel and Learning 

Opportunity scholarship. 

REFERENCES 

1. Suma, S and Magarey, R.C (2000) Downy Mildew in “A guide to 

Sugarcane Diseases” (Eds Rott, P., Bailey, R.A., Comstock, J.C., 

Croft, B.J. and Saumtally, A.S.) pp 90–95 (CIRAD and ISSCT) 

2. Hughes, C.G. (1957) The eradication of Downy mildew. Cane Pest 

and Disease Control Boards’ Conference Minutes and Proceedings, 

pp 29. 

3. Yao, C‐L, Magill, C.W, Frederiksen, R.A., Bonde, M.R., Wang, Y. and 

Wu, P‐S. (1991) Detection and Identification of Peronosclerospora 

sacchari in Maize by DNA Hybridization. Phytopathology 81(8) 901– 

905. 

4. Yao, C‐L, Magill, C.W and Frederiksen, R.A (1992) Length 

heterogeneity in ITS 2 and the methylation status of CCGG and 

GCGC sites in the rRNA genes of the genus Peronosclerospora. 

Current Genetics 22:415–420. 

Amplification. Theoretical amplification was done using 

Peronosclerospora gene sequences from isolates held at USDA‐ 


43 Effect of irrigation method on disease development in a carrot seed crop 

R.S. Trivedi{ XE "Trivedi, R.S." } 1 , J.M. Townshend 2 , M.V. Jaspers 3 , H.J. Ridgway 3 , and J.G. Hampton 1 

1 Bio‐Protection Research Centre and 3 Department of Ecology, PO Box 84, Lincoln University, Canterbury, New Zealand 

2 Midlands Seed Ltd, PO Box 65, Ashburton, Canterbury, New Zealand 

Posters 

INTRODUCTION 

For carrot (Daucus carotae L.) seed production in Canterbury, 

New Zealand, overhead irrigation is commonly used from mid‐ 

November until March to prevent soil moisture deficits. 

However this irrigation method may assist the spread of plant 

pathogens such as Alternaria radicina/A. daucii/Cercospora 

carotae within the crop. We compared the effects of overhead 

irrigation and drip (T‐Tape) irrigation on disease level in a carrot 

seed crop in Canterbury. 


A field assessment of the effect of irrigation method (overhead 

vs. drip) was made in the 2007/08 season. An 8 ha field was 

divided into two; 4 ha was irrigated via a conventional overhead 

system, and 4 ha was irrigated via a drip (T‐Tape) system. The 

drip lines were dug 3–4 cm below the soil surface in early 

November. Soil moisture was monitored using a neutron probe 

and irrigation applied as required. Irrigation treatments were not 

replicated, but within each 4 ha block, twelve 30 m 2 plots were 

selected at random and used for three assessment of foliage 

disease symptoms using a 1 to 10 rating scale where 1= no 

symptoms and 10= dead plant and an assessment of root disease 

symptoms using a 0 to 4 rating scale where 0= no evidence of 

root infection and 4= shoulder region of root completely girdled 

with black rot. At maturity ten primary umbels were hand 

harvested from each plot and hand threshed. Seeds were then 

dried at 30°C to bring the seed moisture level down to 8%, hand 

rubbed to remove spines and thoroughly mixed. Hands were 

sterilised with 90% ethanol to prevent contamination while 

handling different seed samples. For seed infection, 100 carrot 

seeds per plot were plated onto a semi selective agar media for 

A. radicina, and incubated at 27°C in 24 h dark for 14 days. For 

seed germination, 100 seeds per plot were placed between 

moist germination paper towels and incubated at 20°C in 24 h 

dark for 14 days before evaluation. The collected data were 

statistically analysed using an unpaired t‐ test. 

RESULTS 

The carrot plants from drip irrigated blocks had significantly less 

foliage infected by A. radicina/A. daucii/Cercospora carotae at all 

three assessment times (Fig 1, P

Posters 

91 Pathogenicity of Radopholus similis on ginger in Fiji 

U. Turaganivalu{ XE "Turaganivalu, U." } A , G.R. Stirling B , S. Reddy A and M. K. Smith C 

A Fiji Ministry of Agriculture, Box 77, Nausori, Fiji 

B Biological Crop Protection Pty Ltd, 3601 Moggill Rd, Moggill,, Queensland 

C Department of Primary Industries and Fisheries, PO Box 5083, Nambour, Queensland 

INTRODUCTION 

Radopholus similis was first associated with a disease of ginger 

(Zingiber officinale) in the early 1970s, when stunted, chlorotic, 

low yielding crops in Fiji were found to be infested with the 

nematode (1). Nematodes were observed in small, shallow, 

water soaked lesions on the rhizome surface, and these lesions 

eventually enlarged until the rhizome was destroyed. 

Although R.similis was considered primarily responsible for the 

symptoms observed, secondary organisms were also thought to 

be involved (1). This study sought to confirm this by examining 

the pathogenicity of the nematode on ginger in a more 

controlled environment. 


Twenty 4 L pots were filled with autoclaved potting mix and 

planted with a Radopholus‐free ‘seed piece’ of ginger (a section 

of rhizome used as planting material). Pots were then 

transferred to a glasshouse and 6 weeks later, half the pots were 

inoculated with 1,500 R. similis. The nematode was obtained 

from a ginger farm at Veikoba, Fiji and had been multiplied in 

the laboratory on sterile carrot tissue. Fifteen and 20 weeks after 

pots were inoculated, the number of yellowing or dead shoots in 

each pot was recorded, above‐ground biomass in five inoculated 

and five control pots was measured and symptoms on seed 

pieces and newly‐developing rhizomes were assessed. 

Nematodes were extracted by spreading macerated rhizomes or 

200 mL samples of soil and roots on an extraction tray and 

recovering them on a 38µm sieve. 

Portions of seed pieces and rhizomes showing symptoms 

possibly caused by R. similis were assessed by removing small 

pieces of tissue from affected areas, macerating them in water 

and checking for nematodes after 24 hours. Discoloured tissue 

was also checked for fungal pathogens known to cause 

discoloration or rotting of ginger (i.e. Fusarium and Pythium) by 

placing small pieces of tissue onto potato dextrose agar (PDA) or 

corn meal agar with carbendazim, ampicillin, rifampicin, 

pentachloronitrobenzene and pimaricin (CARPP), and observing 

plates after 24 and 48 hours. 

RESULTS 

Non‐inoculated plants grew normally and after 15 weeks they 

had several healthy green shoots up to 90 cm long. In contrast, 

the stem bases and lower leaves of 6 of the 10 inoculated plants 

were yellow and in some cases the affected shoots had died. 

Yellowing was first observed about 12 weeks after inoculation 

and at 15 weeks, 40% of shoots were chlorotic or dead. By 20 

weeks, three inoculated plants had died, shoots on the 

remaining plants were dying back, rhizomes and seed pieces 

were discoloured or badly rotted and plant biomass was 

significantly reduced relative to the control (Table 1). 

into the rhizome, and from seed pieces. In some cases, the 

nematode population in parts of a seed piece or rhizome was as 

high as 500 R. similis/g. Fusarium, Pythium or other fungi were 

not isolated from discoloured tissues. Estimates of the number 

of R. similis recovered after 20 weeks indicated that significant 

nematode multiplication had occurred in roots, seed pieces and 

rhizomes (Table 2). 

Table 1. Effect of Radopholus similis on ginger 20 weeks after plants 

growing in potting mix were either inoculated with the nematode or left 

uninoculated 

Treatment Dry wt. shoots (g) Fresh wt. 

seed piece (g) 

Fresh wt. 

rhizome (g) 

Control 79.2 a 52.8 a 54.4 a 

R. similis 7.5 b 23.7 b 24.5 b 

Numbers in the same column followed by different letters are significantly different 

(P= 0.05) 

Table 2. Numbers of Radopholus similis recovered 20 weeks after ginger 

plants were inoculated with 1,500 nematodes or left uninoculated 

No. R. similis females 

/seed 

piece 

/rhizome 

Control 0 0 0 

/pot 

(soil + roots) 

R. similis 397 884 15,628 

DISCUSSION 

Our results suggest that R. similis multiplies initially on seed 

pieces and roots and then invades newly‐developing rhizomes. 

The nematode first seems to feed on outer parts of the rhizome 

and the resulting damage leads to yellowing at the base of 

shoots and of the lower leaf sheath. As more tissues are 

destroyed, older leaves turn yellow, shoots eventually collapse 

and discoloration extends further into the rhizome. The end 

result is that plants eventually die and the rhizome is totally 

destroyed. 

Given the results of our experiment, we suggest that R. similis is 

a pathogen of ginger in its own right. The nematode is capable of 

killing plants and destroying rhizomes, with secondary organisms 

playing little role in symptom development. 


Funding from ACIAR is gratefully acknowledged. 

REFERENCES 

1. Vilsoni F, McClure MA, Butler LD (1976). Occurrence, host range 

and histopathology of Radopholus similis in ginger (Zingiber 

officinale). Plant Disease Reporter 60: 417–420. 

Observations on tissue collected from affected plants showed 

that R. similis was present in the lowest leaf sheaths, in the collar 

at the base of the shoot, and in rhizome tissue at the point 

where shoots emerged from the rhizome. The nematode was 

also recovered from sunken lesions and blackened tissue on the 

rhizome surface, from discoloured tissue that extended 1–3 mm 


17 Survival of the pistachio dieback bacterium in buried wood 

T.A. Vu Thanh{ XE "Vu Thanh, T.A." } A , D. Giblot‐Ducray A , M.R. Sosnowski B,C and E.S. Scott A,C 

A School of Agriculture, Food and Wine, The University of Adelaide, Waite Campus, PMB 1, Glen Osmond, 5064 SA 

B South Australian Research and Development Institute, GPO Box 397, Adelaide, 5001 SA 

C Cooperative Research Centre for National Plant Biosecurity, LPO Box 5012, Bruce, 2617 ACT 

Posters 

INTRODUCTION 

Pistachio dieback is a bacterial disease causing internal staining, 

trunk and limb lesions, decline, dieback and, in some instances, 

death of pistachio trees (1). Apparently endemic in Australia, the 

causal agent is a strain of Xanthomonas translucens. It is a 

vascular pathogen that provides a local model to assess the 

effectiveness of existing eradication strategies for systemic 

bacterial pathogens of woody perennials which are considered 

high‐priority emergency plant pests in Australia. Burial and 

burning are two accepted means of disposal of diseased plant 

material. However, there is little or no information on the 

survival of bacterial pathogens following burial or burning of 

infected wood. The efficacy of burial and burning as means of 

safe disposal of diseased wood is being evaluated. This paper 

reports the survival of the pistachio dieback bacterium in buried 

wood to date. 


Infected pistachio wood was collected from the Waite Campus 

orchard in August 2008. Staining was assessed and the presence 

of X. translucens was confirmed by culturing on antibiotic 

benlate sucrose peptone agar (ABSPA, 1) and by polymerase 

chain reaction (PCR) using strain‐specific primers (2). 

Methods adapted from those described by Naseri et al. (3) were 

used. Plastic mesh bags containing pieces of infected wood or 

mulched pistachio wood (approx 20 g each) were buried 10 cm 

deep in pots filled with orchard soil or left on the soil surface. 

Pots were placed outdoors in August 2008 and retrieved 

monthly to assess survival of X. translucens. Upon retrieval, each 

piece of wood was cut into half. One half was surface‐sterilised 

and bacterial suspensions obtained by soaking in sterile distilled 

water overnight at room temperature. Suspensions were 

streaked on several culture media amended with various 

antibiotics and incubated at 28°C for 2–8 days. Suspensions 

prepared for culturing were also assayed by PCR using strainand 

species‐specific primers. 

The remaining wood samples were sliced into pieces (1–1.5 mm 

thick), surface sterilised and placed directly onto V8 juice agar 

amended with streptomycin for fungal isolation and nutrient 

agar (NA, Oxoid) amended with benlate for bacterial isolation. 

Plates were incubated at 25°C for 3–5 days, then bacteria and 

fungi were subcultured onto NA and PDA, respectively. To screen 

for antagonism, a suspension of X. translucens was spread on 

sucrose peptone agar plates an hour before applying to the 

centre of each plate a small amount of bacteria isolated from the 

wood. Plates were incubated at 28°C and observed for 3–7 days. 

RESULTS 

X. translucens was detected by PCR with species‐specific primers 

in most wood samples up to 7 months after burying in soil or 

placing on the soil surface. X. translucens was rarely detected by 

culturing, as plates were often over‐ 

selected as the optimal culture medium for subsequent isolation 

of X. translucens from buried wood. 

A number of bacteria isolated from wood, buried or left on the 

soil surface, produced clear inhibition zones and some prevented 

the growth of X. translucens. Fungi isolated from wood samples 

have been stored for future use. 

DISCUSSION 

Viable X. translucens has been detected in pistachio wood buried 

for 7 months. The burial experiment will continue, to examine if 

X. translucens can survive in buried infected wood for up to 2 

years. In comparison, X. campestris pv. campestris survived for 

507 days in cabbage stem residues buried in soil (4). 

Inhibition of the growth of X. translucens on agar by bacteria 

isolated from the wood may explain the difficulty in isolating X. 

translucens from wood. Antibiotic activity of these bacteria is 

being assessed. Another explanation for the difficulty in isolating 

X. translucens from the wood might be that X. translucens enters 

into the viable but non‐culturable (VBNC) state in response to 

the environmental conditions during burial. This possibility is 

being examined. 

Frequently isolated fungi will be assessed for their ability to 

decompose pistachio wood. 

A preliminary trial conducted in August 2008 to assess burning 

for disposal of diseased wood yielded no viable X. tranlucens 

from ash or wood buried 5 cm below the pit surface. However, 

eradication from debris which penetrates the floor of the pit 

may depend on that wood reaching the lethal temperature for 

the bacterium. Further experiments are planned for winter 2009 

to study the effect of heat and burning on survival of X. 

translucens. 

REFERENCES 

1. Facelli E, Taylor C, Scott ES, Fegan M, Huys G, Emmett R, Noble D, 

Sedgley M (2005) Identification of the causal agent of pistachio 

dieback in Australia. European Journal of Plant Pathology 112, 155– 

165. 

2. Marefat A, Ophel‐Keller K, Scott ES and Sedgley M (2006) The use 

of ARMS PCR in detection and identification of xanthomonads 

associated with pistachio dieback in Australia. European Journal of 


3. Naseri B, Davidson JA, Scott ES (2008) Survival of Leptosphaeria 

maculans and associated mycobiota on oilseed rape stubble buried 

in soil. Plant Pathology 57, 280–289. 

4. Schultz T, Gabrielson RL (1986) Xanthomonas campestris pv. 

campestris in Western Washington crucifer seed fields: occurrence 

and survival. Phytopathology 76, 1306–1309. 

grown by soil and/or wood microorganisms. However, X. 

translucens was isolated on NA amended with ampicillin, 

cephalexin and gentamycin from some wood and mulch samples 

after 8 months buried in soil. Nutrient agar with antibiotics was 


Posters 

92 The effect of dryland salinity on the diversity of arbuscular mycorrhizal fungi 

B.A. Wilson{ XE "Wilson, B.A." }, G.J. Ash and J.D.I. Harper 

EH Graham Centre for Agricultural Innovation (an alliance between New South Wales Department of Primary Industries and Charles Sturt 

University), Locked Bag 588, Wagga Wagga, 2678, NSW 

INTRODUCTION 

Dryland salinity is a significant environmental problem in 

Australia. The large‐scale removal of native vegetation and the 

sowing of shallow‐rooted pastures and crops is a major 

contributor to dryland salinity. Much of the research that aims to 

improve land productivity and maintain biodiversity focuses on 

above ground biomass. Less research has investigated the 

deleterious effects of dryland salinity on soil microorganisms 

such as arbuscular mycorrhizal fungi, considered essential for 

the establishment and growth of plants. The aim of study was to 

investigate the diversity of arbuscular mycorrhizal (AM) fungi 

from a saline agricultural field site using denaturing gradient gel 

electrophoresis (DGGE). 


Field site and sampling Soil sampling commenced after an 

electromagnetic survey (EM) of the saline field site and electrical 

conductivity (EC) testing of the soil was complete. The soil 

salinity ranged from non‐saline (1600 mS/m) based on plant salinity tolerance 

guidelines used in Western Australia (1). The paddock was 

divided into 24 plots from which soil cores (5 mm x 40 mm) were 

randomly taken. Soil was sampled in the summer and spring of 

2007. 

Trap cultures Soil removed from each of the 24 plots at both 

sampling times was used to set‐up trap cultures using several 

salt‐tolerant pasture and grass species. The purpose of the trap 

cultures is to provide conditions for maximum sporulation with 

the aim to increase diversity compared to that seen in field soil. 

Cultures were grown for 5 months before being assessed for 

sporulation. Sporulation was so poor for both sets of cultures 

that pots were re‐sown and grown for an additional 4 months. 

present and to provide a general picture of the diversity of AM 

fungi at a dryland salinity‐affected site. 

Figure 2. DGGE gel of summer field samples. Lane 1 (M) = ladder, S = 

slightly saline, N = non‐saline, V = very saline. One sample is represented 

by two lanes except for lane 1 (ladder) and lane 16. 

REFERENCES 

1. 

http://www.agric.wa.gov.au/content/LWE/SALIN/SMEAS/sali 

nity_units.htm 

2. Schwarzott, D and Schüßler, A (2001) A simple and reliable method 

for SSU rRNA gene DNA extraction, amplification, and cloning from 

single AM fungal spores. Mycorrhiza 10, 203–207 

3. Helgason et al (1998) Ploughing up the wood‐wide web. Nature 

394, 431 

4. Simon et al (1992) Specific amplification of the 18S fungal 

ribosomal genes from vesicular‐arbuscular endomycorrhizal fungi 

colonising roots. Applied Environmental Microbiology 58, 291–295. 

5. Kowalchuk et al (1997) Detection and characterisation of fungal 

infections of Ammophilia arenaria (Marram Grass) roots by 

denaturing gradient gel electrophoresis of specifically amplified 18S 

rDNA. Applied and Environmental Microbiology 63, 3858–3865. 

Spore extraction, DNA extraction and PCR‐DGGE Spores were 

extracted from 50 g soil sub‐samples (summer and spring field 

soil and trap culture soil) using wet sieving and sucrose 

centrifugation and DNA was extracted using the Powersoil DNA 

isolation kit (Mo Bio Laboratories Inc, USA). A nested PCR was 

used to amplify the partial small subunit gene 18S ribosomal 

DNA gene (550 bp). The first reaction employed the universal 

fungal primers GeoA2/Geo11 (2) and the second reaction used 

the fungal primer AM1 (3) and the universal eukaryotic primer 

NS31 (4) with an attached 5’ GC clamp on the NS31 primer 

(NS31‐GC) (5) for analysis with DGGE. Gels contained 7% (w/v) 

polyacrylamide (37:1 acrylamide/bis‐acrylamide) and the linear 

gradient was 30–50% denaturant. Gels were run at a constant 

temperature of 60 °C for 16 hrs at 70V using Bio‐rad’s Dcode 

Universal Mutation Detection System (Biorad, Australia). 


Preliminary results suggest that genetic diversity exists across 

the field site irrespective of salinity levels (compare N1‐7). It is 

hypothesised that salinity will reduce the genetic diversity of AM 

fungi at this field site, given that large salt scalds on the property 

have reduced vegetation cover. Further analysis is under way, 

which aims to reveal the diversity between soil samples across 

the salinity gradient on both a spatial and temporal scale. 

Cloning and sequencing will be used to identify the AM fungi 


18 Discovery of a Ceratocystis sp. associated with wilt disease of two native 

leguminous tree hosts in Oman and Pakistan 

Posters 

A.O. Al Adawi A,C* , I. Barnes B , A.A. Al Jahwari C , M.L. Deadman D , B.D. Wingfield B and M.J. Wingfield{ XE "Wingfield, M.J." } A 

A Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, 

Pretoria 0002, South Africa 

B Department of Genetics, FABI, University of Pretoria, Pretoria 0002, South Africa 

C Ghadafan Agriculture Research Station, Ministry of Agriculture, PO Box 204, Sohar, 311, Sultanate of Oman 

D Department of Crop Sciences, PO Box 34, Sultan Qaboos University, Al Khod 123, Sultanate of Oman 

INTRODUCTION 

Ceratocystis fimbriata Ellis and Halst sensu lato represents a well 

recognised group of cryptic species that cause serious canker 

stain and vascular wilt diseases on a wide range of mostly woody 

hosts. An epidemic wilt disease, devastating thousands of mango 

trees, has occurred in Oman and Pakistan since 1998 (1, 2). The 

pathogen causing the disease was identified as the new and 

cryptic species Ceratocystis manginecans M. van Wyk, A. Al 

Adawi and M.J. Wingf., based on morphology and DNA sequence 

comparisons (2). Recently, native Ghaf (Prosopis cineraria L. 

Druce) trees in Oman began to show symptoms of wilt similar to 

those displayed by mangos. Intriguingly, a similar wilt diseases 

has been observed on native Shisham (Dalbergia sissoo, Roxb.) 

trees in Pakistan. The objective of this study was to identify the 

pathogen causing the wilt disease of P. cineraria and D. sissoo in 

Oman and Pakistan. 


During 2004–2006, samples from P. cineraria trees showing 

recent wilting symptoms were collected from Wilayat Sohar in 

the northern region of the Sultanate of Oman. In May 2006, 

samples were collected from D. sissoo plantations in Fasilabad, 

Shorkot, Chenab negar and Multan, in Pakistan. Wood samples 

exhibiting vascular discolouration were placed in moist 

chambers and incubated at 25°C for 7 days. Wood samples were 

also placed between carrot slices (3) to bait for the possible 

presence of Ceratocystis spp. 

Morphological observations of the isolated fungi were made 

from cultures on 2% Malt Extract Agar (MEA) that had been 

incubated for 10 days at 25 ºC. The ITS regions of two isolates 

from each of the two host species were amplified and 

sequenced. Sequence data were compared to those in the 

Genbank database using a blast search 

(http://blast.ncbi.nlm.nih.gov/Blast.cgi). 

Two isolates (CMW17225 and CMW17570) of the Ceratocystis 

sp. isolated from P. cineraria in Oman were tested for 

pathogenicity. Five seedlings, approx 2‐yrs‐old, were inoculated 

with each isolate, 15 cm above soil level. Five control seedlings 

were wounded and inoculated with sterile MEA. Lesion lengths 

were measured after 42 days. 

RESULTS 

Symptoms on diseased P. cineraria and D. sissoo included 

streaked discolouration of the vascular tissue and rapid wilting 

of the foliage. Cultures produced on MEA resembled those of C. 

fimbriata s. l. based on the morphology and size of the 

perithecia, ascospores, conidia and conidiophores. Blast 

searches of the ITS sequences of two isolates from P. cineraria 

showed 100% similarity with C. manginecans, while the two 

isolates D. sissoo shared 98% similarity with that species. 

All the inoculated P. cineraria seedlings had vascular 

discolouration and 40% of the inoculated seedlings wilted and 

died after four weeks. Lesions produced by isolates CMW17225 

and CMW17570 were 105 and 131 mm long respectively, and 

significantly longer than those of the control treatments (5 mm). 

Lesion length (mm) 

160 

140 

120 

100 

80 

60 

40 

20 

0 

Pathogencity test 2006 

CMW17225 CMW17570 Control 

Isolate 

Figure 1. Mean lesion lengths on P. cineraria seedlings 42 days after of 

inoculation with two Ceratocystis isolates. 

DISCUSSION 

The results of this study have shown clearly that a Ceratocystis 

sp. is closely associated with the wilt disease of P. cineraria in 

Oman and D. sissoo in Pakistan. Based on ITS sequence data, this 

fungus is very similar, if not identical, to C. manginecans. 

Furthermore, pathogenicity tests have provided good evidence 

that the Ceratocystis sp. is the cause of the wilt disease of P. 

cineraria and most probably also D. sissoo trees in Oman and 

Pakistan. 

The relatedness of the pathogen of P. cineraria and D. sissoo to 

C. manginecans, which causes a devastating disease of Mango in 

Oman and Pakistan, is intriguing. It has been suggested 

previously that C. manginecans is most likely an introduced 

pathogen in Oman and Pakistan (2). It is thus possible that this 

pathogen has subsequently adapted the ability to infect and kill 

native trees in those countries. This question deserves further 

and urgent study. 


We thank members of the Tree Protection Co‐operative 

Programme (TPCP), University of Pretoria, South Africa, and the 

Ministry of Agriculture, Oman, for funding. We also thank the 

Nuclear Institute for Agriculture and Biology (NIAB) for 

facilitating surveys and shisham sample collection in Pakistan. 

REFERENCES 

1. Al Adawi AO, Deadman ML, Al Rawahi A, Al Maqbali YM, Al Jahwari 

AA, Al Saadi BA, Al Amri IS, Wingfield MJ (2006) Aetiology and 

causal agents of mango sudden decline disease in the Sultanate of 

Oman. European Journal of Plant Pathology 116, 247–254. 

2. Van Wyk M, Al Adawi AO, Khan IA, Deadman ML, Al Jahwari A, 

Wingfield BD, Ploetz RC, Wingfield MJ (2007) Ceratocystis 

manginecans sp. nov., causal disease of a destructive mango wilt 

disease in Oman and Pakistan. Fungal Diversity 27, 213–230. 

3. Moller WJ, DeVay JE (1968) Carrot as a species‐selective isolation 

medium for Ceratocystis fimbriata. Phytopathology 58, 123–124. 


Posters 

93 Evaluation of plant extracts for control of sclerotinia pathogens of vegetable crops 

D. Wite{ XE "Wite, D." } A , O. Villalta A and I.J. Porter A 

A Department of Primary Industries, 621 Burwood Hwy, Knoxfield, Victoria 3180 

INTRODUCTION 

Sclerotinia, caused by Sclerotinia sclerotiorum and S.minor, is 

one of the most damaging soilborne diseases of vegetable crops 

in Australia. These pathogens are difficult to control because 

they have a wide host range, survive in soil for many years as 

melanised sclerotia, and there are limited fungicide and genetic 

resistance options available. Beneficial management practices to 

reduce disease risk and IPM compatible control measures, 

suitable for on‐farm use, are both required to achieve 

sustainable control of Sclerotinia. Our research is therefore 

evaluating a range of new practices and control methods to 

improve the management of Sclerotinia in vegetable production. 

One potential control method is the use of plant extracts with 

antifungal volatile compounds. For instance, isothiocyanates 

(ITCs) released from cruciferous plant residues during hydrolysis 

of glucosinolates reduced the viability of S. sclerotiorum sclerotia 

(1) and unknown volatile compounds released from fennel oil 

inhibited mycelial growth of S. sclerotiorum (2). We report here 

on the efficacy of two mixtures of plant extracts and one 

essential oil on the viability of mycelium and sclerotia of S. 

sclerotiorum and S. minor. 

METHODS 

Treatments. Voom® (mustard and other essential oils, 15–20% 

allyl‐ITCs, Akhil), Dazitol® (mustard oil and capsaicanoids, 

unknown % ITCs, Champon) and bitter fennel oil (Foeniculum 

vulgare, Essential Oils of Tasmania) were tested at 

concentrations from 1–8% v/v. Fluke (20% allyl‐ITCs) was used 

for comparison as standard control in soil bioassay. 

In vitro tests. Mycelial plugs and sclerotia of S. sclerotiorum and 

S. minor isolates from bean and lettuce, respectively, were 

plated onto PDA amended with different concentrations of the 

treatments (contact diffusion). Inocula were also exposed to 

treatments using an inverted Petri dish assay (vapour phase). 

Plates were incubated for 7 days at room temperature and 

colony diameters recorded until growth reached the edge of the 

plates. Inocula that did not grow were transferred to 

unamended PDA to test whether the activity was fungicidal or 

merely fungistatic. 

Soil bioassay (sclerotia). Sclerotia in mesh bags (5/bag) were 

exposed to treatments (vapour phase) in non‐sterile sandy soil (1 

kg sealed pots) outdoors for 24 hrs (n = 3). After this period, 

sclerotia were surface sterilised and plated onto PDA to determine 

viability. 

PRELIMINARY RESULTS 

Effect on mycelial growth in vitro. All concentrations of Voom 

(1%, 3%, 5% v/v) were biocidal to mycelium of both Sclerotinia 

spp, irrespective of application method. Dazitol (4, 6 and 8% v/v) 

was biocidal to mycelium of both spp. when using the vapour 

phase method. Using the diffusion method, 6 and 8% were 

biocidal but 4% was only fungistatic. Fennel oil (2, 4 and 6% v/v) 

significantly suppressed mycelial growth of both pathogens. 

Effect on sclerotia viability in vitro. Voom (3% and 5% v/v) was 

biocidal to sclerotia of both pathogens (Table 1). At 1%, Voom 

was more effective in reducing the viability of sclerotia of S. 

sclerotiorum than S. minor. Dazitol (6% and 8% v/v) was biocidal 

to S. minor sclerotia and significantly reduced the viability of S. 

sclerotiorum sclerotia by 78–89%. Dazitol (4% v/v) also 

significantly reduced sclerotia viability by 78%. Fennel oil (2, 4 

and 6% v/v) had no effect on sclerotia viability. 

Table 1. Mean percentage reduction of sclerotia viability in vitro. 

Treatment (v/v) S. minor S. sclerotiorum 

untreated 0 a 0 a 

Voom 1% 11 b 100 c 

Voom 3% 100 d 100 c 

Voom 5% 100 d 100 c 

Dazitol 4% 78 c 78 b 

Dazitol 6% 100 d 78 b 

Dazitol 8% 100 d 89 b 

Means with the same letters are not significantly different (P6%) significantly reduced the viability of 

sclerotia of both spp. 

DISCUSSION 

The three products tested all released volatile compounds with 

antifungal activity against the two Sclerotinia species. Voom and 

Dazitol, tested at concentrations considered economic for 

disease control, were biocidal to inocula in vitro. In soil, 

however, Voom® (15–20% allyl‐ITCs) was more effective than 

Dazitol (unknown levels of ITCs) in reducing sclerotial viability of 

both pathogens. The standard treatment, Fluke, with similar 

levels of ITCs (20%) to that of Voom, caused total sclerotia 

mortality. Future studies will determine if differences in 

efficacies in soil were due to higher levels of ITCs released from 

Voom during the hydrolysis of glucosinolates. Further 

investigations to determine concentrations of ITCs required to 

achieve high levels of sclerotia mortality in soil are necessary to 

optimise biofumigant treatments such as plant extracts and 

biofumigant crops. Volatile compounds released from the low 

concentrations of fennel oil tested were only inhibitory to 

mycelial growth. Further studies of essential oils would be 

necessary to determine whether they have useful anti‐fungal 

compounds at concentrations that might be biocidal to 

Sclerotinia inoculum, and if so, to determine their mode of 

action. 


We thank Horticulture Australia Ltd and the Department of 

Primary Industries Victoria for financial support. 

REFERENCES 

1. Smolinska, U., Horbowicz, M. (1999). Journal of Phytopathology 

147, 119–124. 

2. Soylu S, Yigitbas H, Soylu EM, Kurt S (2007). Journal of Applied 

Microbiology 103, 1021–1030 


94 First report of Macrophominia phaseolina on rapeseed stem in some provinces 

of Iran 

Posters 

A. Zaman Mirabadi{ XE "Zaman Mirabadi, A." } A , A. Esmaailifar B , A. Alian C and R. M. Alamdalou A 

A Oilseed Research and Development Company, Applied Research Center in North of Country, Sari, Iran 

B Department of Plant Protection, Faculty of Agriculture and Natural Resources Islamic Azad University, Arak, Iran 

C The Central Plant Diagnostic Clinic, Babolsar, Iran 

INTRODUCTION 

Rapeseed (Brassica napus) is one of the most important 

oleaginous crops in different areas of Iran. Recently, in some 

cases, gray‐black lesions with few microsclerotia were observed 

on rapeseed stem. 


In August 2006, rapeseed basal stem and taproot samples were 

collected from Azarbayejan sharghi (As), Ardabil (Ar), 

Kermanshah (Ke), Khuzestan (Ku), Fars (F) and Hamadan (H) 

provinces in Iran. Small pieces (5 mm) of these tissues were 

surface sterilised with NaOCL(1%) for 1 min and then positioned 

in the center of plates containing potato dextrose agar (PDA). 

Plates were maintained at 25°c for 4 days in the dark condition. 

Average diameter of 200 microsclerotia was calculated for each 

isolate. 

RESULTS 

Grey‐black color mycelia with spherical and black microsclerotia 

observed after 5 days. Yielding fungal colonies identified as 

Macrophomina phaseolina (Tassi) Goidanich based on mycelia 

and size of the microsclerotia. Size of 6 isolates microsclerotia 

was estimated for different areas (five provinces), from 50 to 

180 µm in diameter. To our knowledge, this is the first report of 

M. phaseolina on rapeseed stem (cultivars: Okapi, Zarfam, Licord 

and Hyola401) in mentioned provinces of Iran. 

DISCUSSION 

Charcoal rot on canola has been reported from Argentina (2) 

with the presence of microsclerotia 71–94 µm in diameter and 

the United States (1). Average diameter of microsclerotia in Iran 

was consisted: Ku‐102(70–150) µm, As1‐ 96.7(60–150) µm, F‐ 

95(60–150) µm, Ke‐92.81(50–180) µm, Ar‐91.87(60–150) µm 

and As2‐ 87.03(60–180) µm. The highest and lowest size of 

sclerotia was related to warmest and coldest areas respectively. 

It seems to be diversity between Iranian isolates. 

REFERENCES 

1. Baird RE, Hershman DE, Christmas EP (1994) Occurrence of 

Macrophomina phaseolina on Canola in Indiana and Kentucky. 

Plant Disease, 78:316. 

2. Gaetán SA, Fernandez L, Madia M (2006) Occurrence of Charcoal 

Rot Caused by Macrophomina phaseolina on Canola in Argentina. 

Plant Disease, 90:524. 


Posters 

44 First report of rapeseed blackleg caused by pathogenicity group T (PGT) 

of Leptosphaeria maculans in Mazandaran province of Iran 

A. Zaman Mirabadi{ XE "Zaman Mirabadi, A." } A , K. Rahnama B , R.M. Alamdalou A and A. Esmaailifar C 

A Oilseeds Research and Development Company, Pasdaran Avenue, Sari, Iran 

B Department of Plant Protections, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran 

C Department of Plant Protections, Faculty of Agriculture and Natural Resources Islamic Azad University, Arak, Iran 

INTRODUCTION 

Rapeseed (Brassica napus L.) is cultivated in a large scale 

approximately, 20.000 ha in Mazandaran province in the north 

of Iran. Phoma blackleg (Leptosphaeria biglobosa), pathogenicity 

group 1 (PG‐1) or non‐aggressive type, has been reported on 

rapeseed from Golestan province (1). Recently, a typical 

symptom of rapeseed blackleg has been observed in the regions 

with a long history of cultivation (Dasht‐E‐ Naz). 


In September 2008, Ascospores of Leptosphaeria maculans was 

obtained from infected stubble residues of commercial 

Rapeseed Hybrid (Hyola 401)(2). These spores were cultured in 

V8 medium. Thirteen isolates of L.maculans were used for 

determining Pathogenicity groups (PG) according to the 

phenotypic interaction (PI) on 7‐day old rapeseed cultivars; 

Glacier, Westar and Quinta. After 10 days, disease severity was 

rated on a 0–9 scale (3). Wounded cotyledons were inoculated 

with 10µl of conidial suspensions at 2×10 7 spores per ml. All 

plants were maintained in a growth chamber at 21°C (light) to 

16°C (dark), with a 16‐h photoperiod and relative humidity of 

95%. The test was repeated three times. 


Special thanks to the Leibniz Institute of Plant Genetics and Crop 

Plant Research (IPK) for providing the seeds needed for this 

testing. 

REFERENCES 

1. Fernando WGD, Ghanbarnia K, Salati M (2007) First report on the 

presence of phoma blackleg pathogenicity group 1(Leptosphaeria 

biglobosa) on Brassica napus (canola/ rapeseed) in Iran. Plant 

disease, 91: 465. 

2. Mengistu A, Rimmer RS, Williams PH (1993) Protocols for in vitro 

sporulation, ascospore release, sexual mating, and fertility in 

crosses of Leptosphaeria maculans. Plant Disease 77, 538–540. 

3. Williams PH (1985) Crucifer Genetics Cooperatives (CrGC) Resource 

Book. University of Wisconsin, Madison, Wisc., 160pp. 

RESULTS 

Two isolates (Es‐3 and ES‐ 12) were classified as belonging PGT, 2 

(Es‐5 and ES‐7) as PG2 and 9 isolates as PG1. PGT isolates gave PI 

reactions 3 to 4, 7 to 9 and 7 to 9 on Glacier, Quinta and Westar, 

respectively. As our survey, this is the first report of the 

occurrence of Leptosphaeria maculans PGT in Iran(Figure 1). 

DISCUSSION 

In some regions in the north of IRAN, the leaf symptoms have 

been observed as circle lesions with chlorotic border and gray 

color in center, sometimes lesions separate from leaf. The spots 

on stems are more elongate and often surrounded by a purple or 

black border. With attention to high sensitivity of current 

cultivar of Mazandaran province (Hyola 401) to PG2 and PGT of 

L.maculans, It is possible that to be epidemic of blackleg disease 

in the case of suitable climatic condition, in future. 

Figure 1. Phenotypic interaction (PI) of Leptosphaeria maculans isolates 

on five rapeseed cultivars after 10 days. 


19 In vitro study on the effect of NanoSilver (Nanosid) on Sclerotinia sclerotiorum 

fungi the causal agent of rapeseed white stem rot 

Posters 

A. Zaman Mirabadi{ XE "Zaman Mirabadi, A." } A , K. Rahnama B , R. Mehdi Alamdarlou A and A. Esmaailifar c 

A Oilseeds Research and Development Company, Pasdaran Avenue Sari, Iran 

B Department of Plant Protection, Gorgan University of Agricultural Sciences and Natural Resources, Grgan, Iran 

c Department of Plant Protections, Faculty of Agriculture and Natural Resources Islamic Azad University, Arak, Iran 

INTRODUCTION 

White stem rot of rapeseed (Brassica napus L.) caused by 

Sclerotinia sclerotiorum (Lib.) de Bary is a serious disease in 

many areas in the world. This fungus attacks over 360 species 

of plants (2). It has been reported in Golestan and Mazandaran 

provinces in north of Iran (1). Chemical spraying is the simplest 

option for controlling sclerotinia disease in rapeseed fields 

however many surveys have been done for potential on 

bicontrol methods and new fungicide applications. 


In this study, the in vitro effectiveness of nanosilver different 

doses consist of 5, 10, 30, 50, 100,120, 130 and 150 ppm were 

tested against one isolate of S. sclerotiorum. Nanosid solution 

was incorporated into potato dextrose agar (PDA) medium, 

after autoclaving. Sclerotia of S. sclerotiorum were positioned 

in the center of Petri dishes containing PDA plus nanosid and 

were maintained in 25 centigrade. Fungal growth 

characteristics were determined after 8 and 14 days at all of 

the treatments. 

RESULTS 

After 8 days, there was no mycelia growth or sclerotia 

production in doses more than 10 ppm, while there was 

observed a significant difference between the mycelia growth 

of control (Sterile water), 5 and 10 ppm doses of nanosilver. 

Average per cent of inhabitation effect of nanosilver doses (8 

doses) and control treatment on sclerotia were estimated after 

14 days respectively 0, 25.33%, 48.17%, 53.33%, 56%, 56%, 

57.66%, 61% and also 0 for control (Table 1). After 14 days, a 

few numbers of new sclerotia were observed in doses of more 

than 10 ppm (2 to 4 sclerotia) in comparison white 5ppm and 

control (18–22 sclerotia). Obtained results showed that 

Nanosilver has fungistatic action and could be used for 

decreasing sclerotia production and mycelia growth (Fig.1) 

Table 1. Comparison of means for effect of Nanosilver doses on 

sclerotia of S.sclerotiorum after 8 and 14 days. 

Nanosilver(ppm) 

after8days 

Mean of square 

Control 75a z 75a z 

5 31.37b 75a 

10 16.75c 56b 

after14days 

30 0d 38.87c 

50 0d 35cd 

100 0d 33cd 

120 0d 33cd 

130 0d 31.75cd 

150 0d 29.25cd 

z Within columns, numbers fallowed by a common letter are not significantly 

different (P=0.05) according to Duncan’s multiple range test. 

DISCUSSION 

Practical Tests of Nanosid compounds will be done in field 

condition in future. 

REFERENCES 

1. Hossein B, Hamid Z, Gafar E, Abdoreza F (2001) Distribution of 

rapeseed white stem rot in Mazandaran. Proceedings of the 18th 

Iranian plant protection congress, 295p. 

2. Purdy, LH (1979) Sclerotinia sclerotiorum history, diseases and 

symptomatology, host range, geographic distribution, and impact. 

Phytopathology 69:875–880. 

Figure 1. Effect of Nanosilver doses on radial growth of S.sclerotiorum 

after 14 days: a) Control and 5ppm, b) 10 ppm, c)30 ppm and d)50ppm, 

after 8 days: e)100ppm, f)120 ppm, g)130 ppm and h)150 ppm. 


Posters 

20 Study on the effect of number of spraying with fungicides on rapeseed sclerotinia 

stem rot control 

R. Mehdi Alamdarlou A , A. Zaman Mirabadi{ XE "Zaman Mirabadi, A." } A , A. Esmaailifar B and K. Foroozan C 

A Applied Research Center in North of Country_Oilseeds Research and Development Company, Sari, Iran 

B Department of Plant Protection, Faculty of Agriculture and Natural Resources Islamic Azad University, Arak, Iran 

C Oilseeds Research and Development Company,Tehran, Iran 

INTRODUCTION 

Sclerotinia stem rot disease caused by Sclerotinia sclerotiorum 

(Lib.) de Bary fungus, is one of the rapeseed important diseases 

in the world and also in the north of Iran (1). Germination of 

fungus sclerotia produce apothecia on the soil and the 

ascospores that released from apothecia can infect rapeseed 

plants at the flowering stage. Spraying with fungicide in this 

stage protect the plant from infection. 


In order to study the effect of number of spraying with 

fungicides against rapeseed sclerotinia stem rot disease caused 

by S. sclerotiorum, an experiment was conducted in complete 

randomised block design with 3 replications and 7 treatments in 

Mazandaran province for two years (2006–2007). An infected 

field (with many sclerotia in the soil) was selected and the 

rapeseed hybrid Hyola401 planted in it. For disease control at 

the flowering stage of rapeseed one or twice spraying with 

fungicides carbendazim (WP60%) and tebuconazole (EC25%) was 

done. The first spraying was done at the 20%–30% of flowering 

stage and the second one 14 days after that. In both two years 

the period of fungi apothecia appearance and ascospores 

releasing had been started before spraying. The percentage of 

disease infection on leaves and stems was determined. The 

disease severity on the plants was scored from 1(lowest 

infection) to 9(highest infection) and determined in different 

treatments. 

DISCUSSION 

Chemical control of rapeseed sclerotinia stem rot is an effective 

method in the north of Iran. Depending on the weather 

condition and field growth, one or twice fungicide application is 

needed. For best disease control we recommend the disease 

managing by integration of different methods like mechanical, 

agronomical, biological and chemical. 

REFERENCES 

1. Hossein B, Hamid Z, Gafar E, Abdoreza F (2001) Distribution of 

rapeseed white stem rot in Mazandaran. Proceedings of the 18th 

Iranian plant protection congress, 295p. 

2. Saharan GS, Mehta N (2008) Sclerotinia disease of crop plants: 

biology, ecology and disease management, Springer science, 

531pp. 

3. Thomson JR, Thomas PM, Evans JR (1984) Efficacy of aerial 

application of benomyl and iprodione for the control of sclerotinia 

stem rot of canola (rapeseed) in central Alberta, Canadian journal 

of plant pathology, 6:75–77. 

RESULTS 

Results of variances analysis and comparison between 

treatments means by Duncan’s test indicated that in first year 

sprayed treatments compared to control had lower infection and 

higher yield, but there were not significant differences between 

one and twice sprayed treatments. In second year and two years 

combined analysis, control had highest infection and lowest yield 

and twice sprayed treatments had lowest infection and highest 

yield. 

Table1. Comparison of leaf and stem infection percentage, disease 

severity and yield between different treatments in two years. 

Treatments 

%leaf 

infection 

%stem 

infection 

Disease 

severity 

Yield Kg/ha 

S 55a Z 49a Z 6.6a Z 3208d Z 

C 15bc 11bc 3.2c 3793bc 

CC 3.5d 0.5d 0.7f 4020a 

F 21b 15b 4.1b 3720c 

FF 8.5cd 5.5cd 2.4d 3975a 

FC 4d 1d 0.7f 4003a 

CF 7.5cd 3.5d 1.6e 3921ab 

Control(S), Carbendazim(C), Twice carbendazim (CC), folicur(F), Twice folicur (FF), 

Folicur at first and carbendazim at second application(FC), Carbendazim at first and 

folicur at second application (CF) 

z Within columns, numbers fallowed by a common letter are not significantly 

different (P=0.01) according to Duncan’s multiple range test. 


98 The biology and management of chestnut rot in south‐eastern Australia 

L. Shuttleworth{ XE "Shuttleworth, L" }, D. Guest, E. Liew 

A University of Sydney. Room 403, Level 4 McMillan Building NSW 2006 

Posters 

INTRODUCTION 

The Australian chestnut industry is currently small, but has 

potential to expand due to increasing local and export demand. 

The European chestnut, Castanea sativa is the main species 

grown in Australia today. Internal rot of chestnuts is a significant 

problem facing the industry and is what this study will be 

investigating. Internal rot affects the kernel, manifesting in light, 

medium and/or dark brown lesions occurring on the endosperm, 

and embryo. It is often not visible externally and is only realised 

when the nut is opened. The incidence of chestnut rot at 

Melbourne markets has been recorded as high as 40% (1). 

Consumer rejection of the chestnuts is highly likely with rot 

incidence at these levels. Without an appropriate control 

strategy, the Australian chestnut industry is unlikely to grow. 

The main cause of chestnut rot is reported to be endophytic, 

caused by the fungal Ascomycete Phomopsis castanea (Sacc.) 

Höhn (1,3). Research also shows that infection by ascospores 

during flowering is a mode of infection (2). 

The aims of this study are to survey the incidence of chestnut rot 

in south eastern Australia, New South Wales (NSW) and Victoria 

(VIC), identify the pathogen responsible for causing chestnut rot, 

and to study the disease cycle. 


Field and market surveys. A hierarchical sampling strategy was 

used. Twenty two orchards were sampled across VIC and NSW. 

Orchards were classed into 6 regions based on geographical 

distance i.e. 100km proximity (see fig 1 for orchard locations). 

Four commercial varieties were assessed for rot incidence: 

Buffalo Queen, Red Spanish, Purton’s Pride, and Decoppi 

Marone (300 nuts/orchard). Nuts were dissected and visually 

assessed for rot. 

Flemington Markets in NSW were also sampled for chestnut rot. 

Nuts sourced from 5 orchards were sampled, 300 nuts/orchard. 

Decoppi Marone was surveyed from 2 orchards and Purton’s 

Pride from 3 orchards. 

Pathogen identification. Diseased chestnuts from 12 of the 

surveyed farms in VIC and NSW had the pathogen isolated from 

them using standard isolating protocols (1, 3). The pathogen was 

then identified morphologically. 

Observation of the teleomorph was completed through 

microscopic observation of 30 decaying burrs from an orchard in 

Mullion Creek, NSW. 

Endophyte studies. Samples were collected from healthy floral 

and vegetative tissues at Mullion Creek NSW. Seventy‐five 

samples per tissue type were tested. 


Field Survey 

Figure 1. Incidence of chestnut rot from nuts sampled field survey across 

6 regions in NSW and VIC. Total number of nuts in survey =6600. 

Disease incidence of chestnuts tested from Flemington markets, 

NSW was found to be ≤10% for all orchards and varieties tested. 

This value is within the acceptable level of rot set by the 

Australian chestnut industry. 

Pathogen identification. Of the 568 isolates obtained, 62% of 

were identified as Phomopsis.castanea. The teleomorph of 

Diaporthe castaneti Nitschke. was observed growing on decaying 

burr tissue. This indicates that aerosols of ascospores are a 

source of infection in the disease cycle. 

Endophyte studies. Tissues displaying the highest rates of 

pathogen isolation include female flowers (82%), male flowers 

(59%), pedicel (28%), leaf margin (33%), and 1 st year growth 

(17%). Low isolation levels were recorded in petioles (9%), and 

leaf mid veins (9%), second year stems (8%), and third and 

fourth year bark (3%). The pathogen was not recorded in third 

and fourth year xylem tissue, indicating pathogen travel via 

xylem tissue is not significant and likely not systemic. 

CONCLUSION 

Disease incidence varies greatly between regions. This is likely 

due to factors including regional and micro‐climates, rainfall 

during flowering, the susceptibility of host variety to the 

pathogen, and the virulence of the pathogen. 

REFERENCES 

1. Anderson CR (1993) A study of Phomopsis castanea (Sacc.) Höhn, 

and post harvest decay of chestnuts. Thesis. University of 

Melbourne. 

2. Smith HC The life cycle, pathology and taxonomy of two different 

nut rot fungi in chestnut. Australian Nutgrower. 22:2, 10‐15. 

3. Washington WS, Stewart‐Wade S, Hood, V (1999) Phomopsis 

castanea, a seed‐borne endophyte in chestnut trees. Australian 

Journal of Botany. 47, 77‐84. 


Index 

Abkhoo, J................................ 128, 129, 130 

Aftab, M. ................................................131 

Agarwal, A. ...............................................65 

Akem, C. ...................................................50 

Akem, C.N....................................... 132, 133 

Akinsanmi, O.A. .......................................22 

Alhudaib, K. ............................................134 

Amponsah, N.T.........................................70 

Anderson, J.M...........................................54 

Auer, D.P.F................................................58 

Auyong, A.S.M. .......................................135 

Baskarathevan, J.......................................52 

Beever, R.E. ..............................................77 

Beresford, R.M. ........................................44 

Bhuiyan, S.A........................................47, 61 

Billones, R.G. ......................................69, 79 

Bleach, C.M. ...........................................104 

Blomley, C....................................... 114, 136 

Borines, L.M. ..........................................137 

Boyd‐Wilson, K.S.H. ................................138 

Braithwaite, M........................................103 

Brett, R.W.................................................29 

Burgess, L.W...........................................120 

Burgess, T.I. .............................. 37, 111, 139 

Burgess. L.W.............................................42 

Cahill, D.M................................................83 

Casonato, S.G. ..........................................99 

Chomic, A. ................................................31 

Christ, B. .................................................122 

Cobon, J.A...............................................140 

Collins, S.J.........................................27, 141 

Dann, E.K. ...............................................142 

Davidson, J.A. .........................................143 

Davies, P.A.B................................... 108, 144 

Davis, R.I.................................................109 

Dean, J.R.................................................145 

Deland, L...................................................88 

Donald, E.C. ..............................................68 

Donovan, N.J. .........................................146 

Dore, D.S. .................................................71 

Drenth, A. .................................................21 

Edwards, J.................................................24 

Erwin, E.....................................................38 

Evans, K.J. .................................................46 

Everett, K.R...............................................45 

Fahim, M. .................................................66 

Falloon, R.E..................................... 147, 148 

Ferguson, K.L. ...........................................89 

Ford, R. .....................................................82 

Forsyth, L.M............................................150 

Fullerton, R.A..........................................151 

Gambley, C. ............................................152 

Ge, Y. ......................................................153 

Glen, M................................... 154, 155, 156 

Golzar, H...........................................41, 157 

Gouk, C. ..................................................158 

Gouk, S.C. .................................................90 

Greer, L.A................................................159 

Haghighi, S..............................................160 

Hall, B.H.................................. 161, 162, 163 

Hardham, A.R. ..........................................64 

Hidayat, S.H. .............................................49 

Hill, G.N. ...................................................57 

Hodda, M................................................100 

Hohmann, P............................................102 

Huang, R. ................................................164 

Hüberli, D..................................................85 

Jackson, S.L.............................................165 

Jayasena, K.W......................... 166, 167, 168 

Johnson, G.I. .............................................20 

Keane, P.J. ................................................91 

Ketabchi, S..............................................169 

Khanam, N.N...........................................170 

Knight, N.L. .............................................106 

Kueh, K.H. ...............................................171 

Kumari, S.G. ..............................................33 

Lehmensiek, A. .......................................172 

Linde, C.C..................................................51 

Lomavatu, M.F........................................173 

Lovelock, D. ............................................174 

Luck, J.E. .................................................118 

MacDiarmid, R.M......................................32 

Magarey, P.A. .............................59, 78, 175 

Magarey, R.C. .....................................56, 98 

Malligan, C.D. ...................................96, 176 

Mannan, S.........................................80, 177 

Maora, J.Y.S. .............................................55 

McMahon, P.J...........................................23 

Meldrum, R.A. ........................................179 

Miles, A.K........................................180, 181 

Minchinton, E.J. ........................................60 

Mintoff, S.J.L...........................................182 

Moran, J.R.................................................26 

Morin, L. ................................. 115, 183, 184 

Mundy, D.C...............................................86 

Namaliu, Y. ...............................................63 

Nambiar, L. .............................................185 

Newby, Z.J. .............................................186 

Oliver, J.E. ...............................................112 

Panjehkeh, N. .........................................189 

Park, E.W. ...............................................117 

Paul, P.K..................................................113 

Pederick, S.J............................................190 

Pegg, G.S...................................................35 

Perez‐Egusquiza, Z.C...............................191 

Peterson, S.A. .........................................110 

Petkowski, J.E. ....................................... 192 

Petrisko, J.E.............................................. 84 

Phillips, D. ................................................ 67 

Pitt, W.M. .............................................. 193 

Porter, I.............................................28, 121 

Probst, C.M. ............................................. 25 

Ramroodi, S. .......................................... 194 

Randles, J.W........................................... 195 

Ray, J.D. ................................................. 196 

Reen, R.A. .............................................. 197 

Rees‐George, J. ...................................... 198 

Romberg, M.K........................................ 199 

Sakalidis, M.L. .......................................... 36 

Salam, M.................................................. 75 

Salam, M.U. ......................................74, 119 

Salowi, A. ............................................... 200 

Sapak, Z.................................................. 201 

Scarlett, K............................................... 202 

Scoble, C.A. ............................................ 116 

Scott, E.S.........................................203, 204 

Sdoodee, R............................................... 76 

Seem, R.................................................... 92 

Shirazi, M............................................... 205 

Shuttleworth, L ...................................... 227 

Simpfendorfer, S...............................95, 206 

Singh, A.................................................. 207 

Smith, L.J................................................ 208 

Sosnowski, M.R.................................97, 209 

Steele, V................................................. 210 

Stewart, A. ............................................. 101 

Stewart‐Wade, S.M................................ 211 

Sutherland, M.W.................................... 105 

Sutton, T.B. .............................................. 43 

Taylor, P.W.J. ........................................... 53 

Tesoriero, L.A........................................... 40 

Thompson, J.P................. 212, 213, 214, 215 

Thompson, N. ........................................ 216 

Trivedi, R.S. .......................................73, 217 

Truong, N.V.....................................187, 188 

Turaganivalu, U...................................... 218 

Vanneste, J.L............................................ 87 

Viljanen‐Rollinson, S.L.H. ....................... 107 

Vu Thanh, T.A. ....................................... 219 

Walter, M............................................48, 62 

Wellings, C.R. ......................................93, 94 

Wiechel, T.J.........................................30, 39 

Wilson, B.A. ........................................... 220 

Wingfield, M.J...................................34, 221 

Wite, D................................................... 222 

Wunderlich, N.......................................... 72 

Zaman Mirabadi, A. ........ 223, 224, 225, 226

View PDF - Australasian Plant Pathology Society

Create successful ePaper yourself

Delete template?

Save as template?