Next Article in Journal
Characteristics of Progenies Derived from Bidirectional Avena sativa L. and Avena fatua L. Crosses
Previous Article in Journal
Comparison Study on Wild and Cultivated Opuntia sp.: Chemical, Taxonomic, and Antioxidant Evaluations
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 12
Issue 11
10.3390/agriculture12111756
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia

by
Yasser Abobakr
1,2,*,
Ali S. Al-Sarar
1,
Ali A. Alzabib
1 and
Amgad A. Saleh
1,3
1
Department of Plant Protection, College of Food and Agriculture Sciences, King Saud University, Riyadh 11451, Saudi Arabia
2
Department of Animal Pests, Plant Protection Research Institute (PPRI), Agricultural Research Center (ARC), Alexandria 21616, Egypt
3
Agricultural Genetic Engineering Research Institute (AGERI), Agriculture Research Center (ARC), Giza 12619, Egypt
*
Author to whom correspondence should be addressed.
Agriculture 2022, 12(11), 1756; https://doi.org/10.3390/agriculture12111756
Submission received: 2 September 2022 / Revised: 8 October 2022 / Accepted: 22 October 2022 / Published: 24 October 2022
(This article belongs to the Section Crop Protection, Diseases, Pests and Weeds)
Browse Figures
Versions Notes

Abstract

:
Many terrestrial gastropod species have been dispersed as a result of anthropogenic activities and have adapted to new habitats where they are considered as alien or invasive species. Several synanthropic gastropods are invasive in urban and agricultural environments worldwide. In Saudi Arabia, increased human activities have accelerated the introduction of terrestrial gastropod species, increasing the need to study its gastropod fauna. Our preliminary survey disclosed the presence of ariophantid snails in a number of agricultural nurseries. Based on morphological features of shell, body, and reproductive system, we report the first record of Macrochlamys indica from Saudi Arabia. The phylogenetic analysis obtained from DNA sequences of the mitochondrial COI and 16S regions confirmed the identity of M. indica. One third of the investigated nurseries were infested with this snail, however, we did not find any specimens of M. indica in natural habitats or open agricultural fields. The snail-infested nurseries were distributed all over Saudi Arabia. The occurrence of one haplotype of partial mitochondrial COI sequence from these nurseries suggests that the introduction of M. indica is likely very recent. Based on the obtained results, it is recommended that control measurements must be implemented in order to eradicate or at least restrict the dissemination of M. indica from nurseries to natural habitats or agricultural fields.

Graphical Abstract

1. Introduction

Mollusks are the second largest phylum and one of the most important groups of the animals on earth, forming a major part of the world fauna. Gastropoda is the most diverse class of the phylum Mollusca, both in habit and shape [1]. Around 35,000 terrestrial gastropod species (snails and slugs) are recognized with an expected 11,000 to 40,000 cryptic species needing to be well identified and characterized [1,2]. Moreover, gastropods have successfully conquered the land and been able to inhabit terrestrial extreme environments, such as deserts, and arctic and alpine habitats [3,4,5].
Dozens of terrestrial mollusk taxa have been widely dispersed as a result of anthropogenic activities and have adapted to new habitats where they are considered as exotic species [6,7]. Synanthropic gastropods are among these ‘traveling species’ and are invasive in urban and agricultural environments worldwide [8]. Accordingly, very distant regions may have similar terrestrial mollusk fauna of exotic species [8,9]. In Saudi Arabia, as in several other countries, increased human activities have accelerated the introduction of mollusk species, demanding the need to study its mollusk fauna. Moreover, the terrestrial gastropod fauna of Saudi Arabia and its importance for agricultural and environmental issues has been largely ignored throughout the history of malacological studies.
Herbivorous terrestrial gastropods are important agricultural pests worldwide. They are causing economic damage to many agricultural crops, including vegetables, fruit trees, field crops, ornamentals, and medicinal plants [10,11]. By virtue of their abundance and biomass, they deposit considerable amounts of mucus and fecal materials on the infested crops decreasing their value and quality. They make wounds in plants facilitating the entrance of pathogenic microbes to plants [12,13]. Furthermore, numerous land gastropod species are intermediate hosts for parasites and pathogens posing a health risk to both livestock and humans [14]. Many gastropod species have been shown to be highly invasive and disruptive in zones of conservation attention [15].
Macrochlamys Gray, 1847 is a potentially invasive genus and includes more than 100 species extensively distributed in India and Southeast Asia [16,17,18,19]. Ueshima [20] suggested that Macrochlamys may have been introduced from Southeast Asia and distributed through horticulture in Japan. One of the most common Macrochlamys species is M. indica Godwin-Austen, 1883 which is native to India [16,21]. The horn tail snail M. indica is a voracious plant eater and able to totally devour young seedlings [22]. It is a widespread pest in vegetables and ornamental plants in India and Bangladesh [17,23,24]. In the USA, M. indica is listed as one of the quarantine plant pests posing a paramount danger to agriculture [25]. Singh et al. [22] reported the occurrence of M. indica on citrus and guava nursery plants in Punjab, India, feeding on tender and succulent plant leaves and stems. In the forest nurseries of Rajasthan, India, M. indica has been described as a serious pest of neem (Azadirachta indica) causing 10–65% mortality to neem seedlings [26,27]. Our preliminary survey in this study disclosed the presence of ariophantid snails in different regions of Saudi Arabia. Therefore, we aimed to collect more snail specimens to confirm their identity using morphological and molecular data, as well as explore their habitats in different regions of Saudi Arabia.

2. Materials and Methods

2.1. Sampling and Morphological Characterization

Snail samples were collected by direct visual searching and hand picking from several sites throughout Saudi Arabia including Abha, Al-Ahsaa, Al-Madinah, Al-Qassim, Jazan, Riyadh, Tabouk, and Taif regions from 2020 to 2021. The survey included nurseries, gardens, parks, agricultural fields, and natural habitats. The coordinates of collection sites were recorded using GPS (GPSmap 64S model) as shown in Table 1. The distribution map was generated using ArcGIS v.10.3. The shells and living snails were photographed using a Canon 70D DSLR camera. Individual images were stacked via HeliconFocus v6.22 software and calibrated scale bars (mm) were added using Adobe Photoshop CS5. Most of the collected specimens were hand-picked from beneath plant pots and leaf litters as well as from plant leaves. The following shell morphological measurements were taken using vernier caliper (Raider Pro, RD VC500): shell height (SH), shell width (SW), aperture height (AH), aperture width (AW), height of spire (HSP), and height of the body whorl (HBW) as shown in Figure 1 [28]. In addition, the number of whorls of the shell were counted.

2.2. Morpho-Anatomy of the Reproductive System

Twenty live specimens were euthanized [29]. Afterwards, the specimens were preserved in 70% ethanol. The specimens were dissected and the pattern of reproductive system morphology were characterized under a Labomed® Luxeo 6z stereo microscope and photographed using a Labomed® Vega 6MP microscope digital camera (Labo America, Inc., Fremont, CA, USA). The terminology of the reproductive organs was used according to Roy [30].

2.3. Molecular Characterization

Genomic DNA was extracted from 24 snail specimens preserved in 95% ethanol, using QIAamp® DNA Mini kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol. Approximately 10 mg of foot tissue was used for DNA extraction. DNA quantity and quality were checked by NanoDrop 2000/2000c spectrophotometer (Thermo Scientific™, Waltham, MA, USA) and 1% agarose gels in 1× TBE buffer, stained with 1 µg/mL acridine orange and visualized under the Gel Documentation In Genius system, (Syngene, Cambridge, UK). DNA concentrations were adjusted to 10 ng/µL for further molecular work.
Two mitochondrial regions were PCR-amplified: cytochrome c oxidase subunit 1 (COI) and ribosomal 16S (16S) subunit using the primer-pairs LCO1490/HCO2198 and 16SarF/16SbrR, respectively (Table 2) [31,32]. PCR reactions were performed in 30 µL volume containing 15 µL 5× Promega Master Mix (Promega Corporation, Madison, WI, USA), 0.5 µM of each forward and reverse primers, 3 µL 10 ng/µL DNA, and appropriate volume of molecular biology grade water. The optimum annealing temperatures for COI and 16S primer-pairs were initially determined by gradient PCR using DNA samples of two different snails. The PCR conditions were as follows: an initial denaturation step at 94 °C for 5 min, followed by 35 cycles of a denaturation step at 94 °C for 30 s, an annealing step at 40–58 °C for 30 s and an extension step at 72 °C for 1 min, then a final extension step at 72 °C for 5 min in the Mastercycler® nexus gradient PCR machine (Eppendorf AG, Hamburg, Germany). After determining the optimum annealing temperature for COI and 16S primer-pairs, PCR reactions were performed in a final volume of 30 μL as described in Table 2. The PCR products were analyzed and visualized using 1% agarose gels as previously mentioned.
The PCR products of COI and 16S markers were directly sequenced using the same primers used for PCR amplification at Macrogen sequencing facility (Macrogen, Seoul, Korea). Raw DNA sequences were edited and annotated using the BioEdit v7.0.9.0 [33]. Cleaned sequences obtained from Saudi specimens were searched against the NCBI-GenBank database using BLAST algorithm (http://www.ncbi.nlm.nih.gov accessed on 5 March 2022) for identifying their counterpart’s homologous sequences. Based on the sequence homology, the Saudi specimens were recognized to the species level. The pairwise p-distances of COI sequences among different snail species were calculated by using MEGA-X version 10.1.7 [34]. Phylogenetic trees were also constructed using MEGA-X. The evolutionary history was inferred by using the Maximum Likelihood method based on Kimura 2-parameter model [35]. Phylogenetic tree branches were supported with bootstrap values using 1000 replicates.

3. Results

3.1. Distribution of M. indica in Saudi Arabia

The conducted survey revealed that M. indica is found only in plant nurseries and distributed in nearly all Saudi provinces: Tabouk in the north, Al-Ahsaa in the east, Taif and Al-Madinah in the west, Jazan and Abha in the south, and Riyadh and Al-Qassim in the middle region (Figure 2). Moreover, M. indica was found at different altitudes ranging from 140 to 2150 m above the sea level. We collected 110 specimens from all surveyed nurseries.

3.2. Systematics

  • Class Gastropoda Cuvier, 1795
  • Order Stylommatophora A. Schmidt, 1855
  • Superfamily Helicarionoidea Bourguignat, 1877
  • Family Ariophantidae Godwin-Austen, 1883
  • Subfamily Macrochlamydinae Godwin-Austen, 1883
  • Genus Macrochlamys Gray, 1847
  • Macrochlamys indica Godwin-Austen, 1883
Materials examined: SAUDI ARABIA: Tabouk: Al-Yosuf nursery, 29.X.2020, Magic Rose nursery, 6.VI.2021; Jazan: Alam Domiat nursery, 28.XI.2020; Riyadh: Al-Hair nursery, Nursery 10, 11.IV.2021, Al-Habry Nursery, 5.II.2022; Taif: Bostan Al-Zohor nursery, Rose City nursery, Wardet Al-Soltan nursery, 2.X.2021; Al-Ahsaa: My Garden nursery, 4.XI.2021; Abha: Abeer Alworod nursery, 2.III.2022; Al-Madinah: Al-Wafy nursery, 30.III.2022; Al-Qassim: Al-Fatah nursery, 13.V.2022; coll. Yasser Abobakr, Ali Al-Sarar, Ali Alzabib (King Saud University).

3.3. Morphological Description

Shell characters: medium (width up to 17.32 mm; height up to 9.76 mm), depressed, dextral, slightly convex above, pale brownish, translucent, thin but not brittle, surface shiny and smooth with fine growth lines; spire conoid, little raised; suture somewhat impressed; aperture widely lunate and a bit oblique; peristome thin; columellar edge thickened to some extent, oblique, curved, and slightly reflected above the narrowly open umbilicus, number of whorls five to six; the last whorl rounded at the periphery (Figure 3; Table 3).
Body features: sole tripartite; skin is reticulated and pale to dark gray, becoming lighter near foot sole and darker at the head and eye stalks; caudal horn raised and caudal foss large; mantle lobes dark gray and well developed, dorsal lobes large and broad while shell lobes large and long. Animals secrete yellowish-green mucus when bothered (Figure 4).
Genital organs: the genital opening is on the right side of the head. The genital atrium (at) is a muscular structure elongated to some extent and is wider than the vagina (v) (Figure 5A). The vagina is found between the dart apparatus and the complex of the penial sheath. It opens into the genital atrium and hence the genital opening. The penis (p) is a muscular prolonged structure enclosed by a semi-transparent sheath (Figure 5A,E). The epiphallus (e) is a slender structure longer than the penis. The epiphallus has three distinguished parts; the proximal epiphallus (pe), epiphallic caecum (ec), and distal epiphallus (de) (Figure 5A,D). The epiphallic caecum (ec) is a small circular sac. It is coiled for about two circles, located at one third the length of the epiphallus and attached with the penial retractor muscle (prm) (Figure 5A,D). The vas deferens (vd) is a narrow, long, tubular structure connected between the free oviduct and distal end of epiphallus (Figure 5C). The flagellum (fl) is also long and slender (Figure 5B,D). Its free distal end is slightly less in diameter than that of the proximal end. The free oviduct (fo) is a tubular structure that is extended proximally to vagina (Figure 5A).
A muscular brownish tissue which developed at the junction of the gametolytic organ, vagina, and free oviduct is termed the vaginoviducal capsule (vo) (Figure 5A,C). The spermoviduct is a structure consisting of a folded oviducal channel (ov) and prostate gland (pr) (Figure 5B,C). The oviducal channel comprises a pile of plate-like lamellae which are arranged against the prostate gland. The albumen gland (ag) is a creamy white, moderately elongated tongue-shaped structure near the concave surface of the digestive gland (Figure 5A,F). The hermaphrodite duct (hd) is a convoluted tubular creamy white structure that joins the ovotestis to the spermoviduct (Figure 5F). The gametolytic organ is an elongated, tubular structure comprised of a gametolytic duct (gd) and a cylindrical gametolytic sac (gs) (Figure 5A). The dart apparatus is a well-developed, elongated, whitish, and S-shaped tubular structure, and opens into the genital atrium. It consists of dart bag (db), dart neck (dn), median dart shaft (mds), and dart retractor muscle (drm) (Figure 5A,B).

3.4. Molecular Characterization

To confirm the identity of M. indica, two fragments of COI and 16S mitochondrial genes were amplified and sequenced from 24 snail samples representing ten populations collected from agricultural nurseries in different locations/regions of Saudi Arabia.

3.4.1. COI

After removing the LCO1490 and HC02198 primers, the size of the amplified COI fragment generated from 24 M. indica snails was 655 bp and represented one haplotype. The 24 COI sequences were deposited in NCBI-GenBank under the accession numbers OK559629–OK559642 and ON469564–ON469573 (Table 1). When the Saudi COI haplotype of M. indica was searched against NCBI-GenBank, six sequences (accession numbers: MH819411, MH819412, EF015438, MT803095, LC365425, and MF476193) showed ˃99% nucleotide sequence identity with the Saudi COI sequence. These six sequences were recovered from different countries, namely India (accession numbers: MH819411, MH819412, and MF476193), Thailand (accession number: MT803095), Japan (accession number: LC365425), and Australia (accession number: EF015438). Five accession numbers were identified as either Macrochlamys sp. (Japan and Australia) or M. indica (India), whereas the sixth one was identified as Sarika sp. (Thailand). The alignment of these COI homologous sequences with the Saudi COI haplotype showed six synonymous single nucleotide polymorphisms (SNPs), with no change in their translated amino acid sequence (Figure 6). The detected synonymous SNPs resulted from either C/T or A/G transitions. We suggest that all the SNPs detected in MF476193 are not real and, most probably, they are artifacts because all of them are G nucleotides and upon their translation, they produced amino acids different from their closely related taxa (Figure 6). For MT803095 identified as Sarika, we suggest that it is misidentified and it needs to be revised. The phylogenetic analysis confirmed the identity of the Saudi snails as M. indica where the Maximum Likelihood tree branch, containing its COI sequence along with its homologous ones, received 100% bootstrap value (Figure 7). The very low values (range 0–0.2%, excluding MF476193) of pairwise p-distances of COI sequences also confirmed the identity of M. indica from different countries (Table 4). However, the pairwise p-distances of COI between M. indica and other snail species were generally above 12%, supporting the uniqueness of M. indica.

3.4.2. 16S

The amplified 16S fragment was 415 bp, excluding the 16SarF and 16SbrR primers, generated from the Saudi M. indica snails. As in the case of COI, no SNPs were detected in 16S fragments. When the Saudi 16S haplotype of M. indica was searched against the NCBI-GenBank, three homologous sequences were 100% identical with the Saudi haplotype. The accession numbers of these three sequences were LC365393 (Macrochlamys sp., Japan), MT741772 (Sarika sp., Thailand), and MW685665 (Sarika bocourti, Bangladesh). Based on the morphology description and COI data, 16S sequences of Macrochlamys recovered from Saudi Arabia were deposited in NCBI-GenBank as M. indica under the accession numbers OK559644–OK559657 and ON468668–ON468677 (Table 1).

4. Discussion

In the present study, we have reported, for the first time, the occurrence of M. indica in Saudi Arabia. In our survey, we did not find any specimens of M. indica in natural habitats or open agricultural fields, however, it was found in many plant nurseries. One third of the investigated nurseries were infested with this snail. The snail-infested nurseries were distributed all over Saudi Arabia. El-Alfy et al. [36] reported the occurrence of M. indica in the State of Qatar in the Arabian Peninsula. They collected this snail from different ornamental nurseries in Doha city and they thought that the snail was introduced from India with ornamental plants. This Indo-Asian ariophantid snail is native to Bangladesh, India, and Nepal [13,18,22,37,38,39,40]. It is proposed to be introduced to the Andaman Islands and Sri Lanka [16,39], Pakistan [41], Peninsular Malaysia [42], and Sabah and adjacent islands [43]. Recently, Agudo-Padrón and Luz [44] and Kudo et al. [19] reported the occurrence M. indica as an alien species in southern Brazil and Japan, respectively. Macrochlamys indica is apparently an invasive species adversely affecting natural ecosystems and human health [45]. Nandy et al. [46] reported that M. indica was linked with several habitats in India, and strong interaction was with tree trunks and leaves. Collectively, it is very probable that M. indica was introduced to Saudi Arabia through importing ornamental plants from its native regions.
The type species of Macrochlamys was, for a long time, identified as Helix vitrinoides Deshayes, 1831, from an unknown locality. The name M. indica and the complete description of this species was given by Godwin-Austen [47]. The shell and body morphological characters of M. indica in this study agree with those reported by Chanda and Mandal [44]. Taxonomic ambiguity in ariophantid snails has emerged because the species recognition was mainly dependent on shell morphology that is very similar among species [48]. Therefore, other morphological traits are needed for accurate species identification, e.g., snail’s reproductive structures that display significant differences among genera and species [49,50]. In the present study, we described morphological characteristics of the reproductive system of M. indica. The morphology of Macrochlamys penial structures is useful for species-level taxonomy [47,50]. In agreement with Roy [30], the penis of M. indica contains a distinct median constriction (Figure 5E). This constriction is weak in M. coleus [49] and absent in other Macrochlamys species [17,50,51]. The gametolytic organ of M. indica consists of an extended proximal gametolytic duct and a distal gametolytic sac (Figure 5A) which is a genus-specific distinctive trait of Macrochlamys [30,50]. The elongated epiphallus with a spirally coiled epiphallic caecum (Figure 5D) is a distinctive feature of Macrochlamys that distinguishes this genus from Sarika which has a straight epiphallic caecum [47]. The dart apparatus of M. indica is a major auxiliary copulatory organ possessing four distinct regions and described for the first time by Roy [30]. A protruding dart lip separates the dart from the rest of the dart body. The dart is a non-disposable structure, so the dart retractor muscle may aid the dart eversion and retraction during copulation. The development of a thick, brownish tissue on the free oviduct was described in different Macrochlamys species [50]. In the present study, the examination of an M. indica reproductive system showed a brownish, muscular tissue that is developed at the connection of the vagina, free oviduct, and gametolytic organ (Figure 5C). Based on its position between the vagina and the free oviduct, this brownish tissue in Macrochlamys was termed as the vaginoviducal capsule [30]. In an earlier study on some helicarionid snails, Hyman et al. [52] characterized a variously-shaped capsular gland on the distal part of the free oviduct. This gland may have structural relationships with the vaginoviducal capsule of Macrochlamys and needs further investigation [30]. The structural development of the vaginoviducal capsule along with genitalia may be a species-specific trait in Macrochlamys [30]. Nevertheless, this vaginoviducal capsule is poorly-developed in M. kelantanensis [50] and totally absent in M. petrosa [51].
The integration of molecular data with morphological characteristics has helped in resolving many discrepancies of closely related snails [48,53]. For example, Pholyotha et al. [48] used phylogenetic analysis of COI, 16S, and 28S sequences to recognize Taphrenalla Pholyotha & Panha gen. nov., formerly described as Macrochlamys, as a new and closely related genus to its sibling genus Macrochlamys. In this study, the phylogenetic analysis obtained from DNA sequences of the mitochondrial COI and 16S regions confirmed the identity of M. indica collected for the first time from Saudi Arabia. The closest COI and 16S homologous sequences to M. indica were either recognized as Macrochlamys or Sarika, closely sister genera [48]. The average genetic divergence within COI sequences was 0.4%, confirming the identity M. indica. Generally, the intra-specific genetic divergences of COI within the same snail species range from 0–2.4% [48]. However, inter-specific genetic divergences among species of the same genus range from 3.0–7.7% [48,54]. For 16S, the same Saudi haplotype was recovered from Japan (LC365393; Macrochlamys sp.), Thailand (MT741772; Sarika sp.), and Bangladesh (MW685665; Sarika bocourti). Consequently, we expect that M. indica is becoming a problematic invasive species, especially after Kudo et al. [19] proposed its introduction to and spread in Japan from Bangladesh and West Bengal. To be able to distinguish M. indica from other closely related sails, DNA-based markers should be used. In addition, more studies using morphological and molecular markers are needed to investigate Macrochlamys in its native habitats.

5. Conclusions

The occurrence of the alien snail M. indica, a representative of the family Ariophantidae, is confirmed for the first time in Saudi Arabia (13 localities in 8 regions). We have not found any specimens of M. indica in either natural habitats or open fields, however, the infested nurseries can be focal points for spreading this invasive pestiferous snail and may impose great threats on crops in Saudi Arabia. We recommend that the Saudi agricultural authorities implement control measurements in order to eradicate or at least restrict the dissemination of M. indica from nurseries to natural habitats and agricultural fields.

Author Contributions

Conceptualization, Y.A. and A.A.S.; methodology, Y.A., A.A.S., A.S.A.-S. and A.A.A.; software, A.A.S.; validation, A.A.S., Y.A. and A.S.A.-S.; formal analysis, A.A.S.; investigation, Y.A., A.S.A.-S., A.A.S. and A.A.A.; resources, Y.A. and A.S.A.-S.; data curation, A.A.S.; writing—original draft preparation, Y.A. and A.A.S.; writing—review and editing, Y.A. and A.A.S.; visualization, A.A.S.; supervision, A.S.A.-S.; project administration, Y.A. and A.S.A.-S.; funding acquisition, Y.A. All authors have read and agreed to the published version of the manuscript.

Funding

This project was funded by the National Plan for Science, Technology and Innovation (MAARIFAH), King Abdulaziz City for Science and Technology, Kingdom of Saudi Arabia, Award Number (2-17-04-001-0040).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

DNA sequences are available in NCBI-GenBank (https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 21 October 2022)) under the accession numbers OK559629–OK559642, ON469564–ON469573, OK559644–OK559657, and ON468668–ON468677.

Acknowledgments

The authors express their thanks to Saad A. El-Sonbati for his help in generating the snail distribution map and photos. The authors thank the RSSU at King Saud University for their technical support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Barker, G.M. The Biology of Terrestrial Molluscs; CABI publishing: New York, NY, USA, 2001; p. 558. [Google Scholar]
  2. Lydeard, C.; Cowie, R.H.; Ponder, W.F.; Bogan, A.E.; Bouchet, P.; Clark, S.A.; Cummings, K.S.; Frest, T.J.; Garominy, O.; Herbert, D.G.; et al. The global decline of nonmarine mollusks. BioScience 2004, 54, 321–330. [Google Scholar] [CrossRef]
  3. Kerney, M.P.; Cameron, R.A.D. Field Guide to the Land Snails of BRITAIN and North-West Europe; Collins: London, UK, 1979; p. 288. [Google Scholar]
  4. Baur, B.; Raboud, C. Life history of the land snail Arianta arbustorum along an altitudinal gradient. J. Anim. Ecol. 1988, 57, 71–87. [Google Scholar] [CrossRef]
  5. Schmera, D.; Baur, B. Gastropod communities in alpine grasslands are characterized by high beta diversity. Community Ecol. 2014, 15, 246–255. [Google Scholar] [CrossRef] [Green Version]
  6. Cowie, R.H.; Robinson, D.G. Pathways of introductions of nonindigenous land and freshwater snails and slugs. In Invasive Species Vectors and Management Strategies; Carlton, J., Ruiz, G.M., Eds.; Island Press: Washington, DC, USA, 2003; pp. 93–122. [Google Scholar]
  7. Mc Donnell, M.J.; Hahs, A.K. Adaptation and adaptedness of organisms to urban environments. Annu. Rev. Ecol. Evol. Syst. 2015, 46, 261–280. [Google Scholar] [CrossRef] [Green Version]
  8. Robinson, D.G. Alien invasions: The effects of the global economy on nonmarine gastropod introductions into the United States. Malacologia 1999, 41, 413–438. [Google Scholar]
  9. Araya, J.F. Current status of the non-indigenous molluscs in Chile, with the first record of Otala punctata (Müller, 1774) (Gastropoda: Helicidae) in the country and new records for Cornu aspersum (Müller, 1774) and Deroceras laeve (Müller, 1774). J. Nat. Hist. 2015, 49, 1731–1761. [Google Scholar] [CrossRef]
  10. Godan, D. Pest Slugs and Snails, Biology and Control; Springer: Berlin/Heidelberg, Germany, 1983; p. 445. [Google Scholar]
  11. Barker, G.M. Molluscs as Crop Pests; CABI publishing: New York, NY, USA, 2002; p. 400. [Google Scholar]
  12. Michailides, T.J.; Morgan, D.P. Effect of snail (Helix aspersa) damage on Botrytis gray mold caused by Botrytis cinerea in kiwifruit. Plant Dis. 1996, 80, 1141–1146. [Google Scholar] [CrossRef]
  13. Borkakati, R.N.; Gogoi, R.; Borah, B.K. Snail: From present perspective to the history of Assam. Asian Agri-Hist. 2009, 13, 227–234. [Google Scholar]
  14. Valente, R.; Robles, M.D.R.; Diaz, J.I. Gastropods as intermediate hosts of Angiostrongylus spp. in the Americas: Bioecological characteristics and geographical distribution. Mem. Inst. Oswaldo Cruz 2020, 115, e200236. [Google Scholar] [CrossRef]
  15. Barker, G.M.; Watts, C. Management of the Invasive Alien Snail Cantareus Aspersus on Conservation Land; Doc Science Internal Series 31; Department of Conservation: Wellington, New Zealand, 2002; p. 29. [Google Scholar]
  16. Ramakrishna, S.; Mitra, S.C.; Dey, A. Annotated checklist of Indian land molluscs. Rec. Zool. Surv. India 2010, 306, 1–359. [Google Scholar]
  17. Sajan, S.; Tripathy, B.; Chandra, K.; Sivakumar, K. A new species of the genus Macrochlamys Gray, 1847 (Stylommatophora: Ariophantidae) from western Himalaya. Indian J. Nat. Hist. 2019, 53, 797–813. [Google Scholar] [CrossRef]
  18. Sajan, S.K.; Das, S.; Tripathy, B.; Biswas, T. Malacofaunal inventory in Chintamoni Kar Bird Sanctuary, West Bengal, India. J. Threat. Taxa 2021, 13, 17807–17826. [Google Scholar] [CrossRef]
  19. Kudo, K.; Kagawa, O.; Ito, S.; Wada, S.; Nishi, H.; Shariar, S.M.; Yamazaki, D.; Hirano, T.; Chiba, S. Species identification and invasion pathways of an introduced snail Macrochlamys sp. in Japan. BioInvasions Rec. 2022, 11. in press. [Google Scholar]
  20. Ueshima, R. Macrochlamys sp., a helicarionid land snail newly introduced to Japan: Discovery of naturalized populations in Okinawa and the possible pathway of introduction. Chiribotan 2009, 39, 116. [Google Scholar]
  21. Sajan, S.K.; Tripathy, B.; Biswas, T. Species inventory of land and freshwater molluscs from Andhra Pradesh and Telangana states of India. Rec. Zool. Surv. India 2018, 118, 141–155. [Google Scholar] [CrossRef]
  22. Singh, S.; Sandhu, R.K.; Aravind, N.A. Record of pestiferous land snail, Macrochlamys indica Godwin-Austen 1883 (Gastropoda: Ariophantidae), on citrus and guava plants in Punjab, India. Rec. Zool. Surv. India 2020, 120, 293–296. [Google Scholar]
  23. Raut, S.K.; Ghose, K.C. Pestiferous Land Snails of India. Tech. Monograph, No. 11; Zoological Survey of India: Calcutta, India, 1984; pp. 1–151. [Google Scholar]
  24. Jayashankar, M.; Reddy, M.S.; Ramakrishna, S. Incidence of the common garden snail, Macrochlamys indica Benson, 1832 (Gastropoda: Ariophantidae) in Bangalore region. Bioscan 2015, 10, 1003–1006. [Google Scholar]
  25. Cowie, R.H.; Dillon, R.T.; Robinson, D.G.; Smith, J.W. Alien non-marine snails and slugs of priority quarantine importance in the United States: A preliminary risk assessment. Am. Malacol. Bull. 2009, 27, 113–132. [Google Scholar] [CrossRef]
  26. Ahmed, S.I. Insect pest problems of neem. In Proceedings of the Workshop on Neem (Azadirachta Indica) AFRI, Jodhpur, India, 8 December 1998; pp. 15–16. [Google Scholar]
  27. Kumar, S.; Ahmed, S.I. New records of pestiferous land molluscs from Rajasthan, India. Rec. Zool. Surv. India 2000, 98, 67–70. [Google Scholar] [CrossRef]
  28. Blacket, M.J.; Shea, M.; Semeraro, L.; Malipatil, M.B. Introduced Helicidae garden snails in Australia: Morphological and molecular diagnostics, species distributions and systematics. Rec. Aust. Mus. 2016, 68, 99–116. [Google Scholar] [CrossRef] [Green Version]
  29. American Veterinary Medical Association. AVMA Guidelines for the Euthanasia of Animals. Available online: https://www.avma.org/sites/default/files/2020-02/Guidelines-on-Euthanasia-2020.pdf (accessed on 5 May 2020).
  30. Roy, S. Macro- and microscopic morphology of the reproductive system of the terrestrial snail Macrochlamys indica (Godwin-Austen, 1883) (Eupulmonata, Stylommatophora, Ariophantidae). Mollusc. Res. 2020, 40, 379–396. [Google Scholar] [CrossRef]
  31. Palumbi, S.; Martin, A.; Romano, S.; Mcmillan, W.O.; Stice, L.; Grabowwski, G. The Simple Fool’s Guide to PCR, version 2.0; Department of Zoology, University of Hawaii: Honolulu, HI, USA, 1991; p. 45. [Google Scholar]
  32. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  33. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid. Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  34. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. Mega X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  35. Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evo. 1980, 16, 111–120. [Google Scholar] [CrossRef] [PubMed]
  36. El-Alfy, N.Z.; Abdel-Rehim, A.H.; Al-Ali, K.A. Karyotype, meiosis and sperm formation in the land snail Macrochlamys indica. Qatar Univ. Sci. J. 1994, 14, 122–128. [Google Scholar]
  37. Jahan, S.M.; Kulsum, M.U.; Rahman, M.R.; Sarkar, M.M.; Pramanik, M.N. Comparative ecology of Macrochlamys indica and Macrochlamys opiparus (Stylommatophora: Ariophantidae). J. Ecobiol. 2002, 14, 307–318. [Google Scholar]
  38. Mitra, S.C. Pictorial Handbook-Indian Land Snails (Selected Species); Zoological Survey of India: Kolkata, India, 2005; p. 334. [Google Scholar]
  39. Raheem, D.C.; Taylor, H.; Ablett, J.; Preece, R.C.; Aravind, N.A.; Naggs, F. A systematic revision of the land snails of the Western Ghats of India. Trop. Nat. Hist. Supplement 2014, 4, 1–294. [Google Scholar]
  40. Budha, P.B.; Naggs, F.; Backeljau, T. Annotated checklist of the terrestrial gastropods of Nepal. Zookeys 2015, 492, 1–48. [Google Scholar] [CrossRef] [Green Version]
  41. Faiz, L.Z. Diversity and Damage Assessment of Snail in Cultivated Crops of Neelabut Bagh Azad Jammu and Kashmir (Pakistan). J. Biores. Manag. 2020, 7, 11. [Google Scholar] [CrossRef]
  42. Maassen, W.J.M. A Preliminary Checklist of the Non-Marine Molluscs of West-Malaysia “A Handlist”; Malacological Contact Group De Kreukel: Amsterdam, The Netherlands, 2001; pp. 1–161. [Google Scholar]
  43. Phung, C.C.; Yu, F.T.Y.; Liew, T.S. A checklist of land snails from the west coast islands of Sabah, Borneo (Mollusca, Gastropoda). ZooKeys 2017, 673, 49–104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Agudo-Padrón, I.; Luz, J.S. First confirmed occurrence record of a Indo-Asiatic land snail in Brazil and the Americas. Rev. Minerva 2017, 1, 19–27. [Google Scholar]
  45. Chanda, A.; Mandal, B. Major pestiferous snails and slugs of Paschim Medinipur: An account on diagnosis, damage and control. Int. Res. J. Basic Appl. Sci. 2020, 5, 13–22. [Google Scholar]
  46. Nandy, G.; Barman, H.; Pramanik, S.; Banerjee, S.; Aditya, G. Land snail assemblages and microhabitat preferences in the urban areas of Kolkata, India. J. Urban Ecol. 2022, 8, juac004. [Google Scholar] [CrossRef]
  47. Blandford, W.T.; Godwin, H.H. Mollusca: Testacellidae and Zonitidae. Fauna Br. India 1908, 32, 95–96. [Google Scholar]
  48. Pholyotha, A.; Sutcharit, C.; Tongkerd, P.; Jeratthitikul, E.; Panha, S. Integrative systematics reveals the new land-snail genus Taphrenalla (Eupulmonata: Ariophantidae) with a description of nine new species from Thailand. Contrib. Zool. 2020, 90, 21–69. [Google Scholar] [CrossRef]
  49. Schileyko, A.A. Treatise on recent terrestrial pulmonate molluscs. Part 10. Ariophantidae, Ostracolethidae, Ryssotidae, Milacidae, Dyakiidae, Staffordiidae, Gastrodontidae, Zonitidae, Daudebardiidae, Parmacellidae. Ruthenica 2003, 2, 1309–1466. [Google Scholar]
  50. Pholyotha, A.; Sutcharit, C.; Panha, S. The land snail genus Macrochlamys Gray, 1984 from Thailand, with descriptions of five new species (Pulmonata: Ariophantidae). Raffles Bull. Zool. 2018, 66, 763–781. [Google Scholar]
  51. Deshmukh, P.S.; Dummalod, C.B.; Dama, L.B. A morphological study of reproductive system of pestiferous land snail Macrochlamys petrosa from Aurangabad, Maharashtra, India. DAV Int. J. Sci. 2012, 1, 68–71. [Google Scholar]
  52. Hyman, I.T.; Lamborena, I.; Köhler, F. Molecular phylogenetics and systematic revision of the south-eastern Australian Helicarionidae (Gastropoda, Stylommatophora). Contrib. Zool. 2017, 86, 51–95. [Google Scholar] [CrossRef] [Green Version]
  53. Hyman, I.T. Three new genera and five new species of Helicarionidae from southeastern Australia (Pulmonata: Stylommatophora: Helicarionoidea). Molluscan Res. 2007, 27, 89–104. [Google Scholar]
  54. Pholyotha, A.; Sutcharit, C.; Tongkerd, P.; Panha, S. Systematic revision of the limestone karst-restricted land snail genus Aenigmatoconcha (Eupulmonata: Helicarionidae), with description of a new species. Eur. J. Taxon. 2021, 767, 55–82. [Google Scholar] [CrossRef]
Agriculture 12 01756 g001 550
Figure 1. Shell measurements used for characterizing Macrochlamys indica. Abbreviations: SH, shell height; SW, shell width, AH, aperture height; AW, aperture width; HSP, height of spire, and HBW, height of the body whorl.
Figure 1. Shell measurements used for characterizing Macrochlamys indica. Abbreviations: SH, shell height; SW, shell width, AH, aperture height; AW, aperture width; HSP, height of spire, and HBW, height of the body whorl.
Agriculture 12 01756 g001
Agriculture 12 01756 g002 550
Figure 2. Distribution map of Macrochlamys indica in Saudi Arabia. 1. Tabouk, 2. Al-Madinah, 3. Al-Qassim, 4. Riyadh, 5. Al-Ahsaa, 6. Taif, 7. Abha, and 8. Jazan.
Figure 2. Distribution map of Macrochlamys indica in Saudi Arabia. 1. Tabouk, 2. Al-Madinah, 3. Al-Qassim, 4. Riyadh, 5. Al-Ahsaa, 6. Taif, 7. Abha, and 8. Jazan.
Agriculture 12 01756 g002
Agriculture 12 01756 g003 550
Figure 3. The shell of Macrochlamys indica of SAFN17a specimen collected from Wardet Al-Soltan nursery, Taif, Saudi Arabia in apertural view (A), lateral view (B), apical view (C), and basal view (D).
Figure 3. The shell of Macrochlamys indica of SAFN17a specimen collected from Wardet Al-Soltan nursery, Taif, Saudi Arabia in apertural view (A), lateral view (B), apical view (C), and basal view (D).
Agriculture 12 01756 g003
Agriculture 12 01756 g004 550
Figure 4. External morphology of Macrochlamys indica. (A–C) living snail collected from Al-Yosif nursery, Tabouk ((A) lateral view; (B) dorsal view; (C) ventral view); (D) preserved snail collected from Magic Rose nursery, Tabouk; (E) caudal foss; (F) caudal horn; (G) living snail found on an ornamental plant in Al-Habry nursery, Riyadh. Abbreviations: cf, caudal foss; ch, caudal horn; go, genital organs; lsl, left shell lobe; ldl, left dorsal lobe; rdl, right dorsal lobe; rsl, right shell lobe; pn, pneumostome.
Figure 4. External morphology of Macrochlamys indica. (A–C) living snail collected from Al-Yosif nursery, Tabouk ((A) lateral view; (B) dorsal view; (C) ventral view); (D) preserved snail collected from Magic Rose nursery, Tabouk; (E) caudal foss; (F) caudal horn; (G) living snail found on an ornamental plant in Al-Habry nursery, Riyadh. Abbreviations: cf, caudal foss; ch, caudal horn; go, genital organs; lsl, left shell lobe; ldl, left dorsal lobe; rdl, right dorsal lobe; rsl, right shell lobe; pn, pneumostome.
Agriculture 12 01756 g004
Agriculture 12 01756 g005 550
Figure 5. Reproductive system of Macrochlamys indica collected from My Garden nursery, Al-Ahsaa. (A) general view of genitalia; (B) enlarged view of proximal portion of the genitalia; (C) magnified view of prostate gland, vas deferens, and vaginoviducal capsule; (D) enlarged view of epiphallus and epiphallic caecum; (E) magnified view of penis; (F) hermaphrodite duct and albumen gland. Abbreviations: ag, albumen gland; at, genital atrium; db, dart bag; de, distal epiphallus; dn, dart neck; drm, dart retractor muscle; ec, epiphallic caecum; fl, flagellum; fo, free oviduct; gd, gametolytic duct; gs, gametolytic sac; hd, hermaphrodite duct; mc, median constriction; mds, median dart shaft; ov, oviducal channel; p, penis; pe, proximal epiphallus; pr, prostate gland; rpm, penial retractor muscle; vd, vas deferens; vo, vaginoviducal.
Figure 5. Reproductive system of Macrochlamys indica collected from My Garden nursery, Al-Ahsaa. (A) general view of genitalia; (B) enlarged view of proximal portion of the genitalia; (C) magnified view of prostate gland, vas deferens, and vaginoviducal capsule; (D) enlarged view of epiphallus and epiphallic caecum; (E) magnified view of penis; (F) hermaphrodite duct and albumen gland. Abbreviations: ag, albumen gland; at, genital atrium; db, dart bag; de, distal epiphallus; dn, dart neck; drm, dart retractor muscle; ec, epiphallic caecum; fl, flagellum; fo, free oviduct; gd, gametolytic duct; gs, gametolytic sac; hd, hermaphrodite duct; mc, median constriction; mds, median dart shaft; ov, oviducal channel; p, penis; pe, proximal epiphallus; pr, prostate gland; rpm, penial retractor muscle; vd, vas deferens; vo, vaginoviducal.
Agriculture 12 01756 g005
Agriculture 12 01756 g006 550
Figure 6. An alignment of amino acid sequences deduced from COI DNA sequences of different snail specimens collected from Saudi Arabia (SAJN9a, M. indica) and other closely related homologous sequences retrieved from the NCBI-GenBank database. Dashes refer to missing positions and dots indicate that amino acid residues are identical at these positions. The one star indicates that the COI sequence of MT803095 accession number is misidentified and the two stars indicates that the COI sequence of MF476193 accession number has many artifact DNA nucleotides as all of them are “Gs” and they produce different amino acids compared with their closely related taxa.
Figure 6. An alignment of amino acid sequences deduced from COI DNA sequences of different snail specimens collected from Saudi Arabia (SAJN9a, M. indica) and other closely related homologous sequences retrieved from the NCBI-GenBank database. Dashes refer to missing positions and dots indicate that amino acid residues are identical at these positions. The one star indicates that the COI sequence of MT803095 accession number is misidentified and the two stars indicates that the COI sequence of MF476193 accession number has many artifact DNA nucleotides as all of them are “Gs” and they produce different amino acids compared with their closely related taxa.
Agriculture 12 01756 g006
Agriculture 12 01756 g007 550
Figure 7. Maximum Likelihood tree obtained from aligned COI sequences from Macrochlamys and Sarika snails. The star-labeled SAJN9a COI Saudi haplotype represents 24 sequences obtained from 10 snail populations collected from different locations in Saudi Arabia (SA). The other homologous COI sequences were retrieved from the NCBI-GenBank database. Helix pomatia (accession number KU869819) was used as an outgroup taxon. Bootstrap values (1000 replicates) are given on the tree branches.
Figure 7. Maximum Likelihood tree obtained from aligned COI sequences from Macrochlamys and Sarika snails. The star-labeled SAJN9a COI Saudi haplotype represents 24 sequences obtained from 10 snail populations collected from different locations in Saudi Arabia (SA). The other homologous COI sequences were retrieved from the NCBI-GenBank database. Helix pomatia (accession number KU869819) was used as an outgroup taxon. Bootstrap values (1000 replicates) are given on the tree branches.
Agriculture 12 01756 g007
Table
Table 1. Sampling data and GenBank accession numbers for Macrochlamys indica specimens collected from different locations in Saudi Arabia.
Table 1. Sampling data and GenBank accession numbers for Macrochlamys indica specimens collected from different locations in Saudi Arabia.
RegionSiteSpecimen IDCollection DateGenBank Accession NumberLatitudeLongitudeAltitude
COI16S
TaboukAl-Yosif NurserySATN2a29.X.2020OK559635OK559650N28.429333E36.62695739
SATN2bOK559636OK559651
SATN2cOK559637OK559652
SATN2dOK559638OK559653
SATN2eOK559639OK559654
SATN2fOK559633OK559648
SATN2gOK559634OK559649
Magic Rose NurserySATN18a6.VI.2021OK559640OK559655N28.428683E36.6120166757
SATN18bOK559641OK559656
RiyadhAl-Hair NurserySARN2a11.IV.2021OK559629OK559644N24.520694E46.7771120657
SARN2bOK559630OK559645
Nursery 10SARN3a11.IV.2021OK559631OK559646N24.587879E46.7227594668
SARN3bOK559632OK559647
Al-Habry NurserySARN7a5.II.2022ON469564ON468668E24.7724166N46.667567662
SARN7bON469565ON468669
TaifBostan Al-Zohor NurserySAFN16a2.X.2021ON469568ON468672N21.269283E40.40703331679
SAFN16bON469569ON468673
Wardet Al-Soltan NurserySAFN17a2.X.2021--N21.340683E40.44011661609
SAFN17b
Rose City nurserySAFN24a2.X.2021--N21.280333E40.4031121659
JazanAlam Domiat NurserySAJN9a28.XI.2020OK559642OK559657N17.83765E42.38015255
Al-AhsaaMy Garden NurserySAHN23a4.XI.2021ON469566ON468670N25.34842E49.57065140
SAHN23bON469567ON468671
AbhaAbeer Alworod NurserySAAN4a2.III.2022ON469570ON468674N18.58080E42.700482150
SAAN4bON469571ON468675
Al-MadinahAl-Wafy NurserySAMN1a30.III.2022ON469572ON468676N24.5468E39.57833617
SAMN1bON469573ON468677
Al-QassimAl-Fatah NurserySAQN1a13.V.2022--N26.385945E44.064817650
Table
Table 2. The Primer-pairs and PCR conditions used for amplifying the COI and 16S rRNA regions from Macrochlamys indica.
Table 2. The Primer-pairs and PCR conditions used for amplifying the COI and 16S rRNA regions from Macrochlamys indica.
Gene Primer-Pairs (5’-3’)Cycling ConditionsReference
COILCO1490: GGTCAACAAATCATAAAGATATTGG
HCO2198: TAAACTTCAGGGTGACCAAAAAATCA		94°: 5 min; 94°: 30 s, 42°: 1 min, 72°: 1 min, 35 cycles; 72°: 5 minFolmer et al. 1994
[32]
16S16SAR: CGCCTGTTTATCAAAAACAT
16SBR: CCGGTCTGAACTCAGATCACGT		94°: 5 min; 94°: 30 s, 50°: 1 min, 72°: 1 min, 35 cycles; 72°: 5 minPalumbi et al. 1991
[33]
Table
Table 3. Morphometric characteristics of Macrochlamys indica.
Table 3. Morphometric characteristics of Macrochlamys indica.
Characters Means ± SDRanges
Number of shell whorls5.42 ± 0.265.00–6.25
Shell width SW (mm)17.32 ± 1.7811.35–22.65
Shell height SH (mm)9.76 ± 1.028.00–12.20
Aperture width AW (mm)9.21 ± 0.917.30–12.55
Aperture height AH (mm)7.82 ± 0.646.60–8.65
Height of spire HSP1.38 ± 0.251.00–1.95
Height of the body whorl HBW (mm)6.22 ± 0.635.00–7.75
SH/SW ratio0.57 ± 0.080.39–0.81
AH/AW ratio0.85 ± 0.080.86–1.14
AW/HSP ratio6.91 ± 1.3610.04–4.40
HBW/AH ratio0.80 ± 0.09 1.01–0.63
Table
Table 4. Pairwise p-distances calculated from COI sequences from Macrochlamys and their closely relative snails.
Table 4. Pairwise p-distances calculated from COI sequences from Macrochlamys and their closely relative snails.
123456789101112131415
MH819411
Macrochlamys
India (1)
EF015438
Macrochlamys
Australia (2)		0.002
LC365425
Macrochlamys
Japan (3)		0.0020.000
MT803095
Sarika
Thailand (4)		0.0080.0060.006
MF476193
Macrochlamys
India (5)		0.0280.0260.0260.024
SARN2a
Macrochlamys indica
SA (6)		0.0060.0040.0040.0020.022
MT364985
Macrochlamys tanymentula
Thailand (7)		0.1270.1290.1290.1310.1490.129
MT906154
Macrochlamys sp.
Thailand (8)		0.1410.1430.1430.1390.1600.1410.115
MT894116
Sarika dugasti
Thailand (9)		0.1270.1290.1290.1270.1390.1250.1070.093
MT894098
Sarika hainesi
Thailand (10)		0.1210.1230.1230.1210.1330.1190.1130.1050.091
MT894066
Sarika resplendens Thailand (11)		0.1270.1290.1290.1270.1410.1250.1170.1070.0790.071
MT894063
Sarika resplendens
Thailand (12)		0.1250.1270.1270.1250.1390.1230.1170.1090.0790.0690.002
MT894068
Sarika resplendens
Thailand (13)		0.1270.1290.1290.1270.1390.1250.1110.1050.0770.0670.0120.014
MT894067
Sarika resplendens Thailand (14)		0.1250.1270.1270.1250.1390.1230.1090.0950.0830.0480.0360.0380.032
MT894065
Sarika resplendens
Thailand (15)		0.1270.1290.1290.1270.1410.1250.1190.1110.0810.0710.0040.0020.0160.040
KU869819
Helix pomatia (16)		0.2140.2160.2160.2160.2360.2160.2060.2000.1940.1920.1980.1980.1940.1900.200
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Abobakr, Y.; Al-Sarar, A.S.; Alzabib, A.A.; Saleh, A.A. Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia. Agriculture 2022, 12, 1756. https://doi.org/10.3390/agriculture12111756

AMA Style

Abobakr Y, Al-Sarar AS, Alzabib AA, Saleh AA. Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia. Agriculture. 2022; 12(11):1756. https://doi.org/10.3390/agriculture12111756

Chicago/Turabian Style

Abobakr, Yasser, Ali S. Al-Sarar, Ali A. Alzabib, and Amgad A. Saleh. 2022. "Morphological and Molecular Characterization of the Invasive Pestiferous Land Snail Macrochlamys indica Godwin-Austen, 1883 (Gastropoda: Ariophantidae) from Saudi Arabia" Agriculture 12, no. 11: 1756. https://doi.org/10.3390/agriculture12111756

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop